Review





Similar Products

99
NSJ Bioreagents epcam antibody
Epcam Antibody, supplied by NSJ Bioreagents, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/epcam/custom%40v8327%4010%2E64898%2F2026%2E06%2E16%2E732438?v=NSJ+Bioreagents
Average 99 stars, based on 1 article reviews
epcam antibody - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
NSJ Bioreagents epcam antibody pe conjugate
Epcam Antibody Pe Conjugate, supplied by NSJ Bioreagents, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/epcam/custom%40v2184pe%4042319830?v=NSJ+Bioreagents
Average 99 stars, based on 1 article reviews
epcam antibody pe conjugate - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

86
Micromet Inc anti epcam antibody mt201
Expression of EpCAM on cell lines of SCC-UADT, HNSCC-associated fibroblasts, and normal fibroblasts. A Representative histogram and quantitative data on the percentage of EpCAM-positive cells as well as on the expression level of EpCAM of the SCC-UADT cell lines KYSE-30 (ESCC) and FaDu (HNSCC), the HNSCC-associated fibroblast cell line CAF-4, and the normal fibroblast cell line HFF-1 as assessed by flow cytometry upon immunostaining with the AlexaFluor488-labeled anti-EpCAM antibody VU1D9 (high EpCAM-affinity) (mean ± SEM for n = 4; * p < .05 vs. CAF; # p < .05 vs. HFF; § p < .05 vs. KYSE-30; & p < .05 vs. FaDu). B Representative histogram and quantitative data on the percentage of EpCAM-positive cells as well as on the expression level of EpCAM of the SCC-UADT cell lines KYSE-30 and FaDu, the HNSCC-associated fibroblast cell line CAF-4, and the normal fibroblast cell line HFF-1 as assessed by flow cytometry upon immunostaining with the AlexaFluor488-labeled anti-EpCAM antibody <t>MT201</t> (intermediate EpCAM-affinity; clinically validated) (mean ± SEM for n = 4; * p < .05 vs. CAF; # p < .05 vs. HFF; § p < .05 vs. KYSE-30; & p < .05 vs. FaDu)
Anti Epcam Antibody Mt201, supplied by Micromet Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/epcam/pmc13200314-37-2-6?v=Micromet+Inc
Average 86 stars, based on 1 article reviews
anti epcam antibody mt201 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Sangon Biotech epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac
Expression of EpCAM on cell lines of SCC-UADT, HNSCC-associated fibroblasts, and normal fibroblasts. A Representative histogram and quantitative data on the percentage of EpCAM-positive cells as well as on the expression level of EpCAM of the SCC-UADT cell lines KYSE-30 (ESCC) and FaDu (HNSCC), the HNSCC-associated fibroblast cell line CAF-4, and the normal fibroblast cell line HFF-1 as assessed by flow cytometry upon immunostaining with the AlexaFluor488-labeled anti-EpCAM antibody VU1D9 (high EpCAM-affinity) (mean ± SEM for n = 4; * p < .05 vs. CAF; # p < .05 vs. HFF; § p < .05 vs. KYSE-30; & p < .05 vs. FaDu). B Representative histogram and quantitative data on the percentage of EpCAM-positive cells as well as on the expression level of EpCAM of the SCC-UADT cell lines KYSE-30 and FaDu, the HNSCC-associated fibroblast cell line CAF-4, and the normal fibroblast cell line HFF-1 as assessed by flow cytometry upon immunostaining with the AlexaFluor488-labeled anti-EpCAM antibody <t>MT201</t> (intermediate EpCAM-affinity; clinically validated) (mean ± SEM for n = 4; * p < .05 vs. CAF; # p < .05 vs. HFF; § p < .05 vs. KYSE-30; & p < .05 vs. FaDu)
Epcam Primers Forward Ttgccgcagctcaggaagaatg Reverse Gcagccagctttgagcaaatgac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/epcam/pmc13145899-52-0-5?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Exosome Diagnostics epcam positive lc derived exosomes
Expression of EpCAM on cell lines of SCC-UADT, HNSCC-associated fibroblasts, and normal fibroblasts. A Representative histogram and quantitative data on the percentage of EpCAM-positive cells as well as on the expression level of EpCAM of the SCC-UADT cell lines KYSE-30 (ESCC) and FaDu (HNSCC), the HNSCC-associated fibroblast cell line CAF-4, and the normal fibroblast cell line HFF-1 as assessed by flow cytometry upon immunostaining with the AlexaFluor488-labeled anti-EpCAM antibody VU1D9 (high EpCAM-affinity) (mean ± SEM for n = 4; * p < .05 vs. CAF; # p < .05 vs. HFF; § p < .05 vs. KYSE-30; & p < .05 vs. FaDu). B Representative histogram and quantitative data on the percentage of EpCAM-positive cells as well as on the expression level of EpCAM of the SCC-UADT cell lines KYSE-30 and FaDu, the HNSCC-associated fibroblast cell line CAF-4, and the normal fibroblast cell line HFF-1 as assessed by flow cytometry upon immunostaining with the AlexaFluor488-labeled anti-EpCAM antibody <t>MT201</t> (intermediate EpCAM-affinity; clinically validated) (mean ± SEM for n = 4; * p < .05 vs. CAF; # p < .05 vs. HFF; § p < .05 vs. KYSE-30; & p < .05 vs. FaDu)
Epcam Positive Lc Derived Exosomes, supplied by Exosome Diagnostics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/epcam/pm42161118-163-12-0?v=Exosome+Diagnostics
Average 86 stars, based on 1 article reviews
epcam positive lc derived exosomes - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

Image Search Results


Expression of EpCAM on cell lines of SCC-UADT, HNSCC-associated fibroblasts, and normal fibroblasts. A Representative histogram and quantitative data on the percentage of EpCAM-positive cells as well as on the expression level of EpCAM of the SCC-UADT cell lines KYSE-30 (ESCC) and FaDu (HNSCC), the HNSCC-associated fibroblast cell line CAF-4, and the normal fibroblast cell line HFF-1 as assessed by flow cytometry upon immunostaining with the AlexaFluor488-labeled anti-EpCAM antibody VU1D9 (high EpCAM-affinity) (mean ± SEM for n = 4; * p < .05 vs. CAF; # p < .05 vs. HFF; § p < .05 vs. KYSE-30; & p < .05 vs. FaDu). B Representative histogram and quantitative data on the percentage of EpCAM-positive cells as well as on the expression level of EpCAM of the SCC-UADT cell lines KYSE-30 and FaDu, the HNSCC-associated fibroblast cell line CAF-4, and the normal fibroblast cell line HFF-1 as assessed by flow cytometry upon immunostaining with the AlexaFluor488-labeled anti-EpCAM antibody MT201 (intermediate EpCAM-affinity; clinically validated) (mean ± SEM for n = 4; * p < .05 vs. CAF; # p < .05 vs. HFF; § p < .05 vs. KYSE-30; & p < .05 vs. FaDu)

Journal: BMC Cancer

Article Title: Targeting EpCAM expression via near-infrared fluorescent antibodies enables microscopic delineation of primary and recurrent HNSCC

doi: 10.1186/s12885-026-16172-2

Figure Lengend Snippet: Expression of EpCAM on cell lines of SCC-UADT, HNSCC-associated fibroblasts, and normal fibroblasts. A Representative histogram and quantitative data on the percentage of EpCAM-positive cells as well as on the expression level of EpCAM of the SCC-UADT cell lines KYSE-30 (ESCC) and FaDu (HNSCC), the HNSCC-associated fibroblast cell line CAF-4, and the normal fibroblast cell line HFF-1 as assessed by flow cytometry upon immunostaining with the AlexaFluor488-labeled anti-EpCAM antibody VU1D9 (high EpCAM-affinity) (mean ± SEM for n = 4; * p < .05 vs. CAF; # p < .05 vs. HFF; § p < .05 vs. KYSE-30; & p < .05 vs. FaDu). B Representative histogram and quantitative data on the percentage of EpCAM-positive cells as well as on the expression level of EpCAM of the SCC-UADT cell lines KYSE-30 and FaDu, the HNSCC-associated fibroblast cell line CAF-4, and the normal fibroblast cell line HFF-1 as assessed by flow cytometry upon immunostaining with the AlexaFluor488-labeled anti-EpCAM antibody MT201 (intermediate EpCAM-affinity; clinically validated) (mean ± SEM for n = 4; * p < .05 vs. CAF; # p < .05 vs. HFF; § p < .05 vs. KYSE-30; & p < .05 vs. FaDu)

Article Snippet: Similarly, human, anti-EpCAM antibody MT201 (adecatumumab, Micromet Inc.) and isotype control antibody (#31154; Thermo Fisher Scientific, Waltham, Massachusetts, USA) were labeled with IRDye800CW (LI-COR Biosciences; Lincoln, Nebraska, USA) according to the manufacturer’s instructions.

Techniques: Expressing, Flow Cytometry, Immunostaining, Labeling

A , B Representative multi-color epifluorescence microscopy images of immunohistochemically stained cryo-sections of bicellular core-shell-spheroids of HNSCC (FaDu; shell) and HNSCC-associated fibroblasts (CAF-4; core) illustrating the expression of EpCAM (red), S100A4/fibroblasts (green), DAPI/DNA (blue; scale bar: 200 μm; white dashed line: border FaDu/CAF-4) as well as quantitative data on the mean fluorescence intensity of the immunostaining with the IRDye800CW-labeled anti-EpCAM antibody VU1D9 ( A ) or MT201 ( B ) or the respective control antibodies in the HNSCC shell as well as the HNSCC-associated fibroblast core (CAF-4) (mean ± SEM for n = 3; * p < .05 vs. isotype ctrl (CAF4); # p < .05 vs. isotype ctrl (FaDu); § p < .05 vs. VU1D9 (CAF4) or MT201 (CAF4) ; & p < .05 VU1D9 (FaDu) or MT201 (FaDu)). C , D Representative multi-color epifluorescence microscopy images of immunohistochemically stained cryo-sections of bicellular core-shell-spheroids of ESCC (KYSE-30; shell) and HNSCC-associated fibroblasts (CAF-4; core) illustrating the expression of EpCAM (red), S100A4/fibroblasts (green), DAPI/DNA (blue; scale bar: 200 μm; white dashed line: border KYSE-30/CAF-4) as well as quantitative data on the mean fluorescence intensity of the immunostaining with the IRDye800CW-labeled anti-EpCAM antibody VU1D9 ( C ) or MT201 ( D ) or the respective control antibodies in the ESCC shell as well as the HNSCC-associated fibroblast core (CAF-4) (mean ± SEM for n = 3; * p < .05 vs. isotype ctrl (CAF4); # p < .05 vs. isotype ctrl (KYSE-30); § p < .05 vs. VU1D9 (CAF4) or MT201 (CAF4) ; & p < .05 VU1D9 (KYSE-30) or MT201 (KYSE-30))

Journal: BMC Cancer

Article Title: Targeting EpCAM expression via near-infrared fluorescent antibodies enables microscopic delineation of primary and recurrent HNSCC

doi: 10.1186/s12885-026-16172-2

Figure Lengend Snippet: A , B Representative multi-color epifluorescence microscopy images of immunohistochemically stained cryo-sections of bicellular core-shell-spheroids of HNSCC (FaDu; shell) and HNSCC-associated fibroblasts (CAF-4; core) illustrating the expression of EpCAM (red), S100A4/fibroblasts (green), DAPI/DNA (blue; scale bar: 200 μm; white dashed line: border FaDu/CAF-4) as well as quantitative data on the mean fluorescence intensity of the immunostaining with the IRDye800CW-labeled anti-EpCAM antibody VU1D9 ( A ) or MT201 ( B ) or the respective control antibodies in the HNSCC shell as well as the HNSCC-associated fibroblast core (CAF-4) (mean ± SEM for n = 3; * p < .05 vs. isotype ctrl (CAF4); # p < .05 vs. isotype ctrl (FaDu); § p < .05 vs. VU1D9 (CAF4) or MT201 (CAF4) ; & p < .05 VU1D9 (FaDu) or MT201 (FaDu)). C , D Representative multi-color epifluorescence microscopy images of immunohistochemically stained cryo-sections of bicellular core-shell-spheroids of ESCC (KYSE-30; shell) and HNSCC-associated fibroblasts (CAF-4; core) illustrating the expression of EpCAM (red), S100A4/fibroblasts (green), DAPI/DNA (blue; scale bar: 200 μm; white dashed line: border KYSE-30/CAF-4) as well as quantitative data on the mean fluorescence intensity of the immunostaining with the IRDye800CW-labeled anti-EpCAM antibody VU1D9 ( C ) or MT201 ( D ) or the respective control antibodies in the ESCC shell as well as the HNSCC-associated fibroblast core (CAF-4) (mean ± SEM for n = 3; * p < .05 vs. isotype ctrl (CAF4); # p < .05 vs. isotype ctrl (KYSE-30); § p < .05 vs. VU1D9 (CAF4) or MT201 (CAF4) ; & p < .05 VU1D9 (KYSE-30) or MT201 (KYSE-30))

Article Snippet: Similarly, human, anti-EpCAM antibody MT201 (adecatumumab, Micromet Inc.) and isotype control antibody (#31154; Thermo Fisher Scientific, Waltham, Massachusetts, USA) were labeled with IRDye800CW (LI-COR Biosciences; Lincoln, Nebraska, USA) according to the manufacturer’s instructions.

Techniques: Epifluorescence Microscopy, Staining, Expressing, Fluorescence, Immunostaining, Labeling, Control

EpCAM expression in HNSCC, non-malignant HNSCC-associated and non-HNSCC-associated stroma, as well as non-malignant mucosa in cryosections of patient tissue samples with primary and recurrent HNSCC. A , B Representative light microscopy images (overview, scale bar: 200 μm; right: details, scale bar: 60 μm) of immunohistochemically stained HNSCC tissue (hematoxylin staining of nuclei; anti-EpCAM-antibody VU1D9: red) as well as quantitative data on the percentage of EpCAM-positive HNSCC tissue of all the HNSCC tissue visible in the patient tissue samples with primary ( A ) and recurrent ( B ) HNSCC ( n = 9 per group) upon immunohistochemical EpCAM / hematoxylin staining. Quantitative data is illustrated as absolute expression percentages (i) of the single patient samples as bar chart and (ii) grouped as pie chart (expression percentage 0–19%: blue; 20–79%: green; 80–100%: red). C-F Representative multi-color epifluorescence microscopy images of immunohistochemically stained additional cryosections of the same tissue samples of HNSCC and of non-malignant mucosa illustrating the expression of EpCAM (red) and DAPI/DNA (blue; scale bar: 100 μm) as well as quantitative data on the relative background-corrected mean fluorescence intensity levels of selected regions of interest (HNSCC, non-malignant mucosa, HNSCC-associated stroma, and non-HNSCC-associated stroma (subepithelial)) as assessed by anti-EpCAM antibody immunostaining with the antibody VU1D9 ( C/E ) and MT201 ( D/F ) in tissue samples of patients with primary ( C/D ) and recurrent ( E/F ) HNSCC (mean ± SEM for n = 9; * p < .05 vs. HNSCC)

Journal: BMC Cancer

Article Title: Targeting EpCAM expression via near-infrared fluorescent antibodies enables microscopic delineation of primary and recurrent HNSCC

doi: 10.1186/s12885-026-16172-2

Figure Lengend Snippet: EpCAM expression in HNSCC, non-malignant HNSCC-associated and non-HNSCC-associated stroma, as well as non-malignant mucosa in cryosections of patient tissue samples with primary and recurrent HNSCC. A , B Representative light microscopy images (overview, scale bar: 200 μm; right: details, scale bar: 60 μm) of immunohistochemically stained HNSCC tissue (hematoxylin staining of nuclei; anti-EpCAM-antibody VU1D9: red) as well as quantitative data on the percentage of EpCAM-positive HNSCC tissue of all the HNSCC tissue visible in the patient tissue samples with primary ( A ) and recurrent ( B ) HNSCC ( n = 9 per group) upon immunohistochemical EpCAM / hematoxylin staining. Quantitative data is illustrated as absolute expression percentages (i) of the single patient samples as bar chart and (ii) grouped as pie chart (expression percentage 0–19%: blue; 20–79%: green; 80–100%: red). C-F Representative multi-color epifluorescence microscopy images of immunohistochemically stained additional cryosections of the same tissue samples of HNSCC and of non-malignant mucosa illustrating the expression of EpCAM (red) and DAPI/DNA (blue; scale bar: 100 μm) as well as quantitative data on the relative background-corrected mean fluorescence intensity levels of selected regions of interest (HNSCC, non-malignant mucosa, HNSCC-associated stroma, and non-HNSCC-associated stroma (subepithelial)) as assessed by anti-EpCAM antibody immunostaining with the antibody VU1D9 ( C/E ) and MT201 ( D/F ) in tissue samples of patients with primary ( C/D ) and recurrent ( E/F ) HNSCC (mean ± SEM for n = 9; * p < .05 vs. HNSCC)

Article Snippet: Similarly, human, anti-EpCAM antibody MT201 (adecatumumab, Micromet Inc.) and isotype control antibody (#31154; Thermo Fisher Scientific, Waltham, Massachusetts, USA) were labeled with IRDye800CW (LI-COR Biosciences; Lincoln, Nebraska, USA) according to the manufacturer’s instructions.

Techniques: Expressing, Light Microscopy, Staining, Immunohistochemical staining, Epifluorescence Microscopy, Fluorescence, Immunostaining

Postoperative immunostaining of live intraoperatively harvested and cultured patient samples with the IRDye800CW-labeled anti-EpCAM-antibody MT201 (adecatumumab) for fluorescence-based differentiation of HNSCC, non-malignant mucosa, and non-malignant HNSCC-associated stroma. A Representative multi-color confocal laserscanning microscopy images of live intraoperatively harvested and postoperatively immunostained paired tissue sample of HNSCC and non-malignant mucosa (DAPI/DNA: blue; CellMask Green/cell membranes: green; MT201/EpCAM: red; Corresponding H&E staining: multicolor; scale bar: 100 μm) as well as ( B) quantitative data on the relative background-corrected mean fluorescence intensity levels of selected regions of interest (HNSCC, non-malignant mucosa, and non-malignant HNSCC-associated stroma) as assessed by immunostaining with the anti-EpCAM antibody MT201 (adecatumumab) in tissue samples of patients with primary and recurrent HNSCC (mean ± SEM for n = 12; * p < .05 vs. HNSCC)

Journal: BMC Cancer

Article Title: Targeting EpCAM expression via near-infrared fluorescent antibodies enables microscopic delineation of primary and recurrent HNSCC

doi: 10.1186/s12885-026-16172-2

Figure Lengend Snippet: Postoperative immunostaining of live intraoperatively harvested and cultured patient samples with the IRDye800CW-labeled anti-EpCAM-antibody MT201 (adecatumumab) for fluorescence-based differentiation of HNSCC, non-malignant mucosa, and non-malignant HNSCC-associated stroma. A Representative multi-color confocal laserscanning microscopy images of live intraoperatively harvested and postoperatively immunostained paired tissue sample of HNSCC and non-malignant mucosa (DAPI/DNA: blue; CellMask Green/cell membranes: green; MT201/EpCAM: red; Corresponding H&E staining: multicolor; scale bar: 100 μm) as well as ( B) quantitative data on the relative background-corrected mean fluorescence intensity levels of selected regions of interest (HNSCC, non-malignant mucosa, and non-malignant HNSCC-associated stroma) as assessed by immunostaining with the anti-EpCAM antibody MT201 (adecatumumab) in tissue samples of patients with primary and recurrent HNSCC (mean ± SEM for n = 12; * p < .05 vs. HNSCC)

Article Snippet: Similarly, human, anti-EpCAM antibody MT201 (adecatumumab, Micromet Inc.) and isotype control antibody (#31154; Thermo Fisher Scientific, Waltham, Massachusetts, USA) were labeled with IRDye800CW (LI-COR Biosciences; Lincoln, Nebraska, USA) according to the manufacturer’s instructions.

Techniques: Immunostaining, Cell Culture, Labeling, Fluorescence, Microscopy, Staining