|
New England Biolabs
30 o me m7gpppg anti reverse cap analog arca new england biolabs 30 O Me M7gpppg Anti Reverse Cap Analog Arca New England Biolabs, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/analog+30/pm38444607-217-0-5?v=New+England+Biolabs Average 95 stars, based on 1 article reviews
30 o me m7gpppg anti reverse cap analog arca new england biolabs - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
Molecular Dynamics Inc
analog 30 Analog 30, supplied by Molecular Dynamics Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/analog+30/pm42287230-178-1-42?v=Molecular+Dynamics+Inc Average 86 stars, based on 1 article reviews
analog 30 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Keysight Technologies
30 ghz analog signal generator e8257d 30 Ghz Analog Signal Generator E8257d, supplied by Keysight Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/analog+30/pmc11336070-129-27-31?v=Keysight+Technologies Average 90 stars, based on 1 article reviews
30 ghz analog signal generator e8257d - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Werke GmbH
analog pendulum hammer pw 30-e Analog Pendulum Hammer Pw 30 E, supplied by Werke GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/analog+30/10__1016_slash_j__actamat__2024__120326-117-18-24?v=Werke+GmbH Average 90 stars, based on 1 article reviews
analog pendulum hammer pw 30-e - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Synthego Inc
20-o-methyl analog and 30 phosphorothioate internucleotide modified-sgrna synthetic from 20 O Methyl Analog And 30 Phosphorothioate Internucleotide Modified Sgrna Synthetic From, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/analog+30/pm38341433-277-6-18?v=Synthego+Inc Average 90 stars, based on 1 article reviews
20-o-methyl analog and 30 phosphorothioate internucleotide modified-sgrna synthetic from - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Synthego Inc
20-o-methyl analog and 30 phosphorothioate internucleotide modified-sgrna synthetic ugaacugagucgcuauccag 20 O Methyl Analog And 30 Phosphorothioate Internucleotide Modified Sgrna Synthetic Ugaacugagucgcuauccag, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/analog+30/pmc10858947-293-6-19?v=Synthego+Inc Average 90 stars, based on 1 article reviews
20-o-methyl analog and 30 phosphorothioate internucleotide modified-sgrna synthetic ugaacugagucgcuauccag - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
TriLink
cap1 analog cleancap ag (30 ome) Cap1 Analog Cleancap Ag (30 Ome), supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/analog+30/10__1016_slash_j__apsb__2023__11__003-84-29-31?v=TriLink Average 90 stars, based on 1 article reviews
cap1 analog cleancap ag (30 ome) - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
TriLink
cleancap analogs ag, gg, ag-30-ch3 and gg-30-ch3 Cleancap Analogs Ag, Gg, Ag 30 Ch3 And Gg 30 Ch3, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/analog+30/pm35988718-150-137-113?v=TriLink Average 90 stars, based on 1 article reviews
cleancap analogs ag, gg, ag-30-ch3 and gg-30-ch3 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
POWERLAB INC
analog-to-digital converter powerlab r8/30 Analog To Digital Converter Powerlab R8/30, supplied by POWERLAB INC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/analog+30/10__1113_slash_jp285203-133-6-8?v=POWERLAB+INC Average 90 stars, based on 1 article reviews
analog-to-digital converter powerlab r8/30 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
New England Biolabs
30 o me m7g 50 ppp 50 g rna cap structure analog 30 O Me M7g 50 Ppp 50 G Rna Cap Structure Analog, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/analog+30/pmc10462787__mmc3-166-6-11?v=New+England+Biolabs Average 93 stars, based on 1 article reviews
30 o me m7g 50 ppp 50 g rna cap structure analog - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |