Journal: Scientific Reports

Article Title: FKBP4 promotes glycolysis and hepatocellular carcinoma progression via p53/HK2 axis

doi: 10.1038/s41598-024-78383-6

Figure Lengend Snippet: FKBP4 affects phosphorylation of p53 at Ser15, and activation of the p53 signaling pathway. A and B , western blot analysis of p53 in Huh-1 and SMMC7721 cells between the control groups and FKBP4 stable knockdown groups. β-actin was used as the internal control. C , The mRNA levels of p53 were measured by qPCR (SYBR Green) in Huh-1 and SMMC7721 cells between the control groups and FKBP4 stable knockdown groups. CTBP was used as the internal control. Data shown are the mean ± s.d. Turnover assay of p53 protein in Huh-1 cells ( D ) and SMMC7721 cells ( E ) that had been transfected with FKBP4 shRNA or control expression vector with cycloheximide (CHX) (100 µg/ml) treatment at 48 hours post transfection for the indicated times. F , western blot analysis of the phosphorylation of p53 protein level in Huh-1 and SMMC7721 cells between the control groups and FKBP4 stable knockdown groups. β-actin was used as the internal control. G , Quantification of western blot presented in F was performed for pS15-p53, pS37-p53. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.

Article Snippet: The small-interfering RNA (siRNA) targeting FKBP4(siFKBP4#1, 5′- GATGATGTCTTCTGGTGTCAT-3′; siFKBP4 #2, 5′- GCATGGAGAAAGGAGAACATT-3′), siRNA for p53(sip53#1, 5′- CGGCGCACAGAGGAAGAGAAT-3′; sip53 #2, 5′- GTCCAGATGAAGCTCCCAGAA − 3′) were synthesized by Sangon biotech (Shanghai, China).

Techniques: Phospho-proteomics, Activation Assay, Western Blot, Control, Knockdown, SYBR Green Assay, Turnover Assay, Transfection, shRNA, Expressing, Plasmid Preparation

Journal: Scientific Reports

Article Title: FKBP4 promotes glycolysis and hepatocellular carcinoma progression via p53/HK2 axis

doi: 10.1038/s41598-024-78383-6

Figure Lengend Snippet: P53 is a major mediator of FKBP4-induced HK2 activation. The control groups and FKBP4 stable knockdown groups in both Huh-1 and SMMC7721 cells were co-transfected with siRNA negative control (siNC), or p53 siRNA (si-p53#1, and sip53#2). The protein level ( A and B ) of anti-FKBP4, anti-HK2, anti-p53, and anti-β-actin were assessed by Western blot analysis. In vitro analysis of 18 F-FDG uptake rate in both Huh-1 and SMMC7721 cells after treatment with siNC and sip53#1, and sip53#2 for 48 h. And the 18 F-FDG uptake rate ( C and D ) was detected using a γ-counter. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.

Article Snippet: The small-interfering RNA (siRNA) targeting FKBP4(siFKBP4#1, 5′- GATGATGTCTTCTGGTGTCAT-3′; siFKBP4 #2, 5′- GCATGGAGAAAGGAGAACATT-3′), siRNA for p53(sip53#1, 5′- CGGCGCACAGAGGAAGAGAAT-3′; sip53 #2, 5′- GTCCAGATGAAGCTCCCAGAA − 3′) were synthesized by Sangon biotech (Shanghai, China).

Techniques: Activation Assay, Control, Knockdown, Transfection, Negative Control, Western Blot, In Vitro

Journal: Frontiers in Cellular Neuroscience

Article Title: A decrease in Fkbp52 alters autophagosome maturation and A152T-tau clearance in vivo

doi: 10.3389/fncel.2024.1425222

Figure Lengend Snippet: Generation of fkbp4 mutant zebrafish. (A) Position of the CRISPR/Cas9 target site (light green) and PAM sequence (dark green) within exon 2 of the Danio rerio fkbp4 gene. The 1 bp insertion (red) on the mutant allele induces a frameshift and a premature stop codon (orange). (B) Structural domains of the WT Fkbp52 protein and of the “+1” mutant Fkbp52 protein. FK1: peptidyl-prolyl isomerase (PPIase) domain. FK2: PPIase-like domain. TPR: tetratricopeptide repeat domain. CaM: putative calmodulin binding site. (C) Representative immunoblot and resulting quantification showing Fkbp52 levels in WT, fkbp4 +/− and fkbp4 −/− embryos. Actin was used as loading control.

Article Snippet: The following antibodies were used: rabbit anti-FKBP4 (Invitrogen #PA5-22277, 1/500 dilution), mouse anti-β-actine (Sigma #1978, 1/2000 dilution), rabbit anti-α-tubuline (Abcam #ab18251, 1/5000 dilution) and HRP-conjugated secondary antibodies (Interchim, 1/10000 dilution).

Techniques: Mutagenesis, CRISPR, Sequencing, Binding Assay, Western Blot, Control

Journal: Frontiers in Cellular Neuroscience

Article Title: A decrease in Fkbp52 alters autophagosome maturation and A152T-tau clearance in vivo

doi: 10.3389/fncel.2024.1425222

Figure Lengend Snippet: A decrease in Fkbp52 impacts the retrograde velocity of Lamp1-positive vesicles in spinal cord axons. (A) Representative still images of time-lapse imaging at 48 hpf in control, fkbp4 +/− and fkbp4 −/− embryos injected with pT2-HuC:Lamp1-mEGFP ; white arrows and red arrowheads delineate the anterograde and retrograde transport of Lamp1-positive vesicles, respectively. Scale bar, 20 μm. (B) Quantification of anterograde and retrograde velocity of Lamp1-positive vesicles along axons of spinal cord in WT ( n = 11), fkbp4 +/− ( n = 5) and fkbp4 −/− ( n = 6) embryos from 3 independent experiments. Analysis includes ~12 tracked Lamp1 vesicles per embryo (Kruskal–Wallis, Dunn’s multiple comparisons test). Results are shown as mean ± SEM.

Article Snippet: The following antibodies were used: rabbit anti-FKBP4 (Invitrogen #PA5-22277, 1/500 dilution), mouse anti-β-actine (Sigma #1978, 1/2000 dilution), rabbit anti-α-tubuline (Abcam #ab18251, 1/5000 dilution) and HRP-conjugated secondary antibodies (Interchim, 1/10000 dilution).

Techniques: Imaging, Control, Injection

Journal: Frontiers in Cellular Neuroscience

Article Title: A decrease in Fkbp52 alters autophagosome maturation and A152T-tau clearance in vivo

doi: 10.3389/fncel.2024.1425222

Figure Lengend Snippet: The maturation of autophagosomes is impaired in fkbp4 mutants. (A,C) Representative z -projections of the hindbrain region were Lc3-positive vesicles were counted in HCGL transgenic fish, either treated with DMSO or Bafilomycin A1 (A) or crossed with fkbp4 mutants (C) . Top panels: mCherry; middle panels: EGFP; bottom panels: merged of top and middle panels. Autophagosomes have both red and green signal (yellow arrowheads) whereas autolysosomes show red only signal (white arrows). Scale bar, 5 μm (B) Quantification of the percentage of autolysosomes and autophagosomes relative to the total number of autophagic vacuoles in DMSO treated ( n = 5 embryos) and Bafilomycin A1 treated HGCL embryos ( n = 8 embryos) HCGL embryos from one experiment representative of 3 ( t -test with Welch’s correction, p = 0.0332). (D) Quantification of the percentage of autolysosomes relative to the total number of autophagic vacuoles in control fkbp4 +/+ / HCGL + ( n = 27), fkbp4 +/− / HCGL + ( n = 22, ** p = 0.0021 compared to control) and fkbp4 −/− / HCGL + ( n = 23 embryos, * p = 0.0373 compared to control) embryos from 3 independent experiments (One-way ANOVA with Tukey’s multiple comparison). Results are shown as mean ± SD.

Article Snippet: The following antibodies were used: rabbit anti-FKBP4 (Invitrogen #PA5-22277, 1/500 dilution), mouse anti-β-actine (Sigma #1978, 1/2000 dilution), rabbit anti-α-tubuline (Abcam #ab18251, 1/5000 dilution) and HRP-conjugated secondary antibodies (Interchim, 1/10000 dilution).

Techniques: Transgenic Assay, Control, Comparison

Journal: Frontiers in Cellular Neuroscience

Article Title: A decrease in Fkbp52 alters autophagosome maturation and A152T-tau clearance in vivo

doi: 10.3389/fncel.2024.1425222

Figure Lengend Snippet: The clearance of A152T-Tau is significantly slower in fkbp4 +/− mutants. (A) Representative images showing z -stack projections of the photoconverted neurons with Green-Dendra signal just before photoconversion (left panels) and Red-Dendra signal just after photoconversion, 24 h and 48 h later (right panels) in fkbp4 +/+ , fkbp4 +/− , and fkbp4 −/− embryos expressing Dendra-Tau A152T. Scale bar, 10 μm. (B) The remaining intensity of the initial Red-Dendra signal was calculated as percentage of the initial intensity 24 h and 48 h post photoconversion in fkbp4 +/+ , fkbp4 +/− , and fkbp4 −/− larvae with similar A152T-Tau expression ( fkbp4 +/+ : n = 16, average expression 143 ± 31; fkbp4 +/− : n = 11, average expression 141 ± 26; fkbp4 −/− : n = 5, average expression 141 ± 47) from 4 independent experiments ( fkbp4 +/− vs. fkbp4 +/+ at 24 h: **** p < 0.0001; fkbp4 +/− vs. fkbp4 +/+ at 48 h: ** p = 0.0012; two-way ANOVA with Tukey’s multiple comparison). Results are shown as mean ± SD.

Article Snippet: The following antibodies were used: rabbit anti-FKBP4 (Invitrogen #PA5-22277, 1/500 dilution), mouse anti-β-actine (Sigma #1978, 1/2000 dilution), rabbit anti-α-tubuline (Abcam #ab18251, 1/5000 dilution) and HRP-conjugated secondary antibodies (Interchim, 1/10000 dilution).

Techniques: Expressing, Comparison