Review





Similar Products

86
Synthego Inc grna sgrna sequences flanking ugp2 exon 2
Grna Sgrna Sequences Flanking Ugp2 Exon 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pm40769148-755-20-30?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
grna sgrna sequences flanking ugp2 exon 2 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

90
Illumina Inc illumina sequenced grna-2
Illumina Sequenced Grna 2, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc11514453-331-17-17?v=Illumina+Inc
Average 90 stars, based on 1 article reviews
illumina sequenced grna-2 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

93
Addgene inc cloning gene specific guide rna sequences
Cloning Gene Specific Guide Rna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc11494886-326-6-16?v=Addgene+inc
Average 93 stars, based on 1 article reviews
cloning gene specific guide rna sequences - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

92
Santa Cruz Biotechnology guide rna grna sequences
Guide Rna Grna Sequences, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pm38582251-71-9-6?v=Santa+Cruz+Biotechnology
Average 92 stars, based on 1 article reviews
guide rna grna sequences - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

90
Synthego Inc grna sequence 2

Grna Sequence 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc10694670-100-0-5?v=Synthego+Inc
Average 90 stars, based on 1 article reviews
grna sequence 2 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation grna-2 sequence

Grna 2 Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/us11643672-456-2-22?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
grna-2 sequence - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Biotechnology Information nucleotide sequence of the omicron variant (b.1.1.529) of the sars-cov-2 grna

Nucleotide Sequence Of The Omicron Variant (B.1.1.529) Of The Sars Cov 2 Grna, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pm37185717-67-11-21?v=Biotechnology+Information
Average 90 stars, based on 1 article reviews
nucleotide sequence of the omicron variant (b.1.1.529) of the sars-cov-2 grna - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
KU Leuven p58 backbone with 2 grna targeting sequence for pdc1
Plasmids used in this work
P58 Backbone With 2 Grna Targeting Sequence For Pdc1, supplied by KU Leuven, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc09520875-21-2-16?v=KU+Leuven
Average 90 stars, based on 1 article reviews
p58 backbone with 2 grna targeting sequence for pdc1 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
KU Leuven p58 backbone with 2 grna targeting sequence for pdc5
Plasmids used in this work
P58 Backbone With 2 Grna Targeting Sequence For Pdc5, supplied by KU Leuven, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc09520875-22-0-16?v=KU+Leuven
Average 90 stars, based on 1 article reviews
p58 backbone with 2 grna targeting sequence for pdc5 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology nsmase 2 specific grna sequences
a Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNA targeting GFP (72 h) and GW4869 (10 µM) or DMSO (0.5%, 30 min) and pulse-treated with GPN. Data are means ± SD. n = 52 cells for DMSO and 39 cells for GW4869 over three independent experiments. b Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNAs targeting ALIX/TSG101 and GW4869 or DMSO and pulse-treated with GPN. Data are means ± SD. n = 46 cells for DMSO and 44 cells for GW4869 over three independent experiments. c Survival rate of HeLa cells pre-treated with siRNA targeting GFP after 5 h of exposure to LLOMe at indicated concentrations in the presence of GW4869 or DMSO. Data are means ± SD. n = 3 independent experiments. d Survival rate of HeLa cells pre-treated with siRNA targeting ALIX/TSG101 after 5 h exposure to LLOMe at indicated concentrations in the presence of GW4869 or DMSO. Data are means ± SD. n = 3 independent experiments. e Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNAs targeting ALIX/TSG101 and GFP or nSMase-1 and pulse-treated with GPN. Data are means ± SD. n = 28 cells for si GFP and 28 cells for si nSMase-1 over three independent experiments. f Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNAs targeting ALIX/TSG101 and GFP or <t>nSMase-2</t> and pulse-treated with GPN. Data are means ± SD. n = 28 cells for si GFP and 40 cells for si nSMase-2 over three independent experiments. g Time-course plotting LysoTracker-positive puncta in WT or nSMase-2 KO HeLa cells pulse-treated with GPN. Data are means ± SD. n = 58 cells for WT and 66 cells for nSMase-2 KO over three independent experiments. h Survival rate of wild-type (WT) or nSMase-2 KO HeLa cells after 5 h exposure to LLOMe at the indicated concentration. Data are means ± SD. n = 4 independent experiments. P values were calculated by paired ( c , d , h ) or unpaired two-tailed t test ( a , b , e , f , g ). i Model illustrating how Ca 2+ -activated SM scrambling and turnover may promote restoration of damaged lysosomes.
Nsmase 2 Specific Grna Sequences, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc08986845-247-36-28?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
nsmase 2 specific grna sequences - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

Image Search Results


Journal: iScience

Article Title: TIGIT contributes to the regulation of 4-1BB and does not define NK cell dysfunction in glioblastoma

doi: 10.1016/j.isci.2023.108353

Figure Lengend Snippet:

Article Snippet: gRNA sequence 2: AUGUCACCUCUCCUCCACCA , Synthego , N/A.

Techniques: Recombinant, Lactate Dehydrogenase Assay, Cell Based Assay, Gene Knockout, Enzyme-linked Immunosorbent Assay, shRNA, Sequencing, Software, Gene Expression

Plasmids used in this work

Journal: Microbial Cell Factories

Article Title: Development of an industrial yeast strain for efficient production of 2,3-butanediol

doi: 10.1186/s12934-022-01924-z

Figure Lengend Snippet: Plasmids used in this work

Article Snippet: P58-PDC1 , P58 backbone with 2 gRNA targeting sequence for PDC1 (AGCATCCAACAATTTTTGCA and GATAAGCTTTATGAAGTCAA) , MCB, KU Leuven.

Techniques: Marker, Plasmid Preparation, Sequencing, Expressing

a Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNA targeting GFP (72 h) and GW4869 (10 µM) or DMSO (0.5%, 30 min) and pulse-treated with GPN. Data are means ± SD. n = 52 cells for DMSO and 39 cells for GW4869 over three independent experiments. b Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNAs targeting ALIX/TSG101 and GW4869 or DMSO and pulse-treated with GPN. Data are means ± SD. n = 46 cells for DMSO and 44 cells for GW4869 over three independent experiments. c Survival rate of HeLa cells pre-treated with siRNA targeting GFP after 5 h of exposure to LLOMe at indicated concentrations in the presence of GW4869 or DMSO. Data are means ± SD. n = 3 independent experiments. d Survival rate of HeLa cells pre-treated with siRNA targeting ALIX/TSG101 after 5 h exposure to LLOMe at indicated concentrations in the presence of GW4869 or DMSO. Data are means ± SD. n = 3 independent experiments. e Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNAs targeting ALIX/TSG101 and GFP or nSMase-1 and pulse-treated with GPN. Data are means ± SD. n = 28 cells for si GFP and 28 cells for si nSMase-1 over three independent experiments. f Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNAs targeting ALIX/TSG101 and GFP or nSMase-2 and pulse-treated with GPN. Data are means ± SD. n = 28 cells for si GFP and 40 cells for si nSMase-2 over three independent experiments. g Time-course plotting LysoTracker-positive puncta in WT or nSMase-2 KO HeLa cells pulse-treated with GPN. Data are means ± SD. n = 58 cells for WT and 66 cells for nSMase-2 KO over three independent experiments. h Survival rate of wild-type (WT) or nSMase-2 KO HeLa cells after 5 h exposure to LLOMe at the indicated concentration. Data are means ± SD. n = 4 independent experiments. P values were calculated by paired ( c , d , h ) or unpaired two-tailed t test ( a , b , e , f , g ). i Model illustrating how Ca 2+ -activated SM scrambling and turnover may promote restoration of damaged lysosomes.

Journal: Nature Communications

Article Title: Ca 2+ -activated sphingomyelin scrambling and turnover mediate ESCRT-independent lysosomal repair

doi: 10.1038/s41467-022-29481-4

Figure Lengend Snippet: a Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNA targeting GFP (72 h) and GW4869 (10 µM) or DMSO (0.5%, 30 min) and pulse-treated with GPN. Data are means ± SD. n = 52 cells for DMSO and 39 cells for GW4869 over three independent experiments. b Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNAs targeting ALIX/TSG101 and GW4869 or DMSO and pulse-treated with GPN. Data are means ± SD. n = 46 cells for DMSO and 44 cells for GW4869 over three independent experiments. c Survival rate of HeLa cells pre-treated with siRNA targeting GFP after 5 h of exposure to LLOMe at indicated concentrations in the presence of GW4869 or DMSO. Data are means ± SD. n = 3 independent experiments. d Survival rate of HeLa cells pre-treated with siRNA targeting ALIX/TSG101 after 5 h exposure to LLOMe at indicated concentrations in the presence of GW4869 or DMSO. Data are means ± SD. n = 3 independent experiments. e Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNAs targeting ALIX/TSG101 and GFP or nSMase-1 and pulse-treated with GPN. Data are means ± SD. n = 28 cells for si GFP and 28 cells for si nSMase-1 over three independent experiments. f Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNAs targeting ALIX/TSG101 and GFP or nSMase-2 and pulse-treated with GPN. Data are means ± SD. n = 28 cells for si GFP and 40 cells for si nSMase-2 over three independent experiments. g Time-course plotting LysoTracker-positive puncta in WT or nSMase-2 KO HeLa cells pulse-treated with GPN. Data are means ± SD. n = 58 cells for WT and 66 cells for nSMase-2 KO over three independent experiments. h Survival rate of wild-type (WT) or nSMase-2 KO HeLa cells after 5 h exposure to LLOMe at the indicated concentration. Data are means ± SD. n = 4 independent experiments. P values were calculated by paired ( c , d , h ) or unpaired two-tailed t test ( a , b , e , f , g ). i Model illustrating how Ca 2+ -activated SM scrambling and turnover may promote restoration of damaged lysosomes.

Article Snippet: To generate nSMase-2-KO and SMS1/SMS2 double-KO (SMS-KO) HeLa cells, a mix of CRISPR/Cas9 constructs encoding three different gRNAs per gene and the corresponding HDR plasmids were obtained from Santa Cruz (nSMase-2, sc401937; SMS1, sc-403382; SMS2, sc-405416). nSMase-2-specific gRNA sequences were: A/sense, 5′-CGTAGACCCCGACGTCGTAC-3′; B/sense, 5′-GAGTACATCCTGTACGACGT-3′; C/sense, 5′-GTGGCATTTGACGTCGTCTG-3′.

Techniques: Concentration Assay, Two Tailed Test