Journal: Nature Communications

Article Title: Sex difference in BAT thermogenesis depends on PGC-1α–mediated phospholipid synthesis in mice

doi: 10.1038/s41467-025-61219-w

Figure Lengend Snippet: a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated viruses (AAV) -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.

Article Snippet: AAV vectors expressing shRNA that targets Chrebp (Mlxipl, target sequence: GGACTGCTTCTTGTCCGATAT) and scrambled shRNA were obtained from VectorBuilder VB230122-1164ver and VB010000-0023jze, respectively.

Techniques: Gene Expression, Injection, Labeling

Journal: Stem Cell Research & Therapy

Article Title: Near-infrared light induces neurogenesis and modulates anxiety-like behavior

doi: 10.1186/s13287-024-04114-3

Figure Lengend Snippet: NIR irradiation promoted NSC proliferation and astrocyte differentiation (A) Scheme of the experimental design. (B) shRNA- Opn4 injection down-regulated OPN4 and GFAP expression in the hippocampus of mice with NIR irradiation. (C) Immunofluorescence staining for GFAP in the control and shRNA- Opn4 group with NIR irradiation. (D) Quantitative data from immunofluorescence staining (5 slices from 3 mice for each group). Values are presented as mean ± SEM, *** p < 0.001. (E) Representative micrographs of NSC sphere formation after NIR irradiation and Opn4 inhibitor (AA92593) treatment. (F) Quantitative data from NSC sphere counts with the indicated treatment. The results from four repeat wells of a 24-well plate. Values are given as mean ± SEM. * p < 0.05. (G) Photographs of the EdU incorporation assay of NSCs under NIR exposure. (H) Quantitative data from NSC proliferation under illumination across 12–13 randomly selected view fields of the tested samples using ImageJ software. Values are given as mean ± SEM. * P < 0.05, and *** P < 0.001

Article Snippet: Custom-made AAV vectors carrying shRNA targeting mouse Opn4 (shRNA- Opn4 ) and control AAV-CMV (shRNA- control) were purchased from GeneChem Biotechnology Co., Ltd. (Shanghai, China).

Techniques: Irradiation, shRNA, Injection, Expressing, Immunofluorescence, Staining, Control, Software

Journal: Zoological Research

Article Title: NLRP3-mediated autophagy dysfunction links gut microbiota dysbiosis to tau pathology in chronic sleep deprivation

doi: 10.24272/j.issn.2095-8137.2024.085

Figure Lengend Snippet: Chronic SD induced NLRP3 inflammasome activation and autophagy inhibition in the hippocampus of mice

Article Snippet: AAV vectors containing a non-specific sequence (CGC TGA GTA CTT CGA AAT GTC) or short hairpin RNA targeting NLRP3 (CCA GGA TCC TCT TCC TCA TA) were designed and obtained from GeneChem (China).

Techniques: Activation Assay, Inhibition

Journal: Zoological Research

Article Title: NLRP3-mediated autophagy dysfunction links gut microbiota dysbiosis to tau pathology in chronic sleep deprivation

doi: 10.24272/j.issn.2095-8137.2024.085

Figure Lengend Snippet: SD microbiota transplantation inhibited autophagic flux and enhanced NLRP3 inflammasome activity

Article Snippet: AAV vectors containing a non-specific sequence (CGC TGA GTA CTT CGA AAT GTC) or short hairpin RNA targeting NLRP3 (CCA GGA TCC TCT TCC TCA TA) were designed and obtained from GeneChem (China).

Techniques: Transplantation Assay, Activity Assay

Journal: Zoological Research

Article Title: NLRP3-mediated autophagy dysfunction links gut microbiota dysbiosis to tau pathology in chronic sleep deprivation

doi: 10.24272/j.issn.2095-8137.2024.085

Figure Lengend Snippet: Behavioral and pathological changes induced by chronic SD were reversed in NLRP3 -/- mice

Article Snippet: AAV vectors containing a non-specific sequence (CGC TGA GTA CTT CGA AAT GTC) or short hairpin RNA targeting NLRP3 (CCA GGA TCC TCT TCC TCA TA) were designed and obtained from GeneChem (China).

Techniques:

Journal: Zoological Research

Article Title: NLRP3-mediated autophagy dysfunction links gut microbiota dysbiosis to tau pathology in chronic sleep deprivation

doi: 10.24272/j.issn.2095-8137.2024.085

Figure Lengend Snippet: Knockdown of NLRP3 in the hippocampus restored autophagic flux, suppressed tau hyperphosphorylation, and ameliorated cognitive deficits

Article Snippet: AAV vectors containing a non-specific sequence (CGC TGA GTA CTT CGA AAT GTC) or short hairpin RNA targeting NLRP3 (CCA GGA TCC TCT TCC TCA TA) were designed and obtained from GeneChem (China).

Techniques: Knockdown

Journal: Zoological Research

Article Title: NLRP3-mediated autophagy dysfunction links gut microbiota dysbiosis to tau pathology in chronic sleep deprivation

doi: 10.24272/j.issn.2095-8137.2024.085

Figure Lengend Snippet: Deletion of NLRP3 reversed NLRP3 inflammasome activation, autophagy deficits, and tau hyperphosphorylation caused by Akt inhibitor-induced activation of GSK-3β in primary hippocampal neurons

Article Snippet: AAV vectors containing a non-specific sequence (CGC TGA GTA CTT CGA AAT GTC) or short hairpin RNA targeting NLRP3 (CCA GGA TCC TCT TCC TCA TA) were designed and obtained from GeneChem (China).

Techniques: Activation Assay