|
Synthego Inc
crispr crrna sequence Crispr Crrna Sequence, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+crrna+sequence/crispr+crrna+sequence/bio_rxiv__2025__10__03__680197-183-1-20 Average 86 stars, based on 1 article reviews
crispr crrna sequence - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
dna sequences and crispr rna (crrna) Dna Sequences And Crispr Rna (Crrna), supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+crrna+sequence/crispr+rna++crrna+/pm39308213__ac4c03959_si_001-13-1-12 Average 90 stars, based on 1 article reviews
dna sequences and crispr rna (crrna) - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
Benchling Inc
20 base pair crispr-rna (crrna) sequences 20 Base Pair Crispr Rna (Crrna) Sequences, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+crrna+sequence/20+base+pair+crispr+rna++crrna++sequences/pmc11251090-333-1-9 Average 90 stars, based on 1 article reviews
20 base pair crispr-rna (crrna) sequences - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
Danaher Inc
alt r crispr cas12a crrna targeting sequence ggatgctgtgtccagcttatgctt Alt R Crispr Cas12a Crrna Targeting Sequence Ggatgctgtgtccagcttatgctt, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+crrna+sequence/bio_rxiv__2023__12__19__572386-179-3-9 Average 86 stars, based on 1 article reviews
alt r crispr cas12a crrna targeting sequence ggatgctgtgtccagcttatgctt - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
|
Danaher Inc
crispr rna crrna sequences Crispr Rna Crrna Sequences, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+crrna+sequence/pm37938828-283-9-21 Average 86 stars, based on 1 article reviews
crispr rna crrna sequences - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
|
Hokkaido System Science Co
polynucleotides for expressing crrna corresponding to the spacer sequence of e. coli crispr Polynucleotides For Expressing Crrna Corresponding To The Spacer Sequence Of E. Coli Crispr, supplied by Hokkaido System Science Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+crrna+sequence/polynucleotides+for+expressing+crrna+corresponding+to+the+spacer+sequence+of+e++coli+crispr/us11807869-293-32-50 Average 90 stars, based on 1 article reviews
polynucleotides for expressing crrna corresponding to the spacer sequence of e. coli crispr - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
Danaher Inc
nucleotide protospacer sequence crrna Nucleotide Protospacer Sequence Crrna, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+crrna+sequence/Alt-R+CRISPR-Cas9+Negative+Control+crRNA/bio_rxiv__2023__05__05__539557-335-2-6 Average 95 stars, based on 1 article reviews
nucleotide protospacer sequence crrna - by Bioz Stars,
2026-11
95/100 stars
|
Buy from Supplier |
|
Danaher Inc
cas9 crrna sequence Cas9 Crrna Sequence, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+crrna+sequence/CRISPR-Cas9+crRNA/bio_rxiv__2023__01__11__523593-62-25-32 Average 95 stars, based on 1 article reviews
cas9 crrna sequence - by Bioz Stars,
2026-11
95/100 stars
|
Buy from Supplier |
|
GenScript corporation
fragment containing the intact j23119 (spei) promoter and the front sequence of crispr rna (crrna) Fragment Containing The Intact J23119 (Spei) Promoter And The Front Sequence Of Crispr Rna (Crrna), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+crrna+sequence/fragment+containing+the+intact+j23119++spei++promoter+and+the+front+sequence+of+crispr+rna++crrna+/pmc09431524-179-2-20 Average 90 stars, based on 1 article reviews
fragment containing the intact j23119 (spei) promoter and the front sequence of crispr rna (crrna) - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |