Review





Similar Products

92
ATCC gene names
Gene Names, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene names/product/ATCC
Average 92 stars, based on 1 article reviews
gene names - by Bioz Stars, 2026-02
92/100 stars
  Buy from Supplier

90
ATCC strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id
Strain Gene Name Accession Polypeptide Arthrobacter Aurescens Dsm Hyuc Seq Id, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id/product/ATCC
Average 90 stars, based on 1 article reviews
strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

93
Cusabio b kit name human calcitonin gene related peptide
B Kit Name Human Calcitonin Gene Related Peptide, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/b kit name human calcitonin gene related peptide/product/Cusabio
Average 93 stars, based on 1 article reviews
b kit name human calcitonin gene related peptide - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

90
Oligos Etc oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10)
Oligo Gene Name Sequence (5’ 3’) Gyra Gyra For Ttgaaggaggaactcttgatgg (Seq Id No: 10), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10)/product/Oligos Etc
Average 90 stars, based on 1 article reviews
oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10) - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Chrom Tech chrom./gene name
Chrom./Gene Name, supplied by Chrom Tech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chrom./gene name/product/Chrom Tech
Average 90 stars, based on 1 article reviews
chrom./gene name - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
SomaLogic protein mapping to uniprot ids and gene names
Protein Mapping To Uniprot Ids And Gene Names, supplied by SomaLogic, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/protein mapping to uniprot ids and gene names/product/SomaLogic
Average 90 stars, based on 1 article reviews
protein mapping to uniprot ids and gene names - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

97
ATCC aspergillus niger atcc 1015 gene name aspnidraft 214857 ec 3 1 1 11
Aspergillus Niger Atcc 1015 Gene Name Aspnidraft 214857 Ec 3 1 1 11, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aspergillus niger atcc 1015 gene name aspnidraft 214857 ec 3 1 1 11/product/ATCC
Average 97 stars, based on 1 article reviews
aspergillus niger atcc 1015 gene name aspnidraft 214857 ec 3 1 1 11 - by Bioz Stars, 2026-02
97/100 stars
  Buy from Supplier

90
Unigene reference orf gene name blast best hi
Reference Orf Gene Name Blast Best Hi, supplied by Unigene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reference orf gene name blast best hi/product/Unigene
Average 90 stars, based on 1 article reviews
reference orf gene name blast best hi - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Real Time Primers real time primers gene names primer sequences (5'→3)
Real Time Primers Gene Names Primer Sequences (5'→3), supplied by Real Time Primers, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/real time primers gene names primer sequences (5'→3)/product/Real Time Primers
Average 90 stars, based on 1 article reviews
real time primers gene names primer sequences (5'→3) - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results