|
Microsynth ag
control odn 1982 Control Odn 1982, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+odn+1982/control+odn+1982/pmc05373453-300-13-16 Average 90 stars, based on 1 article reviews
control odn 1982 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Coley Pharmaceutical
control odn (no. 1982) Control Odn (No. 1982), supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+odn+1982/control+odn/us08206725-395-11-18 Average 90 stars, based on 1 article reviews
control odn (no. 1982) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Enzo Biochem
control 1982 odn Control 1982 Odn, supplied by Enzo Biochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+odn+1982/control+1982+odn/pmc02597678-37-11-14 Average 90 stars, based on 1 article reviews
control 1982 odn - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Coley Pharmaceutical
phosphorothioate-linked non-cpg control odn 1982 Phosphorothioate Linked Non Cpg Control Odn 1982, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+odn+1982/phosphorothioate+linked+non+cpg+control+odn+1982/pmc01976275-44-19-31 Average 90 stars, based on 1 article reviews
phosphorothioate-linked non-cpg control odn 1982 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Coley Pharmaceutical
control odn 1982 Control Odn 1982, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+odn+1982/control+odn/pm18072859-38-6-12 Average 90 stars, based on 1 article reviews
control odn 1982 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Coley Pharmaceutical
negative control 1982 odn devoid of cpg motifs Negative Control 1982 Odn Devoid Of Cpg Motifs, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+odn+1982/negative+control+1982+odn+devoid+of+cpg+motifs/pm17982080-76-10-19 Average 90 stars, based on 1 article reviews
negative control 1982 odn devoid of cpg motifs - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Generi Biotech
control odn 1982 Control Odn 1982, supplied by Generi Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+odn+1982/control+odn+1982/pm16217768-48-4-19 Average 90 stars, based on 1 article reviews
control odn 1982 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Coley Pharmaceutical
control odn sequence 1982 Control Odn Sequence 1982, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+odn+1982/control+odn/pmc01064943-53-27-38 Average 90 stars, based on 1 article reviews
control odn sequence 1982 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Coley Pharmaceutical
control odn sequence 1982 (tccaggacttctctcaggtt) Control Odn Sequence 1982 (Tccaggacttctctcaggtt), supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+odn+1982/control+odn/pmc01064943-141-27-38 Average 90 stars, based on 1 article reviews
control odn sequence 1982 (tccaggacttctctcaggtt) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |