Review





Similar Products

94
Integrated DNA Technologies m13 forward
M13 Forward, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward/M13+Forward/custom%4051-01-13-01%4042301098
Average 94 stars, based on 1 article reviews
m13 forward - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

86
Servicebio Inc u6 forward pcr primer
U6 Forward Pcr Primer, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward/primer+snrna+u6/pmc13145395-12-3-8
Average 86 stars, based on 1 article reviews
u6 forward pcr primer - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Eurofins htrac hdr genomic forward primer targeting lha
Htrac Hdr Genomic Forward Primer Targeting Lha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward/and+forward+oligonucleotides+reverse+sgrna/pmc13265900-94-0-10
Average 86 stars, based on 1 article reviews
htrac hdr genomic forward primer targeting lha - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Bioneer Corporation pelb forward primer
Pelb Forward Primer, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward/primer+sequences/pm42321788-80-16-10
Average 86 stars, based on 1 article reviews
pelb forward primer - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Citrix Systems Inc workspace experience service 102 forwards
Workspace Experience Service 102 Forwards, supplied by Citrix Systems Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward/70+app+workspace/us12652326-189-1-16
Average 86 stars, based on 1 article reviews
workspace experience service 102 forwards - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Eurofins gse310442 oligonucleotides htrac hdr genomic forward primer targeting lha
Gse310442 Oligonucleotides Htrac Hdr Genomic Forward Primer Targeting Lha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward/and+forward+oligonucleotides+reverse+sgrna/10__1016_slash_j__isci__2026__116175-216-32-43
Average 86 stars, based on 1 article reviews
gse310442 oligonucleotides htrac hdr genomic forward primer targeting lha - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Eurofins gagcggagtccgatgtctc forward primer eurofins na mm ccl27a
Gagcggagtccgatgtctc Forward Primer Eurofins Na Mm Ccl27a, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward/actctctgc+caaactgctgctcaagctgc+eurofins+human+na+primer+tgggcaagtc+thra/pm42229582-687-181-183
Average 86 stars, based on 1 article reviews
gagcggagtccgatgtctc forward primer eurofins na mm ccl27a - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

94
OriGene origene rplp0 forward
Origene Rplp0 Forward, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward/RPLP0+(NM_053275)+Human+3'+UTR+Clone/bio_rxiv__64898__2026__05__21__726749-108-5-5
Average 94 stars, based on 1 article reviews
origene rplp0 forward - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

86
Fasmac Co Ltd forward actgggttttacaaacctgtga
Forward Actgggttttacaaacctgtga, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward/3+5+ccacgga+gcgagtcctg/pm42167370-68-5-11
Average 86 stars, based on 1 article reviews
forward actgggttttacaaacctgtga - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac
Epcam Primers Forward Ttgccgcagctcaggaagaatg Reverse Gcagccagctttgagcaaatgac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-52-0-5
Average 86 stars, based on 1 article reviews
epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results