|
InvivoGen
hek-blue il-2 cells Hek Blue Il 2 Cells, supplied by InvivoGen, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il2/HEK-Blue+IL-2+Cells/custom%40hkb-il2-2%4042430242 Average 95 stars, based on 1 article reviews
hek-blue il-2 cells - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
Nektar Inc
il2 prodrug nktr 214 Il2 Prodrug Nktr 214, supplied by Nektar Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il2/214+nktr/us12648962-233-15-20 Average 86 stars, based on 1 article reviews
il2 prodrug nktr 214 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
InvivoGen
hek blue il Hek Blue Il, supplied by InvivoGen, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il2/HEK-Blue+IL-2+Cells/pm42242227-239-13-16 Average 95 stars, based on 1 article reviews
hek blue il - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
OriGene
acagacactggcaacattgcgg il 2 ![]() Acagacactggcaacattgcgg Il 2, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il2/Il2/bio_rxiv__64898__2026__05__21__726749-108-11-5 Average 94 stars, based on 1 article reviews
acagacactggcaacattgcgg il 2 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Novartis
il2 ![]() Il2, supplied by Novartis, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il2/il2/pm42167233-745-9-13 Average 86 stars, based on 1 article reviews
il2 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Mabtech Inc
il2 ![]() Il2, supplied by Mabtech Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il2/2+il/pm42150061-362-32-33 Average 86 stars, based on 1 article reviews
il2 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Charles River Laboratories
cmv il2 il15 1 1jic jiccrl mice ![]() Cmv Il2 Il15 1 1jic Jiccrl Mice, supplied by Charles River Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il2/balb+c+mice/bio_rxiv__64898__2026__05__10__723228-111-9-13 Average 86 stars, based on 1 article reviews
cmv il2 il15 1 1jic jiccrl mice - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Koatech Technology Corporation
nod shi scid il2 receptor gamma null nog mice ![]() Nod Shi Scid Il2 Receptor Gamma Null Nog Mice, supplied by Koatech Technology Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il2/gamma+il2+mice+nod+nog+null+receptor+scid+shi/pm42128301-77-0-9 Average 86 stars, based on 1 article reviews
nod shi scid il2 receptor gamma null nog mice - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
Journal: bioRxiv
Article Title: A fusion Cell-Permeable C16orf74 Peptide Selectively Disrupts Calcineurin-NFAT Interaction and Inhibits T-cell Activation Without Cytotoxicity
doi: 10.64898/2026.05.21.726749
Figure Lengend Snippet: (A) Evaluation of NFAT transcriptional activity using an immune co-culture bioassay. Jurkat T cells stably expressing a luciferase reporter under the control of an NFAT-response element were co-cultured with Raji antigen-presenting cells. Cells were treated with vehicle (activated cells), the positive control CsA (150 nM), or the peptide conjugates R11-C16 or TAT-C16 (10 µM). Luminescence was measured and is expressed relative to the activated control. Data are presented as mean ± SD of independent replicates. ****P<0.001; ***P<0.005; ns – non significant. (B) Quantitative RT-PCR analysis of IL-2 gene expression in Jurkat T cells. Cells were pre-treated with R11-C16 or CsA for 1.5 hours, followed by stimulation with PMA and ionomycin for 6 hours. Results are expressed as log fold change relative to unstimulated cells ("Cells only"). Data are presented as mean ± SD. ****P<0.001; ***P<0.005; ns – non significant.
Article Snippet: Primer sequences were obtained from
Techniques: Activity Assay, Co-Culture Assay, Bioassay, Stable Transfection, Expressing, Luciferase, Control, Cell Culture, Positive Control, Quantitative RT-PCR, Gene Expression