|
ATCC
gene names Gene Names, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene names/product/ATCC Average 92 stars, based on 1 article reviews
gene names - by Bioz Stars,
2026-02
92/100 stars
|
Buy from Supplier |
|
ATCC
strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id Strain Gene Name Accession Polypeptide Arthrobacter Aurescens Dsm Hyuc Seq Id, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id/product/ATCC Average 90 stars, based on 1 article reviews
strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Cusabio
b kit name human calcitonin gene related peptide B Kit Name Human Calcitonin Gene Related Peptide, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/b kit name human calcitonin gene related peptide/product/Cusabio Average 93 stars, based on 1 article reviews
b kit name human calcitonin gene related peptide - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Oligos Etc
oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10) Oligo Gene Name Sequence (5’ 3’) Gyra Gyra For Ttgaaggaggaactcttgatgg (Seq Id No: 10), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10)/product/Oligos Etc Average 90 stars, based on 1 article reviews
oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10) - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Chrom Tech
chrom./gene name Chrom./Gene Name, supplied by Chrom Tech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chrom./gene name/product/Chrom Tech Average 90 stars, based on 1 article reviews
chrom./gene name - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
SomaLogic
protein mapping to uniprot ids and gene names Protein Mapping To Uniprot Ids And Gene Names, supplied by SomaLogic, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/protein mapping to uniprot ids and gene names/product/SomaLogic Average 90 stars, based on 1 article reviews
protein mapping to uniprot ids and gene names - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
ATCC
aspergillus niger atcc 1015 gene name aspnidraft 214857 ec 3 1 1 11 Aspergillus Niger Atcc 1015 Gene Name Aspnidraft 214857 Ec 3 1 1 11, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aspergillus niger atcc 1015 gene name aspnidraft 214857 ec 3 1 1 11/product/ATCC Average 97 stars, based on 1 article reviews
aspergillus niger atcc 1015 gene name aspnidraft 214857 ec 3 1 1 11 - by Bioz Stars,
2026-02
97/100 stars
|
Buy from Supplier |
|
Unigene
reference orf gene name blast best hi Reference Orf Gene Name Blast Best Hi, supplied by Unigene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reference orf gene name blast best hi/product/Unigene Average 90 stars, based on 1 article reviews
reference orf gene name blast best hi - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Real Time Primers
real time primers gene names primer sequences (5'→3) Real Time Primers Gene Names Primer Sequences (5'→3), supplied by Real Time Primers, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/real time primers gene names primer sequences (5'→3)/product/Real Time Primers Average 90 stars, based on 1 article reviews
real time primers gene names primer sequences (5'→3) - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |