|
TaKaRa
smartchip mydesign chip Smartchip Mydesign Chip, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/10__1016_slash_j__still__2025__106963-74-19-22?v=TaKaRa Average 97 stars, based on 1 article reviews
smartchip mydesign chip - by Bioz Stars,
2026-08
97/100 stars
|
Buy from Supplier |
|
Illumina Inc
truseq dna pcr free library preparation kit Truseq Dna Pcr Free Library Preparation Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pmc12828172-205-10-16?v=Illumina+Inc Average 96 stars, based on 1 article reviews
truseq dna pcr free library preparation kit - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Sangon Biotech
chip pcr primers Chip Pcr Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pm41520738-143-1-11?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
chip pcr primers - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Proteintech
chip quantitative pcr Chip Quantitative Pcr, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pm41481720-262-1-15?v=Proteintech Average 96 stars, based on 1 article reviews
chip quantitative pcr - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Illumina Inc
truseq chip sample prep kit set a and pcr box Truseq Chip Sample Prep Kit Set A And Pcr Box, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pmc12664603-83-0-9?v=Illumina+Inc Average 96 stars, based on 1 article reviews
truseq chip sample prep kit set a and pcr box - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Stilla Technologies
r10105 sapphire chips digital pcr stilla technologies R10105 Sapphire Chips Digital Pcr Stilla Technologies, supplied by Stilla Technologies, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pm41043432-329-179-184?v=Stilla+Technologies Average 86 stars, based on 1 article reviews
r10105 sapphire chips digital pcr stilla technologies - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Azenta
chip pcr no 3 r ccatccaatcggtagtagcg Chip Pcr No 3 R Ccatccaatcggtagtagcg, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pmc12490252-142-0-3?v=Azenta Average 86 stars, based on 1 article reviews
chip pcr no 3 r ccatccaatcggtagtagcg - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Azenta
chip pcr no 1 r gcccaatacgaccaaatcc Chip Pcr No 1 R Gcccaatacgaccaaatcc, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pmc12490252-138-0-3?v=Azenta Average 86 stars, based on 1 article reviews
chip pcr no 1 r gcccaatacgaccaaatcc - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |