Journal: Cell reports

Article Title: A therapeutically targetable positive feedback loop between lnc-HLX-2-7 , HLX, and MYC that promotes group 3 medulloblastoma

doi: 10.1016/j.celrep.2024.113938

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: shRNA Scrambled Control lentivirus plasmids , GeneCopoeia , Cat# CSHCTR001-LVRU6GP.

Techniques: Recombinant, Clone Assay, Luciferase, TUNEL Assay, Control, Negative Control, shRNA, Plasmid Preparation, Software, Imaging, Fluorescence, Microscopy

Journal: iScience

Article Title: Altering heparan sulfate suppresses cell abnormalities and neuron loss in Drosophila presenilin model of Alzheimer Disease

doi: 10.1016/j.isci.2024.110256

Figure Lengend Snippet: Knockdown of Ndst1 in primary mouse astrocytes lowers levels of intracellular liposomes (A) Micrographs showing levels of lipid droplets (LD), a marker for lentiviral transfection (green), and nuclear stain (DAPI, blue) in control, cells transfected with either a scramble sequence shRNA vector or one targeting Ndst1. Ndst1 shRNA produced reduced levels of LD number and volume (panels on the right), as well as decreases in Plin2 expression measured by qPCR. (B) The effect of Ndst1 shRNA was evaluated on astrocytes from animals expressing humanized variants of APOE3 and APOE4. LD volumes were significantly reduced by Ndst1 knockdown compared to scramble controls in astrocytes from either of these two genotypes [images show individual cells, nuclei (blue), and LD (red), and graphs provide quantitation of LD volumes. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001). Error bars represent SEM.

Article Snippet: Lentivirus Negative Scramble shRNA Target Sequence: GCACTACCAGAGCTAACTCAGATAGTACT , Origene , Cat#TR30021.

Techniques: Knockdown, Liposomes, Marker, Transfection, Staining, Control, Sequencing, shRNA, Plasmid Preparation, Produced, Expressing, Quantitation Assay

Journal: iScience

Article Title: Altering heparan sulfate suppresses cell abnormalities and neuron loss in Drosophila presenilin model of Alzheimer Disease

doi: 10.1016/j.isci.2024.110256

Figure Lengend Snippet:

Article Snippet: Lentivirus Negative Scramble shRNA Target Sequence: GCACTACCAGAGCTAACTCAGATAGTACT , Origene , Cat#TR30021.

Techniques: Virus, shRNA, Sequencing, Recombinant, Staining, Synthesized, Transfection, Software, RNA Sequencing