Review





Similar Products

86
Genechem lentiviral particles carrying shrna targeting grb2
<t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
Lentiviral Particles Carrying Shrna Targeting Grb2, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grb2/ags+cell+gc+lines/pmc13157854-91-0-18
Average 86 stars, based on 1 article reviews
lentiviral particles carrying shrna targeting grb2 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Human Protein Atlas grb2 immunohistochemistry
<t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
Grb2 Immunohistochemistry, supplied by Human Protein Atlas, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grb2/grb2+immunohistochemistry/pmc13157854-107-50-54
Average 86 stars, based on 1 article reviews
grb2 immunohistochemistry - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Genechem stable cell lines lentiviral particles carrying shrna targeting grb2
<t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
Stable Cell Lines Lentiviral Particles Carrying Shrna Targeting Grb2, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grb2/ags+cell+gc+lines/10__2147_slash_jhc__s581550-81-3-24
Average 86 stars, based on 1 article reviews
stable cell lines lentiviral particles carrying shrna targeting grb2 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

93
Proteintech anti grb2
<t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
Anti Grb2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grb2/GRB2+Antibody/pm41901226-133-103-108
Average 93 stars, based on 1 article reviews
anti grb2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

95
Cell Signaling Technology Inc grb2 3972s
<t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
Grb2 3972s, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grb2/GRB2+Antibody/pm41819264-232-34-39
Average 95 stars, based on 1 article reviews
grb2 3972s - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

95
Cell Signaling Technology Inc grb2
<t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
Grb2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grb2/GRB2+Antibody/pm41760308-88-144-146
Average 95 stars, based on 1 article reviews
grb2 - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology k ras
<t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
K Ras, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grb2/GRB2+Antibody/pm41651299-183-39-64
Average 96 stars, based on 1 article reviews
k ras - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology grb2
<t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
Grb2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grb2/GRB2+Antibody/pm41651299-183-34-64
Average 96 stars, based on 1 article reviews
grb2 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.

Journal: Journal of Hepatocellular Carcinoma

Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

doi: 10.2147/JHC.S581550

Figure Lengend Snippet: GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.

Article Snippet: Lentiviral particles carrying shRNA targeting GRB2 (shGRB2-1: CAGATATTCCTGCGGGACATA, shGRB2-2: CGGCTTCATTCCCAAGAACTA) and negative control (shGRB2-NC: TTCTCCGAACGTGTCACGT) were constructed by GeneChem (Shanghai, China).

Techniques: Expressing, Immunohistochemistry

Correlation between GRB2 expression and poor prognosis of HCC patients. ( A ) GRB2 expression vs histological grade; ( B ) Association between GRB2 expression and TNM stage; ( C ) Overall and relapse-free survival curves of HCC patients; ( D ) The ROC curve of GRB2 in the diagnosis of HCC. “***” P < 0.001.

Journal: Journal of Hepatocellular Carcinoma

Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

doi: 10.2147/JHC.S581550

Figure Lengend Snippet: Correlation between GRB2 expression and poor prognosis of HCC patients. ( A ) GRB2 expression vs histological grade; ( B ) Association between GRB2 expression and TNM stage; ( C ) Overall and relapse-free survival curves of HCC patients; ( D ) The ROC curve of GRB2 in the diagnosis of HCC. “***” P < 0.001.

Article Snippet: Lentiviral particles carrying shRNA targeting GRB2 (shGRB2-1: CAGATATTCCTGCGGGACATA, shGRB2-2: CGGCTTCATTCCCAAGAACTA) and negative control (shGRB2-NC: TTCTCCGAACGTGTCACGT) were constructed by GeneChem (Shanghai, China).

Techniques: Expressing, Biomarker Discovery

Correlation between GRB2 and hypoxia. ( A ) The correlation between GRB2 and hypoxia gene HIF-1α expression.; ( B ) The correlation between GRB2 and hypoxia gene VEGFA expression.; ( C ) GSVA analysis of GRB2 in ICGC-LIRI; ( D ) Hypoxia score and GRB2 expression. “****” P < 0.0001.

Journal: Journal of Hepatocellular Carcinoma

Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

doi: 10.2147/JHC.S581550

Figure Lengend Snippet: Correlation between GRB2 and hypoxia. ( A ) The correlation between GRB2 and hypoxia gene HIF-1α expression.; ( B ) The correlation between GRB2 and hypoxia gene VEGFA expression.; ( C ) GSVA analysis of GRB2 in ICGC-LIRI; ( D ) Hypoxia score and GRB2 expression. “****” P < 0.0001.

Article Snippet: Lentiviral particles carrying shRNA targeting GRB2 (shGRB2-1: CAGATATTCCTGCGGGACATA, shGRB2-2: CGGCTTCATTCCCAAGAACTA) and negative control (shGRB2-NC: TTCTCCGAACGTGTCACGT) were constructed by GeneChem (Shanghai, China).

Techniques: Expressing

PI3K/AKT pathway contributes to sorafenib resistance under hypoxia. ( A ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM vs DMSO, hypoxia, 24 h); ( B ) Western blotting of PI3K, AKT, p-AKT (sorafenib 5 μM ± LY294002 20 μM, hypoxia, 24 h); ( C ) CCK-8 viability (sorafenib 0,5,10,15,20 μM ± LY294002 20 μM, hypoxia, 24 h); ( D ) Wound healing (sorafenib 5 μM ± LY294002, hypoxia, 24 h); ( E ) Flow cytometry (sorafenib 5 μM ± LY294002, hypoxia, 24 h).The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

Journal: Journal of Hepatocellular Carcinoma

Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

doi: 10.2147/JHC.S581550

Figure Lengend Snippet: PI3K/AKT pathway contributes to sorafenib resistance under hypoxia. ( A ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM vs DMSO, hypoxia, 24 h); ( B ) Western blotting of PI3K, AKT, p-AKT (sorafenib 5 μM ± LY294002 20 μM, hypoxia, 24 h); ( C ) CCK-8 viability (sorafenib 0,5,10,15,20 μM ± LY294002 20 μM, hypoxia, 24 h); ( D ) Wound healing (sorafenib 5 μM ± LY294002, hypoxia, 24 h); ( E ) Flow cytometry (sorafenib 5 μM ± LY294002, hypoxia, 24 h).The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

Article Snippet: Lentiviral particles carrying shRNA targeting GRB2 (shGRB2-1: CAGATATTCCTGCGGGACATA, shGRB2-2: CGGCTTCATTCCCAAGAACTA) and negative control (shGRB2-NC: TTCTCCGAACGTGTCACGT) were constructed by GeneChem (Shanghai, China).

Techniques: Western Blot, CCK-8 Assay, Flow Cytometry

Down-regulation of GRB2 suppressed PI3K/AKT pathway in HCC cells. ( A ) GRB2 knockdown efficiency verified by Western blotting and RT-qPCR in stable cell lines; ( B ) CCK-8 viability (sorafenib 0,5,10,15,20 μM, hypoxia, 24 h) in shGRB2-NC, shGRB2-1, shGRB2-2; ( C ) Wound healing (sorafenib 5 μM, hypoxia, 24 h); ( D ) Flow cytometry (sorafenib 5 μM, hypoxia, 24 h); ( E ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM, hypoxia, 24 h). The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

Journal: Journal of Hepatocellular Carcinoma

Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

doi: 10.2147/JHC.S581550

Figure Lengend Snippet: Down-regulation of GRB2 suppressed PI3K/AKT pathway in HCC cells. ( A ) GRB2 knockdown efficiency verified by Western blotting and RT-qPCR in stable cell lines; ( B ) CCK-8 viability (sorafenib 0,5,10,15,20 μM, hypoxia, 24 h) in shGRB2-NC, shGRB2-1, shGRB2-2; ( C ) Wound healing (sorafenib 5 μM, hypoxia, 24 h); ( D ) Flow cytometry (sorafenib 5 μM, hypoxia, 24 h); ( E ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM, hypoxia, 24 h). The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

Article Snippet: Lentiviral particles carrying shRNA targeting GRB2 (shGRB2-1: CAGATATTCCTGCGGGACATA, shGRB2-2: CGGCTTCATTCCCAAGAACTA) and negative control (shGRB2-NC: TTCTCCGAACGTGTCACGT) were constructed by GeneChem (Shanghai, China).

Techniques: Knockdown, Western Blot, Quantitative RT-PCR, Stable Transfection, CCK-8 Assay, Flow Cytometry

GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.

Journal: Journal of Hepatocellular Carcinoma

Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

doi: 10.2147/JHC.S581550

Figure Lengend Snippet: GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.

Article Snippet: Figure 1 GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells.

Techniques: Expressing, Immunohistochemistry

Correlation between GRB2 expression and poor prognosis of HCC patients. ( A ) GRB2 expression vs histological grade; ( B ) Association between GRB2 expression and TNM stage; ( C ) Overall and relapse-free survival curves of HCC patients; ( D ) The ROC curve of GRB2 in the diagnosis of HCC. “***” P < 0.001.

Journal: Journal of Hepatocellular Carcinoma

Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

doi: 10.2147/JHC.S581550

Figure Lengend Snippet: Correlation between GRB2 expression and poor prognosis of HCC patients. ( A ) GRB2 expression vs histological grade; ( B ) Association between GRB2 expression and TNM stage; ( C ) Overall and relapse-free survival curves of HCC patients; ( D ) The ROC curve of GRB2 in the diagnosis of HCC. “***” P < 0.001.

Article Snippet: Figure 1 GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells.

Techniques: Expressing, Biomarker Discovery

Correlation between GRB2 and hypoxia. ( A ) The correlation between GRB2 and hypoxia gene HIF-1α expression.; ( B ) The correlation between GRB2 and hypoxia gene VEGFA expression.; ( C ) GSVA analysis of GRB2 in ICGC-LIRI; ( D ) Hypoxia score and GRB2 expression. “****” P < 0.0001.

Journal: Journal of Hepatocellular Carcinoma

Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

doi: 10.2147/JHC.S581550

Figure Lengend Snippet: Correlation between GRB2 and hypoxia. ( A ) The correlation between GRB2 and hypoxia gene HIF-1α expression.; ( B ) The correlation between GRB2 and hypoxia gene VEGFA expression.; ( C ) GSVA analysis of GRB2 in ICGC-LIRI; ( D ) Hypoxia score and GRB2 expression. “****” P < 0.0001.

Article Snippet: Figure 1 GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells.

Techniques: Expressing

PI3K/AKT pathway contributes to sorafenib resistance under hypoxia. ( A ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM vs DMSO, hypoxia, 24 h); ( B ) Western blotting of PI3K, AKT, p-AKT (sorafenib 5 μM ± LY294002 20 μM, hypoxia, 24 h); ( C ) CCK-8 viability (sorafenib 0,5,10,15,20 μM ± LY294002 20 μM, hypoxia, 24 h); ( D ) Wound healing (sorafenib 5 μM ± LY294002, hypoxia, 24 h); ( E ) Flow cytometry (sorafenib 5 μM ± LY294002, hypoxia, 24 h).The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

Journal: Journal of Hepatocellular Carcinoma

Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

doi: 10.2147/JHC.S581550

Figure Lengend Snippet: PI3K/AKT pathway contributes to sorafenib resistance under hypoxia. ( A ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM vs DMSO, hypoxia, 24 h); ( B ) Western blotting of PI3K, AKT, p-AKT (sorafenib 5 μM ± LY294002 20 μM, hypoxia, 24 h); ( C ) CCK-8 viability (sorafenib 0,5,10,15,20 μM ± LY294002 20 μM, hypoxia, 24 h); ( D ) Wound healing (sorafenib 5 μM ± LY294002, hypoxia, 24 h); ( E ) Flow cytometry (sorafenib 5 μM ± LY294002, hypoxia, 24 h).The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

Article Snippet: Figure 1 GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells.

Techniques: Western Blot, CCK-8 Assay, Flow Cytometry

Down-regulation of GRB2 suppressed PI3K/AKT pathway in HCC cells. ( A ) GRB2 knockdown efficiency verified by Western blotting and RT-qPCR in stable cell lines; ( B ) CCK-8 viability (sorafenib 0,5,10,15,20 μM, hypoxia, 24 h) in shGRB2-NC, shGRB2-1, shGRB2-2; ( C ) Wound healing (sorafenib 5 μM, hypoxia, 24 h); ( D ) Flow cytometry (sorafenib 5 μM, hypoxia, 24 h); ( E ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM, hypoxia, 24 h). The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

Journal: Journal of Hepatocellular Carcinoma

Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

doi: 10.2147/JHC.S581550

Figure Lengend Snippet: Down-regulation of GRB2 suppressed PI3K/AKT pathway in HCC cells. ( A ) GRB2 knockdown efficiency verified by Western blotting and RT-qPCR in stable cell lines; ( B ) CCK-8 viability (sorafenib 0,5,10,15,20 μM, hypoxia, 24 h) in shGRB2-NC, shGRB2-1, shGRB2-2; ( C ) Wound healing (sorafenib 5 μM, hypoxia, 24 h); ( D ) Flow cytometry (sorafenib 5 μM, hypoxia, 24 h); ( E ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM, hypoxia, 24 h). The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

Article Snippet: Figure 1 GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells.

Techniques: Knockdown, Western Blot, Quantitative RT-PCR, Stable Transfection, CCK-8 Assay, Flow Cytometry