Review





Similar Products

97
TaKaRa smartchip mydesign chip
Smartchip Mydesign Chip, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/10__1016_slash_j__still__2025__106963-74-19-22?v=TaKaRa
Average 97 stars, based on 1 article reviews
smartchip mydesign chip - by Bioz Stars, 2026-07
97/100 stars
  Buy from Supplier

96
Illumina Inc truseq dna pcr free library preparation kit
Truseq Dna Pcr Free Library Preparation Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pmc12828172-205-10-16?v=Illumina+Inc
Average 96 stars, based on 1 article reviews
truseq dna pcr free library preparation kit - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

86
Sangon Biotech chip pcr primers
Chip Pcr Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pm41520738-143-1-11?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
chip pcr primers - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

96
Proteintech chip quantitative pcr
Chip Quantitative Pcr, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pm41481720-262-1-15?v=Proteintech
Average 96 stars, based on 1 article reviews
chip quantitative pcr - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

96
Illumina Inc truseq chip sample prep kit set a and pcr box
Truseq Chip Sample Prep Kit Set A And Pcr Box, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pmc12664603-83-0-9?v=Illumina+Inc
Average 96 stars, based on 1 article reviews
truseq chip sample prep kit set a and pcr box - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

86
Stilla Technologies r10105 sapphire chips digital pcr stilla technologies
R10105 Sapphire Chips Digital Pcr Stilla Technologies, supplied by Stilla Technologies, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pm41043432-329-179-184?v=Stilla+Technologies
Average 86 stars, based on 1 article reviews
r10105 sapphire chips digital pcr stilla technologies - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Azenta chip pcr no 3 r ccatccaatcggtagtagcg
Chip Pcr No 3 R Ccatccaatcggtagtagcg, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pmc12490252-142-0-3?v=Azenta
Average 86 stars, based on 1 article reviews
chip pcr no 3 r ccatccaatcggtagtagcg - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Azenta chip pcr no 1 r gcccaatacgaccaaatcc
Chip Pcr No 1 R Gcccaatacgaccaaatcc, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pmc12490252-138-0-3?v=Azenta
Average 86 stars, based on 1 article reviews
chip pcr no 1 r gcccaatacgaccaaatcc - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

Image Search Results