Review





Similar Products

99
Thermo Fisher gene exp ifnb1 hs01077958 s1
Characterization of RVFV infection and host response in human trophoblast stem cells (hTSCs) by immunofluorescence, qRT-PCR, and western blotting (A) Representative immunofluorescence microscopy of uninfected controls and RVFV strain ZH548-infected human trophoblast stem cells (hTSCs) from Donor 1 at 24 h post-infection (hpi). Cells were stained with lineage-specific markers: cytotrophoblasts (CyT) with E-Cadherin and TEAD4 (red), syncytiotrophoblasts (STB) with hCG-β (red), and extravillous trophoblasts (EvT) with HLA-G (red). RVFV infection was detected using an anti-RVFV Gn and NSs antibody (green), and nuclei were counterstained with DAPI (blue). Scale bars, 10 μm (main panels). (B) Viral replication kinetics of RVFV in hTSCs. Cells were infected with RVFV at an MOI of 1. Total RNA was extracted at 0, 24, and 48 hpi, and RVFV L gene expression was quantified by qRT-PCR. (C) Quantification of infectious progeny virus release. Viral titers in culture supernatants collected at 24 and 48 h post-infection (hpi) were determined using a fluorescence-based titration assay. The bar graph displays the log10-transformed infectious titers (fluorescence-based TCID50/mL) for three independent donors (donors 1–3). Error bars represent the standard error of the mean (SEM) of technical replicates. ∗ p < 0.05 (two-way ANOVA), indicating a statistically significant increase in viral titers over time. Non-significant differences are not labeled. (D and E) Western blotting analysis of RVFV viral protein expression and quantification. Infection was performed as described in B. Lysates collected at 0, 24, and 48 hpi were analyzed for RVFV Gn and NSs proteins, normalized to β-actin. Each symbol represents a single data point from an independent experiment ( n = 2). Statistical analysis was not performed due to the limited sample size. (F and G) Antiviral immune response (F) and inflammatory cytokine gene expression (G) in RVFV-infected hTSCs. The same synthesized cDNA from B was used to analyze the expression of type I ( IFNA1, <t>IFNB1</t> ) and type III ( IFNL1 ) interferons (F), as well as inflammatory genes ( IL-6, IL-8 , and TNF-α ) (G). General quantitative analysis (B, F, and G): For all qRT-PCR data, relative expression levels were calculated using the 2-ΔΔCt method, normalized to uninfected cells at 0 hpi. Data are stratified by donor to illustrate biological variability: donor 1 (red circles), donor 2 (purple squares), and donor 3 (blue triangles). Each symbol represents the mean of technical replicates, and horizontal lines indicate the mean of biological replicates. Statistical analyses were performed using two distinct approaches: (1) two-way ANOVA assessed donor variability, indicating no significant difference between donors across conditions, with the exception of IL-6 at 24 hpi in F (# p < 0.05); (2) One-way ANOVA followed by Dunnett’s post hoc test assessed differences against the 0 hpi baseline for individual donors, indicated by asterisks (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001).
Gene Exp Ifnb1 Hs01077958 S1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifnb/Gene+Exp%2E+IFNB1%2C+Hs01077958_s1/pmc13098504-328-28-4
Average 99 stars, based on 1 article reviews
gene exp ifnb1 hs01077958 s1 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

97
PBL Assay human ifnb elisa kit
Characterization of RVFV infection and host response in human trophoblast stem cells (hTSCs) by immunofluorescence, qRT-PCR, and western blotting (A) Representative immunofluorescence microscopy of uninfected controls and RVFV strain ZH548-infected human trophoblast stem cells (hTSCs) from Donor 1 at 24 h post-infection (hpi). Cells were stained with lineage-specific markers: cytotrophoblasts (CyT) with E-Cadherin and TEAD4 (red), syncytiotrophoblasts (STB) with hCG-β (red), and extravillous trophoblasts (EvT) with HLA-G (red). RVFV infection was detected using an anti-RVFV Gn and NSs antibody (green), and nuclei were counterstained with DAPI (blue). Scale bars, 10 μm (main panels). (B) Viral replication kinetics of RVFV in hTSCs. Cells were infected with RVFV at an MOI of 1. Total RNA was extracted at 0, 24, and 48 hpi, and RVFV L gene expression was quantified by qRT-PCR. (C) Quantification of infectious progeny virus release. Viral titers in culture supernatants collected at 24 and 48 h post-infection (hpi) were determined using a fluorescence-based titration assay. The bar graph displays the log10-transformed infectious titers (fluorescence-based TCID50/mL) for three independent donors (donors 1–3). Error bars represent the standard error of the mean (SEM) of technical replicates. ∗ p < 0.05 (two-way ANOVA), indicating a statistically significant increase in viral titers over time. Non-significant differences are not labeled. (D and E) Western blotting analysis of RVFV viral protein expression and quantification. Infection was performed as described in B. Lysates collected at 0, 24, and 48 hpi were analyzed for RVFV Gn and NSs proteins, normalized to β-actin. Each symbol represents a single data point from an independent experiment ( n = 2). Statistical analysis was not performed due to the limited sample size. (F and G) Antiviral immune response (F) and inflammatory cytokine gene expression (G) in RVFV-infected hTSCs. The same synthesized cDNA from B was used to analyze the expression of type I ( IFNA1, <t>IFNB1</t> ) and type III ( IFNL1 ) interferons (F), as well as inflammatory genes ( IL-6, IL-8 , and TNF-α ) (G). General quantitative analysis (B, F, and G): For all qRT-PCR data, relative expression levels were calculated using the 2-ΔΔCt method, normalized to uninfected cells at 0 hpi. Data are stratified by donor to illustrate biological variability: donor 1 (red circles), donor 2 (purple squares), and donor 3 (blue triangles). Each symbol represents the mean of technical replicates, and horizontal lines indicate the mean of biological replicates. Statistical analyses were performed using two distinct approaches: (1) two-way ANOVA assessed donor variability, indicating no significant difference between donors across conditions, with the exception of IL-6 at 24 hpi in F (# p < 0.05); (2) One-way ANOVA followed by Dunnett’s post hoc test assessed differences against the 0 hpi baseline for individual donors, indicated by asterisks (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001).
Human Ifnb Elisa Kit, supplied by PBL Assay, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifnb/Human+Interferon+Beta+1a/us12600704-809-16-21
Average 97 stars, based on 1 article reviews
human ifnb elisa kit - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

94
Boster Bio mouse ifn beta ifnb1 elisa kit boster cat
Characterization of RVFV infection and host response in human trophoblast stem cells (hTSCs) by immunofluorescence, qRT-PCR, and western blotting (A) Representative immunofluorescence microscopy of uninfected controls and RVFV strain ZH548-infected human trophoblast stem cells (hTSCs) from Donor 1 at 24 h post-infection (hpi). Cells were stained with lineage-specific markers: cytotrophoblasts (CyT) with E-Cadherin and TEAD4 (red), syncytiotrophoblasts (STB) with hCG-β (red), and extravillous trophoblasts (EvT) with HLA-G (red). RVFV infection was detected using an anti-RVFV Gn and NSs antibody (green), and nuclei were counterstained with DAPI (blue). Scale bars, 10 μm (main panels). (B) Viral replication kinetics of RVFV in hTSCs. Cells were infected with RVFV at an MOI of 1. Total RNA was extracted at 0, 24, and 48 hpi, and RVFV L gene expression was quantified by qRT-PCR. (C) Quantification of infectious progeny virus release. Viral titers in culture supernatants collected at 24 and 48 h post-infection (hpi) were determined using a fluorescence-based titration assay. The bar graph displays the log10-transformed infectious titers (fluorescence-based TCID50/mL) for three independent donors (donors 1–3). Error bars represent the standard error of the mean (SEM) of technical replicates. ∗ p < 0.05 (two-way ANOVA), indicating a statistically significant increase in viral titers over time. Non-significant differences are not labeled. (D and E) Western blotting analysis of RVFV viral protein expression and quantification. Infection was performed as described in B. Lysates collected at 0, 24, and 48 hpi were analyzed for RVFV Gn and NSs proteins, normalized to β-actin. Each symbol represents a single data point from an independent experiment ( n = 2). Statistical analysis was not performed due to the limited sample size. (F and G) Antiviral immune response (F) and inflammatory cytokine gene expression (G) in RVFV-infected hTSCs. The same synthesized cDNA from B was used to analyze the expression of type I ( IFNA1, <t>IFNB1</t> ) and type III ( IFNL1 ) interferons (F), as well as inflammatory genes ( IL-6, IL-8 , and TNF-α ) (G). General quantitative analysis (B, F, and G): For all qRT-PCR data, relative expression levels were calculated using the 2-ΔΔCt method, normalized to uninfected cells at 0 hpi. Data are stratified by donor to illustrate biological variability: donor 1 (red circles), donor 2 (purple squares), and donor 3 (blue triangles). Each symbol represents the mean of technical replicates, and horizontal lines indicate the mean of biological replicates. Statistical analyses were performed using two distinct approaches: (1) two-way ANOVA assessed donor variability, indicating no significant difference between donors across conditions, with the exception of IL-6 at 24 hpi in F (# p < 0.05); (2) One-way ANOVA followed by Dunnett’s post hoc test assessed differences against the 0 hpi baseline for individual donors, indicated by asterisks (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001).
Mouse Ifn Beta Ifnb1 Elisa Kit Boster Cat, supplied by Boster Bio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifnb/Mouse+IFN-Beta+ELISA+Kit+PicoKine/pm41985455-324-98-103
Average 94 stars, based on 1 article reviews
mouse ifn beta ifnb1 elisa kit boster cat - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
OriGene ifnb1 tgctctcctgttgtgcttctccac atagatggtcaatgcggcgtcc brzostek racine
Characterization of RVFV infection and host response in human trophoblast stem cells (hTSCs) by immunofluorescence, qRT-PCR, and western blotting (A) Representative immunofluorescence microscopy of uninfected controls and RVFV strain ZH548-infected human trophoblast stem cells (hTSCs) from Donor 1 at 24 h post-infection (hpi). Cells were stained with lineage-specific markers: cytotrophoblasts (CyT) with E-Cadherin and TEAD4 (red), syncytiotrophoblasts (STB) with hCG-β (red), and extravillous trophoblasts (EvT) with HLA-G (red). RVFV infection was detected using an anti-RVFV Gn and NSs antibody (green), and nuclei were counterstained with DAPI (blue). Scale bars, 10 μm (main panels). (B) Viral replication kinetics of RVFV in hTSCs. Cells were infected with RVFV at an MOI of 1. Total RNA was extracted at 0, 24, and 48 hpi, and RVFV L gene expression was quantified by qRT-PCR. (C) Quantification of infectious progeny virus release. Viral titers in culture supernatants collected at 24 and 48 h post-infection (hpi) were determined using a fluorescence-based titration assay. The bar graph displays the log10-transformed infectious titers (fluorescence-based TCID50/mL) for three independent donors (donors 1–3). Error bars represent the standard error of the mean (SEM) of technical replicates. ∗ p < 0.05 (two-way ANOVA), indicating a statistically significant increase in viral titers over time. Non-significant differences are not labeled. (D and E) Western blotting analysis of RVFV viral protein expression and quantification. Infection was performed as described in B. Lysates collected at 0, 24, and 48 hpi were analyzed for RVFV Gn and NSs proteins, normalized to β-actin. Each symbol represents a single data point from an independent experiment ( n = 2). Statistical analysis was not performed due to the limited sample size. (F and G) Antiviral immune response (F) and inflammatory cytokine gene expression (G) in RVFV-infected hTSCs. The same synthesized cDNA from B was used to analyze the expression of type I ( IFNA1, <t>IFNB1</t> ) and type III ( IFNL1 ) interferons (F), as well as inflammatory genes ( IL-6, IL-8 , and TNF-α ) (G). General quantitative analysis (B, F, and G): For all qRT-PCR data, relative expression levels were calculated using the 2-ΔΔCt method, normalized to uninfected cells at 0 hpi. Data are stratified by donor to illustrate biological variability: donor 1 (red circles), donor 2 (purple squares), and donor 3 (blue triangles). Each symbol represents the mean of technical replicates, and horizontal lines indicate the mean of biological replicates. Statistical analyses were performed using two distinct approaches: (1) two-way ANOVA assessed donor variability, indicating no significant difference between donors across conditions, with the exception of IL-6 at 24 hpi in F (# p < 0.05); (2) One-way ANOVA followed by Dunnett’s post hoc test assessed differences against the 0 hpi baseline for individual donors, indicated by asterisks (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001).
Ifnb1 Tgctctcctgttgtgcttctccac Atagatggtcaatgcggcgtcc Brzostek Racine, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifnb/Interferon+beta+(IFNB1)+Cytosection/pm41973907-291-70-81
Average 94 stars, based on 1 article reviews
ifnb1 tgctctcctgttgtgcttctccac atagatggtcaatgcggcgtcc brzostek racine - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
Cusabio enzyme linked immunosorbent assay elisa
Characterization of RVFV infection and host response in human trophoblast stem cells (hTSCs) by immunofluorescence, qRT-PCR, and western blotting (A) Representative immunofluorescence microscopy of uninfected controls and RVFV strain ZH548-infected human trophoblast stem cells (hTSCs) from Donor 1 at 24 h post-infection (hpi). Cells were stained with lineage-specific markers: cytotrophoblasts (CyT) with E-Cadherin and TEAD4 (red), syncytiotrophoblasts (STB) with hCG-β (red), and extravillous trophoblasts (EvT) with HLA-G (red). RVFV infection was detected using an anti-RVFV Gn and NSs antibody (green), and nuclei were counterstained with DAPI (blue). Scale bars, 10 μm (main panels). (B) Viral replication kinetics of RVFV in hTSCs. Cells were infected with RVFV at an MOI of 1. Total RNA was extracted at 0, 24, and 48 hpi, and RVFV L gene expression was quantified by qRT-PCR. (C) Quantification of infectious progeny virus release. Viral titers in culture supernatants collected at 24 and 48 h post-infection (hpi) were determined using a fluorescence-based titration assay. The bar graph displays the log10-transformed infectious titers (fluorescence-based TCID50/mL) for three independent donors (donors 1–3). Error bars represent the standard error of the mean (SEM) of technical replicates. ∗ p < 0.05 (two-way ANOVA), indicating a statistically significant increase in viral titers over time. Non-significant differences are not labeled. (D and E) Western blotting analysis of RVFV viral protein expression and quantification. Infection was performed as described in B. Lysates collected at 0, 24, and 48 hpi were analyzed for RVFV Gn and NSs proteins, normalized to β-actin. Each symbol represents a single data point from an independent experiment ( n = 2). Statistical analysis was not performed due to the limited sample size. (F and G) Antiviral immune response (F) and inflammatory cytokine gene expression (G) in RVFV-infected hTSCs. The same synthesized cDNA from B was used to analyze the expression of type I ( IFNA1, <t>IFNB1</t> ) and type III ( IFNL1 ) interferons (F), as well as inflammatory genes ( IL-6, IL-8 , and TNF-α ) (G). General quantitative analysis (B, F, and G): For all qRT-PCR data, relative expression levels were calculated using the 2-ΔΔCt method, normalized to uninfected cells at 0 hpi. Data are stratified by donor to illustrate biological variability: donor 1 (red circles), donor 2 (purple squares), and donor 3 (blue triangles). Each symbol represents the mean of technical replicates, and horizontal lines indicate the mean of biological replicates. Statistical analyses were performed using two distinct approaches: (1) two-way ANOVA assessed donor variability, indicating no significant difference between donors across conditions, with the exception of IL-6 at 24 hpi in F (# p < 0.05); (2) One-way ANOVA followed by Dunnett’s post hoc test assessed differences against the 0 hpi baseline for individual donors, indicated by asterisks (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001).
Enzyme Linked Immunosorbent Assay Elisa, supplied by Cusabio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifnb/Human+Interferon+%CE%B2%2CIFN-%CE%B2%2FIFNB+ELISA+Kit/pmc12752754-523-9-15
Average 94 stars, based on 1 article reviews
enzyme linked immunosorbent assay elisa - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

99
Thermo Fisher gene exp ifnb1 mm00439552 s1
Characterization of RVFV infection and host response in human trophoblast stem cells (hTSCs) by immunofluorescence, qRT-PCR, and western blotting (A) Representative immunofluorescence microscopy of uninfected controls and RVFV strain ZH548-infected human trophoblast stem cells (hTSCs) from Donor 1 at 24 h post-infection (hpi). Cells were stained with lineage-specific markers: cytotrophoblasts (CyT) with E-Cadherin and TEAD4 (red), syncytiotrophoblasts (STB) with hCG-β (red), and extravillous trophoblasts (EvT) with HLA-G (red). RVFV infection was detected using an anti-RVFV Gn and NSs antibody (green), and nuclei were counterstained with DAPI (blue). Scale bars, 10 μm (main panels). (B) Viral replication kinetics of RVFV in hTSCs. Cells were infected with RVFV at an MOI of 1. Total RNA was extracted at 0, 24, and 48 hpi, and RVFV L gene expression was quantified by qRT-PCR. (C) Quantification of infectious progeny virus release. Viral titers in culture supernatants collected at 24 and 48 h post-infection (hpi) were determined using a fluorescence-based titration assay. The bar graph displays the log10-transformed infectious titers (fluorescence-based TCID50/mL) for three independent donors (donors 1–3). Error bars represent the standard error of the mean (SEM) of technical replicates. ∗ p < 0.05 (two-way ANOVA), indicating a statistically significant increase in viral titers over time. Non-significant differences are not labeled. (D and E) Western blotting analysis of RVFV viral protein expression and quantification. Infection was performed as described in B. Lysates collected at 0, 24, and 48 hpi were analyzed for RVFV Gn and NSs proteins, normalized to β-actin. Each symbol represents a single data point from an independent experiment ( n = 2). Statistical analysis was not performed due to the limited sample size. (F and G) Antiviral immune response (F) and inflammatory cytokine gene expression (G) in RVFV-infected hTSCs. The same synthesized cDNA from B was used to analyze the expression of type I ( IFNA1, <t>IFNB1</t> ) and type III ( IFNL1 ) interferons (F), as well as inflammatory genes ( IL-6, IL-8 , and TNF-α ) (G). General quantitative analysis (B, F, and G): For all qRT-PCR data, relative expression levels were calculated using the 2-ΔΔCt method, normalized to uninfected cells at 0 hpi. Data are stratified by donor to illustrate biological variability: donor 1 (red circles), donor 2 (purple squares), and donor 3 (blue triangles). Each symbol represents the mean of technical replicates, and horizontal lines indicate the mean of biological replicates. Statistical analyses were performed using two distinct approaches: (1) two-way ANOVA assessed donor variability, indicating no significant difference between donors across conditions, with the exception of IL-6 at 24 hpi in F (# p < 0.05); (2) One-way ANOVA followed by Dunnett’s post hoc test assessed differences against the 0 hpi baseline for individual donors, indicated by asterisks (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001).
Gene Exp Ifnb1 Mm00439552 S1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifnb/Gene+Exp%2E+Ifnb1%2C+Mm00439552_s1/pmc12907107-25-6--1
Average 99 stars, based on 1 article reviews
gene exp ifnb1 mm00439552 s1 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

94
Cusabio human ifn β
Characterization of RVFV infection and host response in human trophoblast stem cells (hTSCs) by immunofluorescence, qRT-PCR, and western blotting (A) Representative immunofluorescence microscopy of uninfected controls and RVFV strain ZH548-infected human trophoblast stem cells (hTSCs) from Donor 1 at 24 h post-infection (hpi). Cells were stained with lineage-specific markers: cytotrophoblasts (CyT) with E-Cadherin and TEAD4 (red), syncytiotrophoblasts (STB) with hCG-β (red), and extravillous trophoblasts (EvT) with HLA-G (red). RVFV infection was detected using an anti-RVFV Gn and NSs antibody (green), and nuclei were counterstained with DAPI (blue). Scale bars, 10 μm (main panels). (B) Viral replication kinetics of RVFV in hTSCs. Cells were infected with RVFV at an MOI of 1. Total RNA was extracted at 0, 24, and 48 hpi, and RVFV L gene expression was quantified by qRT-PCR. (C) Quantification of infectious progeny virus release. Viral titers in culture supernatants collected at 24 and 48 h post-infection (hpi) were determined using a fluorescence-based titration assay. The bar graph displays the log10-transformed infectious titers (fluorescence-based TCID50/mL) for three independent donors (donors 1–3). Error bars represent the standard error of the mean (SEM) of technical replicates. ∗ p < 0.05 (two-way ANOVA), indicating a statistically significant increase in viral titers over time. Non-significant differences are not labeled. (D and E) Western blotting analysis of RVFV viral protein expression and quantification. Infection was performed as described in B. Lysates collected at 0, 24, and 48 hpi were analyzed for RVFV Gn and NSs proteins, normalized to β-actin. Each symbol represents a single data point from an independent experiment ( n = 2). Statistical analysis was not performed due to the limited sample size. (F and G) Antiviral immune response (F) and inflammatory cytokine gene expression (G) in RVFV-infected hTSCs. The same synthesized cDNA from B was used to analyze the expression of type I ( IFNA1, <t>IFNB1</t> ) and type III ( IFNL1 ) interferons (F), as well as inflammatory genes ( IL-6, IL-8 , and TNF-α ) (G). General quantitative analysis (B, F, and G): For all qRT-PCR data, relative expression levels were calculated using the 2-ΔΔCt method, normalized to uninfected cells at 0 hpi. Data are stratified by donor to illustrate biological variability: donor 1 (red circles), donor 2 (purple squares), and donor 3 (blue triangles). Each symbol represents the mean of technical replicates, and horizontal lines indicate the mean of biological replicates. Statistical analyses were performed using two distinct approaches: (1) two-way ANOVA assessed donor variability, indicating no significant difference between donors across conditions, with the exception of IL-6 at 24 hpi in F (# p < 0.05); (2) One-way ANOVA followed by Dunnett’s post hoc test assessed differences against the 0 hpi baseline for individual donors, indicated by asterisks (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001).
Human Ifn β, supplied by Cusabio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifnb/Human+Interferon+%CE%B2%2CIFN-%CE%B2%2FIFNB+ELISA+Kit/pm41913215-90-21-23
Average 94 stars, based on 1 article reviews
human ifn β - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

Image Search Results


Characterization of RVFV infection and host response in human trophoblast stem cells (hTSCs) by immunofluorescence, qRT-PCR, and western blotting (A) Representative immunofluorescence microscopy of uninfected controls and RVFV strain ZH548-infected human trophoblast stem cells (hTSCs) from Donor 1 at 24 h post-infection (hpi). Cells were stained with lineage-specific markers: cytotrophoblasts (CyT) with E-Cadherin and TEAD4 (red), syncytiotrophoblasts (STB) with hCG-β (red), and extravillous trophoblasts (EvT) with HLA-G (red). RVFV infection was detected using an anti-RVFV Gn and NSs antibody (green), and nuclei were counterstained with DAPI (blue). Scale bars, 10 μm (main panels). (B) Viral replication kinetics of RVFV in hTSCs. Cells were infected with RVFV at an MOI of 1. Total RNA was extracted at 0, 24, and 48 hpi, and RVFV L gene expression was quantified by qRT-PCR. (C) Quantification of infectious progeny virus release. Viral titers in culture supernatants collected at 24 and 48 h post-infection (hpi) were determined using a fluorescence-based titration assay. The bar graph displays the log10-transformed infectious titers (fluorescence-based TCID50/mL) for three independent donors (donors 1–3). Error bars represent the standard error of the mean (SEM) of technical replicates. ∗ p < 0.05 (two-way ANOVA), indicating a statistically significant increase in viral titers over time. Non-significant differences are not labeled. (D and E) Western blotting analysis of RVFV viral protein expression and quantification. Infection was performed as described in B. Lysates collected at 0, 24, and 48 hpi were analyzed for RVFV Gn and NSs proteins, normalized to β-actin. Each symbol represents a single data point from an independent experiment ( n = 2). Statistical analysis was not performed due to the limited sample size. (F and G) Antiviral immune response (F) and inflammatory cytokine gene expression (G) in RVFV-infected hTSCs. The same synthesized cDNA from B was used to analyze the expression of type I ( IFNA1, IFNB1 ) and type III ( IFNL1 ) interferons (F), as well as inflammatory genes ( IL-6, IL-8 , and TNF-α ) (G). General quantitative analysis (B, F, and G): For all qRT-PCR data, relative expression levels were calculated using the 2-ΔΔCt method, normalized to uninfected cells at 0 hpi. Data are stratified by donor to illustrate biological variability: donor 1 (red circles), donor 2 (purple squares), and donor 3 (blue triangles). Each symbol represents the mean of technical replicates, and horizontal lines indicate the mean of biological replicates. Statistical analyses were performed using two distinct approaches: (1) two-way ANOVA assessed donor variability, indicating no significant difference between donors across conditions, with the exception of IL-6 at 24 hpi in F (# p < 0.05); (2) One-way ANOVA followed by Dunnett’s post hoc test assessed differences against the 0 hpi baseline for individual donors, indicated by asterisks (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001).

Journal: iScience

Article Title: Dissecting placental host-pathogen interactions: Rift Valley fever virus infection in early human trophoblast stem cells

doi: 10.1016/j.isci.2026.115584

Figure Lengend Snippet: Characterization of RVFV infection and host response in human trophoblast stem cells (hTSCs) by immunofluorescence, qRT-PCR, and western blotting (A) Representative immunofluorescence microscopy of uninfected controls and RVFV strain ZH548-infected human trophoblast stem cells (hTSCs) from Donor 1 at 24 h post-infection (hpi). Cells were stained with lineage-specific markers: cytotrophoblasts (CyT) with E-Cadherin and TEAD4 (red), syncytiotrophoblasts (STB) with hCG-β (red), and extravillous trophoblasts (EvT) with HLA-G (red). RVFV infection was detected using an anti-RVFV Gn and NSs antibody (green), and nuclei were counterstained with DAPI (blue). Scale bars, 10 μm (main panels). (B) Viral replication kinetics of RVFV in hTSCs. Cells were infected with RVFV at an MOI of 1. Total RNA was extracted at 0, 24, and 48 hpi, and RVFV L gene expression was quantified by qRT-PCR. (C) Quantification of infectious progeny virus release. Viral titers in culture supernatants collected at 24 and 48 h post-infection (hpi) were determined using a fluorescence-based titration assay. The bar graph displays the log10-transformed infectious titers (fluorescence-based TCID50/mL) for three independent donors (donors 1–3). Error bars represent the standard error of the mean (SEM) of technical replicates. ∗ p < 0.05 (two-way ANOVA), indicating a statistically significant increase in viral titers over time. Non-significant differences are not labeled. (D and E) Western blotting analysis of RVFV viral protein expression and quantification. Infection was performed as described in B. Lysates collected at 0, 24, and 48 hpi were analyzed for RVFV Gn and NSs proteins, normalized to β-actin. Each symbol represents a single data point from an independent experiment ( n = 2). Statistical analysis was not performed due to the limited sample size. (F and G) Antiviral immune response (F) and inflammatory cytokine gene expression (G) in RVFV-infected hTSCs. The same synthesized cDNA from B was used to analyze the expression of type I ( IFNA1, IFNB1 ) and type III ( IFNL1 ) interferons (F), as well as inflammatory genes ( IL-6, IL-8 , and TNF-α ) (G). General quantitative analysis (B, F, and G): For all qRT-PCR data, relative expression levels were calculated using the 2-ΔΔCt method, normalized to uninfected cells at 0 hpi. Data are stratified by donor to illustrate biological variability: donor 1 (red circles), donor 2 (purple squares), and donor 3 (blue triangles). Each symbol represents the mean of technical replicates, and horizontal lines indicate the mean of biological replicates. Statistical analyses were performed using two distinct approaches: (1) two-way ANOVA assessed donor variability, indicating no significant difference between donors across conditions, with the exception of IL-6 at 24 hpi in F (# p < 0.05); (2) One-way ANOVA followed by Dunnett’s post hoc test assessed differences against the 0 hpi baseline for individual donors, indicated by asterisks (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001).

Article Snippet: TaqMan FAM/MGB probe assays (Thermo Scientific) were employed for detection. mRNA expression levels were assessed for the following cytokines using the corresponding TaqMan Assay IDs: IFNA1 (Hs00256882_s1), IFNB1 (Hs01077958_s1), IFNL1 (Hs00601677_g1), IL6 (Hs00985639_m1), IL8 (Hs00174103_m1), and TNFA (Hs00174128_m1).

Techniques: Infection, Immunofluorescence, Quantitative RT-PCR, Western Blot, Microscopy, Staining, Gene Expression, Virus, Fluorescence, Titration, Transformation Assay, Labeling, Expressing, Synthesized

IFN-λ-mediated antiviral response against RVFV in hTSCs (A and B) Single-cell transcriptomic analysis of interferon and ISG expression. (A) Expression levels of type I ( IFNA1, IFNB1 ) and type III ( IFNL1 ) interferons. (B) Induction of key interferon-stimulated genes (ISGs). Data were derived from the scRNA-seq dataset described in . Cells were stratified into three groups: Mock (uninfected control), RVFV-uninfected (bystander), and RVFV-infected, and expression values represent the average of three independent donors ( n = 3) across trophoblast subtypes (CyT1, CyT2, and Juvenile STB). (C) Interferon lambda (IFN-λ) bioassay. hTSCs were pretreated with recombinant IFN-λ (10 ng/mL or 100 ng/mL) for 24 h prior to RVFV infection. (Left) Western blot analysis of RVFV Gn and NSs protein levels. β-actin was used as a loading control. Numbers 1–3 on the blot images correspond to the three individual donors. (Right) Densitometric quantification of Gn and NSs protein expression normalized to β-actin. Data are stratified by donor to illustrate biological variability: donor 1 (red circles), donor 2 (purple squares), and donor 3 (blue triangles). Each symbol represents the result of an independent experiment. Statistical analyses were performed using two distinct approaches: (1) two-way ANOVA assessed donor variability, indicating no significant difference between donors across most conditions, with the exception of Gn protein levels in the 100 ng/mL IFN-λ treatment group, where a significant difference was observed between Donor 2 and Donor 3 (# p < 0.05); (2) one-way ANOVA followed by Dunnett’s post hoc test was used to determine statistical significance against controls. Comparisons were made against the RVFV-infected untreated control group (∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001).

Journal: iScience

Article Title: Dissecting placental host-pathogen interactions: Rift Valley fever virus infection in early human trophoblast stem cells

doi: 10.1016/j.isci.2026.115584

Figure Lengend Snippet: IFN-λ-mediated antiviral response against RVFV in hTSCs (A and B) Single-cell transcriptomic analysis of interferon and ISG expression. (A) Expression levels of type I ( IFNA1, IFNB1 ) and type III ( IFNL1 ) interferons. (B) Induction of key interferon-stimulated genes (ISGs). Data were derived from the scRNA-seq dataset described in . Cells were stratified into three groups: Mock (uninfected control), RVFV-uninfected (bystander), and RVFV-infected, and expression values represent the average of three independent donors ( n = 3) across trophoblast subtypes (CyT1, CyT2, and Juvenile STB). (C) Interferon lambda (IFN-λ) bioassay. hTSCs were pretreated with recombinant IFN-λ (10 ng/mL or 100 ng/mL) for 24 h prior to RVFV infection. (Left) Western blot analysis of RVFV Gn and NSs protein levels. β-actin was used as a loading control. Numbers 1–3 on the blot images correspond to the three individual donors. (Right) Densitometric quantification of Gn and NSs protein expression normalized to β-actin. Data are stratified by donor to illustrate biological variability: donor 1 (red circles), donor 2 (purple squares), and donor 3 (blue triangles). Each symbol represents the result of an independent experiment. Statistical analyses were performed using two distinct approaches: (1) two-way ANOVA assessed donor variability, indicating no significant difference between donors across most conditions, with the exception of Gn protein levels in the 100 ng/mL IFN-λ treatment group, where a significant difference was observed between Donor 2 and Donor 3 (# p < 0.05); (2) one-way ANOVA followed by Dunnett’s post hoc test was used to determine statistical significance against controls. Comparisons were made against the RVFV-infected untreated control group (∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001).

Article Snippet: TaqMan FAM/MGB probe assays (Thermo Scientific) were employed for detection. mRNA expression levels were assessed for the following cytokines using the corresponding TaqMan Assay IDs: IFNA1 (Hs00256882_s1), IFNB1 (Hs01077958_s1), IFNL1 (Hs00601677_g1), IL6 (Hs00985639_m1), IL8 (Hs00174103_m1), and TNFA (Hs00174128_m1).

Techniques: Single Cell, Expressing, Derivative Assay, Control, Infection, Bioassay, Recombinant, Western Blot