Review





Similar Products

91
ATCC consensus tree
Consensus Tree, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ets+consensus/10__1094_slash_phyto___05___22___0151___r-123-2-30?v=ATCC
Average 91 stars, based on 1 article reviews
consensus tree - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

95
ATCC enterobacterial repetitive intergenic consensus i
Enterobacterial Repetitive Intergenic Consensus I, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ets+consensus/pmc10157257-89-11-19?v=ATCC
Average 95 stars, based on 1 article reviews
enterobacterial repetitive intergenic consensus i - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

94
ATCC g a c c 23s rrna consensus rbs β galactosidase log2 fold change b diminuta atcc 11568 bdim rs13760 c sp
G A C C 23s Rrna Consensus Rbs β Galactosidase Log2 Fold Change B Diminuta Atcc 11568 Bdim Rs13760 C Sp, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ets+consensus/pmc08144410__41467_2021_23362_MOESM1_ESM-90-139-153?v=ATCC
Average 94 stars, based on 1 article reviews
g a c c 23s rrna consensus rbs β galactosidase log2 fold change b diminuta atcc 11568 bdim rs13760 c sp - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

98
ATCC 29149 aayg locus consensus description gene size bp protein size aa rumgna 02411 polyprenyl glycosylphosphotransferase
29149 Aayg Locus Consensus Description Gene Size Bp Protein Size Aa Rumgna 02411 Polyprenyl Glycosylphosphotransferase, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ets+consensus/pmc08157926__pnas__2007595118__sapp-22-1-0?v=ATCC
Average 98 stars, based on 1 article reviews
29149 aayg locus consensus description gene size bp protein size aa rumgna 02411 polyprenyl glycosylphosphotransferase - by Bioz Stars, 2026-07
98/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology consensus oligonucleotides for the ets (pu.1) sc-2549
Consensus Oligonucleotides For The Ets (Pu.1) Sc 2549, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ets+consensus/pmc02626199-369-6-19?v=Santa+Cruz+Biotechnology
Average 90 stars, based on 1 article reviews
consensus oligonucleotides for the ets (pu.1) sc-2549 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Degnan Labs ets consensus binding core
Ets Consensus Binding Core, supplied by Degnan Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ets+consensus/pmc02668265-40-1-8?v=Degnan+Labs
Average 90 stars, based on 1 article reviews
ets consensus binding core - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology 32p- labelled probes-506d 5'cggccgcgggaagcagcctgcgagccgtgc'3, -506i 5'cggccgcgggaagcggccgcgggaagcagc'3 and ets-1 consensus 5'gatctcgagcaggaagttcga'3
32p Labelled Probes 506d 5'cggccgcgggaagcagcctgcgagccgtgc'3, 506i 5'cggccgcgggaagcggccgcgggaagcagc'3 And Ets 1 Consensus 5'gatctcgagcaggaagttcga'3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ets+consensus/10__1161_slash_atvbaha__107__140541-281-30-35?v=Santa+Cruz+Biotechnology
Average 90 stars, based on 1 article reviews
32p- labelled probes-506d 5'cggccgcgggaagcagcctgcgagccgtgc'3, -506i 5'cggccgcgggaagcggccgcgggaagcagc'3 and ets-1 consensus 5'gatctcgagcaggaagttcga'3 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

95
Santa Cruz Biotechnology consensus oligonucleotides
Consensus Oligonucleotides, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ets+consensus/pm17088079-44-10-19?v=Santa+Cruz+Biotechnology
Average 95 stars, based on 1 article reviews
consensus oligonucleotides - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology oligomers containing either a consensus ets or nfκb binding element
Oligomers Containing Either A Consensus Ets Or Nfκb Binding Element, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ets+consensus/pmc01526589-53-12-22?v=Santa+Cruz+Biotechnology
Average 90 stars, based on 1 article reviews
oligomers containing either a consensus ets or nfκb binding element - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results