|
ATCC
consensus tree Consensus Tree, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ets+consensus/10__1094_slash_phyto___05___22___0151___r-123-2-30?v=ATCC Average 91 stars, based on 1 article reviews
consensus tree - by Bioz Stars,
2026-07
91/100 stars
|
Buy from Supplier |
|
ATCC
enterobacterial repetitive intergenic consensus i Enterobacterial Repetitive Intergenic Consensus I, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ets+consensus/pmc10157257-89-11-19?v=ATCC Average 95 stars, based on 1 article reviews
enterobacterial repetitive intergenic consensus i - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
|
ATCC
g a c c 23s rrna consensus rbs β galactosidase log2 fold change b diminuta atcc 11568 bdim rs13760 c sp G A C C 23s Rrna Consensus Rbs β Galactosidase Log2 Fold Change B Diminuta Atcc 11568 Bdim Rs13760 C Sp, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ets+consensus/pmc08144410__41467_2021_23362_MOESM1_ESM-90-139-153?v=ATCC Average 94 stars, based on 1 article reviews
g a c c 23s rrna consensus rbs β galactosidase log2 fold change b diminuta atcc 11568 bdim rs13760 c sp - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
ATCC
29149 aayg locus consensus description gene size bp protein size aa rumgna 02411 polyprenyl glycosylphosphotransferase 29149 Aayg Locus Consensus Description Gene Size Bp Protein Size Aa Rumgna 02411 Polyprenyl Glycosylphosphotransferase, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ets+consensus/pmc08157926__pnas__2007595118__sapp-22-1-0?v=ATCC Average 98 stars, based on 1 article reviews
29149 aayg locus consensus description gene size bp protein size aa rumgna 02411 polyprenyl glycosylphosphotransferase - by Bioz Stars,
2026-07
98/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
consensus oligonucleotides for the ets (pu.1) sc-2549 Consensus Oligonucleotides For The Ets (Pu.1) Sc 2549, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ets+consensus/pmc02626199-369-6-19?v=Santa+Cruz+Biotechnology Average 90 stars, based on 1 article reviews
consensus oligonucleotides for the ets (pu.1) sc-2549 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Degnan Labs
ets consensus binding core Ets Consensus Binding Core, supplied by Degnan Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ets+consensus/pmc02668265-40-1-8?v=Degnan+Labs Average 90 stars, based on 1 article reviews
ets consensus binding core - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
32p- labelled probes-506d 5'cggccgcgggaagcagcctgcgagccgtgc'3, -506i 5'cggccgcgggaagcggccgcgggaagcagc'3 and ets-1 consensus 5'gatctcgagcaggaagttcga'3 32p Labelled Probes 506d 5'cggccgcgggaagcagcctgcgagccgtgc'3, 506i 5'cggccgcgggaagcggccgcgggaagcagc'3 And Ets 1 Consensus 5'gatctcgagcaggaagttcga'3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ets+consensus/10__1161_slash_atvbaha__107__140541-281-30-35?v=Santa+Cruz+Biotechnology Average 90 stars, based on 1 article reviews
32p- labelled probes-506d 5'cggccgcgggaagcagcctgcgagccgtgc'3, -506i 5'cggccgcgggaagcggccgcgggaagcagc'3 and ets-1 consensus 5'gatctcgagcaggaagttcga'3 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
consensus oligonucleotides Consensus Oligonucleotides, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ets+consensus/pm17088079-44-10-19?v=Santa+Cruz+Biotechnology Average 95 stars, based on 1 article reviews
consensus oligonucleotides - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
oligomers containing either a consensus ets or nfκb binding element Oligomers Containing Either A Consensus Ets Or Nfκb Binding Element, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ets+consensus/pmc01526589-53-12-22?v=Santa+Cruz+Biotechnology Average 90 stars, based on 1 article reviews
oligomers containing either a consensus ets or nfκb binding element - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |