tae buffer (Valiant Co Ltd)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Valiant Co Ltd tae buffer
Tae Buffer, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 96/100, based on 48 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tae+buffer/TAE+buffer/pm41075785-1007-67-70
Average 96 stars, based on 48 article reviews

tae buffer - by Bioz Stars, 2026-11

96/100 stars

Images

Recombinant:

Article Title: Integrated omics reveals disease-associated radial glia-like cells with epigenetically dysregulated interferon response in multiple sclerosis.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-OCT3/4 Mab Santa Cruz Cat#sc-5279; RRID:AB_628051 Rabbit anti-SOX2 PAb Abcam Cat#ab97959; RRID:AB_2341193 Chicken anti-NESTIN PAb Novus Biolgicals Cat#NB100-1604; RRID: AB_2282642 Rabbit anti-PAX6 PAb Biolegend Cat#901301; RRID:AB_2565003 Chicken anti-VIM PAb Antibodies.com Cat#A85421; RRID:AB_778824 Rabbit anti-Ki67 Mab Abcam Cat#ab16667; RRID:AB_302459 Alexa Fluor 546-conjugated Goat Anti Rabbit IgG Thermo Fisher Cat#A11010; RRID:AB_2534077 Alexa Fluor 488-conjugated Goat Anti Chicken IgY Thermo Fisher Cat#A11039; RRID:AB_2534096 Alexa Fluor 546-conjugated Donkey Anti Mouse IgG Thermo Fisher Cat#A10036; RRID:AB_11180613 Alexa Fluor 488-conjugated Donkey Anti Rabbit IgG Thermo Fisher Cat#A21206; RRID:AB_2535792 Mouse anti-p16Ink4a Mab Invitrogen Cat#MA5-17093; RRID:AB_2538564 Rabbit anti-p21 Mab Thermo Fisher Cat#MA5-14949; RRID:AB_10984461 Rabbit anti-GDF15 PAb Proteintech Cat#27455-1-AP; RRID:AB_2880875 Mouse anti-b-actin Mab Sigma Cat# A1978; RRID:AB_476692 IRDye 680RD Goat anti-Rabbit LI-COR Biosciences Cat#926-68071; RRID:AB_10956166 IRDye 800CW Goat anti-Mouse LI-COR Biosciences Cat#926-32210; RRID:AB_621842 Biological samples Control fibroblasts (Table S1) Ionescu et al.18 Douvaras et al.111 N/A MS patient-derived fibroblasts (Table S1) Ionescu et al.18 Douvaras et al.111 N/A Chemicals, peptides, and recombinant proteins DMEM, high glucose, GlutaMAX Thermo Fisher Cat#61965026 Fetal bovine serum Thermo Fisher Cat#26140079 MEM Non-essential amino acids solution (100X) Thermo Fisher Cat#11140050 Sodium pyruvate (100 mM) Thermo Fisher Cat#11360070 Neurobasal Medium Thermo Fisher Cat#21103049 DMEM/F-12 Thermo Fisher Cat#11320033 GlutaMAX Supplement Thermo Fisher Cat#35050038 B-27 Supplement (50X) Thermo Fisher Cat#17504001 N-2 Supplement (100X) Thermo Fisher Cat#17502001 CHIR99021 Cell Guidance Systems Cat#SM13 Human LIF PeproTech Cat#300-05 SB-431542 Cayman Chemical Cat#13031 StemMACS Y27632 Miltenyi Biotec Cat#130-104-169 Growth Factor Reduced Basement Membrane Matrix Corning Cat#354230 Trypsin-EDTA (0.05%) ThermoFisher Cat#11580626 Accutase Thermo Fisher Cat#A1110501 Normal goat serum Thermo Fisher Cat#16-210-064 Normal donkey serum Thermo Fisher Cat# D9663 mTeSR Plus STEMCELL Technologies Cat#100-1130 hESC-Qualified Matrigel Corning Cat#354277 ReLeSR STEMCELL Technologies Cat#100-0483 DMEM/F-12, GlutaMAX supplement Thermo Fisher Cat#31331093 (Continued on next page) e1 Neuron 113, 4158–4177.e1–e10, December 17, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER B-27 supplement, minus vitamin A Thermo Fisher Cat#12587001 Human Noggin recombinant protein PeproTech Cat#120-10C Human FGF-basic (FGF-2) PeproTech Cat#100-18B Laminin Sigma-Aldrich Cat#L2020 Poly-L-ornithine Sigma-Aldrich Cat#P4957 Human EGF PeproTech Cat#A-100-15 Fluoromount-G Thermo Fisher Cat#00-4958-02 DAPI fluorescence reagent for DNA Thermo Fisher Cat#D8417 DreamTaq Hot Start DNA Polymerase Thermo Fisher Cat#EP1702 dNTP Mix (10 mM each) Thermo Fisher Cat#R0192 Agarose Scientific Laboratory Supplies Cat#BIO41025 TAE buffer, 50X MP Biomedicals Cat#11TAE50X01 TrackIt 100bp DNA Ladder Thermo Fisher Cat#10488058 Gel Loading Dye (6X) New England BioLabs Cat#B7024S GelRed Nucleic Acid Gel Stain Biotium Cat#41003 Navitoclax (ABT-263) Selleck Chemicals Cat#S1001 Fast SYBR Green Master Mix Thermo Fisher Cat#4385612 RIPA Lysis and Extraction Buffer Abcam Cat#ab156034 Halt Protease & Phosphatase Inhibitor Cocktail Thermo Fisher Cat#1861281 Prestained Protein Marker Proteintech Cat#PL00001 Intercept-TBS Blocking Buffer LI-COR Biosciences Cat#927-60001 NuPAGE LDS Sample Buffer (4X) Invitrogen Cat#NP0007 20X BoltTM MOPS SDS Running Buffer Invitrogen Cat#B0001 BoltTM Bis-Tris Plus Mini Protein Gels, 4-12%, 1.0 mm, WedgeWellTM format Invitrogen Cat# NW04122BOX PVDF Transfer Membranes, 0.45 μm Thermo Scientific Cat#88518 Bovine Serum Albumin Thermo Fisher Cat#1002096887 Triton X-100 Thermo Fisher Cat#1002575509 bisBenzimide H 33342 trihydrochloride (Hoechst) Sigma-Aldrich Cat#14533 eBioscience Propidium Iodide Thermo Fisher Cat#BMS500PI Critical commercial assays DNeasy Blood & Tissue Kit Qiagen Cat#69506 RNeasy Mini Kit Qiagen Cat#74106 Pierce BCA Protein Assay Kit Thermo Fisher Cat#23227 Click-iT EdU Cell Proliferation Kit Thermo Fisher Cat#C10337 CytoTune-iPS 2.0 Sendai Reprogramming Kit Thermo Fisher Cat#A16517 Quant-iT PicoGreen dsDNA Assay Kits and dsDNA Reagents Thermo Fisher Cat#P7589 EZ DNA Methylation Gold Kit Zymo Cat#D5005 xGen Methyl-Seq Lib Prep 96rxn Integrated DNA Technologies Cat#1009824 Senescence Cell Detection (for microplate) Dojindo Cat#SG05-05 Cellular Senescence Detection Kit – SPiDER-β-gal Dojindo Cat#SG02-10 Human Cytokine Array C5 RayBiotech Cat#AAH-CYT-5 Deposited data scRNAseq datasets NCBI, GEO GSE297365 snATACseq datasets NCBI, GEO GSE297690 WGBS datasets NCBI, GEO GSE251839 Bulk RNA-seq datasets NCBI, GEO GSE297192 (Continued on next page) Neuron 113, 4158–4177.e1–e10, December 17, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Telo A, CGGTTTGTTTGGGTTTGGGTTT GGGTTTGGGTTTGGGTT Custom primer from Sigma N/A Telo B, GGCTTGCCTTACCCTTACC CTTACCCTTACCCTTACCCT Custom primer from Sigma N/A Hbg1, GCTTCTGACACAACTGTGTTCACTAGC Custom primer from Sigma N/A Hbg2, CACCAACTTCATCCACGTTCACC Custom primer from Sigma N/A Software and algorithms Adobe Illustrator Adobe RRID:SCR_010279 Fiji GNU Generic Public License RRID:SCR_002285 Prism GraphPad RRID:SCR_002798 FlowJo BD RRID:SCR_008520 CellProfiler BSD RRID:SCR_007358 Python Python Programming Language https://www.python.org R The R Project for Statistical Computing https://www.r-project.org fastQC Babraham Bioinformatics https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ MultiQC Ewels et al.112 https://multiqc.info/ noisyR Moutsopoulos et al.113 https://core-bioinformatics. github.io/noisyR/ ClustAssess Shahsavari et al.114 https://core-bioinformatics. github.io/ClustAssess/ STAR Dobin et al.115 https://github.com/alexdobin/STAR featureCounts Liao et al.116 https://subread.sourceforge.net/ edgeR Robinson et al.117 http://bioconductor.org/packages/ release/bioc/html/edgeR.html DESeq2 Love et al.118 https://github.com/mikelove/DESeq2 bulkAnalyseR Moutsopoulos et al.50 https://github.com/Core- Bioinformatics/bulkAnalyseR GENIE3 Huynh-Thu et al.119 https://github.com/aertslab/GENIE3 visNetwork Almende et al.120 https://github.com/visjs/vis-network CellRanger 10X genomics https://www.10xgenomics.com CellRanger ARC 10X genomics https://www.10xgenomics.com Seurat Satija Lab https://satijalab.org/seurat Signac Satija Lab https://satijalab.org/signac Harmony Korsunsky et al.121 https://github.com/immunogenomics/ harmony Bismark Krueger and Andrews122 https://www.bioinformatics. babraham.ac.uk/projects/bismark/ methylKit Akalin et al.123 https://github.com/al2na/methylKit Metilene Jühling et al.124 http://legacy.bioinf.uni-leipzig.de/ Software/metilene/ gProfiler Kolberg et al.125 https://github.com/Granulate/gprofiler AUCell Aibar er al.126 https://www.bioconductor.org/ packages/release/bioc/html/ AUCell.html BayesSpace Zhao et al.127 https://www.bioconductor.org/ packages/release/bioc/html/ BayesSpace.html (Continued on next page) e3 Neuron 113, 4158–4177.e1–e10, December 17, 2025

Fluorescence:

Staining:

SYBR Green Assay:

Lysis:

Extraction:

Marker:

Blocking Assay:

Bicinchoninic Acid Protein Assay:

Picogreen Assay:

DNA Methylation Assay:

RNA Sequencing:

Agarose Gel Electrophoresis:

Article Title: Integrated omics reveals disease-associated radial glia-like cells with epigenetically dysregulated interferon response in multiple sclerosis.
Article Snippet: .. Samples were diluted with Gel Loading Dye (New England BioLabs), and 5 μL was loaded into a 2% agarose gel (Thermo Fisher) in 1X TAE buffer (MP Biomedicals). .. TrackIt 100 bp DNA Ladder (Thermo Fisher) was used to assess band size.

Article Title: Integrated omics reveals disease-associated radial glia-like cells with epigenetically dysregulated interferon response in multiple sclerosis
Article Snippet: .. Samples were diluted with Gel Loading Dye (New England BioLabs), and 5 μL was loaded into a 2% agarose gel (Thermo Fisher) in 1X TAE buffer (MP Biomedicals). .. Samples were diluted with Gel Loading Dye (New England BioLabs), and 5 μL was loaded into a 2% agarose gel (Thermo Fisher) in 1X TAE buffer (MP Biomedicals).

Article Title: Autophagy Cholesterol Axis Remodeling Supports Malignant Progression and Chemoresistance in Glioma
Article Snippet: .. Primer specificity was verified by in silico PCR using the ENCODE UCSC Genome Browser and experimentally confirmed by electrophoresis of PCR products on a 1% agarose gel prepared in 1× Tris-Acetate-EDTA (TAE) buffer (MP Biomedicals, #TAW50X01) at 100 V for 45 min. .. Live-cell mitochondrial imaging was performed using MitoViewTM Green (Biotium, #70054) to assess mitochondrial morphology and network organization, and Hoechst 33342 (Biotium, #33342) to visualize cell nuclei.

Review