Review



lysis buffer  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Promega lysis buffer
    Lysis Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ns2+buffer/lysis+buffer/pm24136724-76-14-16
    Average 90 stars, based on 1 article reviews
    lysis buffer - by Bioz Stars, 2026-11
    90/100 stars

    Images

    Related Articles

    Lysis:

    Article Title: Skin Aerosolization Predominance in a Pig Farm
    Article Snippet: The different volumes of supplemented PBS containing the air samples from BIAFTS were first concentrated using Amicon® Ultra-15 50 K (Merck, Darmstadt, Alemania) up to approximately 2 mL. .. A total of 350 μL was mixed with one volume of Lysis buffer (Promega, Madison, WI, USA) for DNA extraction. ..

    Article Title: Activation of bioluminescence by structural complementation
    Article Snippet: .. For TMR gel analysis, 79 μl of each induced culture was mixed with 10 μl 10× Fast Break Lysis Buffer (Promega Corporation), 10 μl of a 1:100 dilution of HALOTAG TMR ligand (Promega Corporation) non-luminescent polypeptide and 10 μl of RQ1 DNase and incubated at room temperature for 10 minutes. ..

    Article Title: Controlling mitochondrial membrane architecture via MIC60 determines viral replication to promote anti-viral immunity.
    Article Snippet: .. 52 Genotyping of embryos from Mic60 gt mice was conducted as previously described, 53 after removing the extra-embryonic tissue, the embryonic portion was treated in Lysis buffer (Promega) for at least 7 h at 55 ◦ C. PCR was carried out afterward using the following cycles and oligonucleotides: 1 × 4 min 94 ◦ C; 35 × 94 ◦ C 40sec, 56 ◦ C 30sec, 72 ◦ C 30sec; 1 × 72 ◦ C 10 min. Wild-type amplification was performed using the oligonucleotide sequences H001C10f-5 ′ -TTTGTGCATGTGTGTGGATGAGC-3 ′ and H001C10R - 5 ′ -GAACC CAGTTCGGGTGGTGTAGG-3 ′ , mutant fragments were obtained with the same reverse primer but with the primer splirev1 5 ′ - GCTAGCTTGCCAAACCTACAGGTGG -3 ′ within the gene trap vector. ..

    Article Title: ZFHX3 is integral to androgen/AR signaling involving protein association with AR in prostate cancer cells.
    Article Snippet: .. Forty-eight hours after plasmid transfection, including 24-hour R1881 or enzalutamide treatment, cells were lysed in 5 × lysis buffer (Promega) for 30 min, and luciferase activities were determined using the Dual-Luciferase Reporter Gene Assay Kit (Promega). ..

    Article Title:
    Article Snippet: .. After the indicated treatments, cells were washed 3 with PBS once, and lysed with lysis buffer (Promega). .. Suspensions were loaded into a 4 white opaque 96-well plate, and Luciferase Assay Reagent (Promega) was added 5 immediately before detection.

    Article Title: Donor-Targeted Anti-HLA-A2 Antibody Shows Nanogram-Level Efficacy in a Novel GVHD Mouse Model
    Article Snippet: .. Maximal lysis is defined as effector cells + target cells with lysis buffer (Promega, #G182A). ..

    Article Title: Lymphoid and CXCR4 Cell Targeted Lipid Nanoparticles Facilitate HIV-1 Proviral DNA Excision.
    Article Snippet: .. After the incubation period, the cells were centrifuged at 650 × g for 5 min, washed with PBS, and lysed by incubation with 100 μL of 1x lysis buffer (Promega) on a shaking platform for 15 min. .. Following lysis, 100 μL of the Promega Luciferase assay reagent was added to the cell lysate, and the luminescence was measured according to themanufacturer’s protocol.

    Article Title:
    Article Snippet: 100 mL of 1 passive lysis buffer (Promega) was added, and the culture vessel was gently shaken for 15 min at room temperature. .. Then 10–20 mL of lysis buffer was used to measure the firefly luciferase activity after adding 100 mL of luciferase assay reagent II (Promega), and the Renilla luciferase activity was measured after dispensing 100 mL of Stop & Glo reagent (Promega) with a Tecan Infinite 200 Pro instrument. ..

    DNA Extraction:

    Article Title: Skin Aerosolization Predominance in a Pig Farm
    Article Snippet: The different volumes of supplemented PBS containing the air samples from BIAFTS were first concentrated using Amicon® Ultra-15 50 K (Merck, Darmstadt, Alemania) up to approximately 2 mL. .. A total of 350 μL was mixed with one volume of Lysis buffer (Promega, Madison, WI, USA) for DNA extraction. ..

    Incubation:

    Article Title: Activation of bioluminescence by structural complementation
    Article Snippet: .. For TMR gel analysis, 79 μl of each induced culture was mixed with 10 μl 10× Fast Break Lysis Buffer (Promega Corporation), 10 μl of a 1:100 dilution of HALOTAG TMR ligand (Promega Corporation) non-luminescent polypeptide and 10 μl of RQ1 DNase and incubated at room temperature for 10 minutes. ..

    Article Title: Lymphoid and CXCR4 Cell Targeted Lipid Nanoparticles Facilitate HIV-1 Proviral DNA Excision.
    Article Snippet: .. After the incubation period, the cells were centrifuged at 650 × g for 5 min, washed with PBS, and lysed by incubation with 100 μL of 1x lysis buffer (Promega) on a shaking platform for 15 min. .. Following lysis, 100 μL of the Promega Luciferase assay reagent was added to the cell lysate, and the luminescence was measured according to themanufacturer’s protocol.

    Polymerase Chain Reaction:

    Article Title: Controlling mitochondrial membrane architecture via MIC60 determines viral replication to promote anti-viral immunity.
    Article Snippet: .. 52 Genotyping of embryos from Mic60 gt mice was conducted as previously described, 53 after removing the extra-embryonic tissue, the embryonic portion was treated in Lysis buffer (Promega) for at least 7 h at 55 ◦ C. PCR was carried out afterward using the following cycles and oligonucleotides: 1 × 4 min 94 ◦ C; 35 × 94 ◦ C 40sec, 56 ◦ C 30sec, 72 ◦ C 30sec; 1 × 72 ◦ C 10 min. Wild-type amplification was performed using the oligonucleotide sequences H001C10f-5 ′ -TTTGTGCATGTGTGTGGATGAGC-3 ′ and H001C10R - 5 ′ -GAACC CAGTTCGGGTGGTGTAGG-3 ′ , mutant fragments were obtained with the same reverse primer but with the primer splirev1 5 ′ - GCTAGCTTGCCAAACCTACAGGTGG -3 ′ within the gene trap vector. ..

    Amplification:

    Article Title: Controlling mitochondrial membrane architecture via MIC60 determines viral replication to promote anti-viral immunity.
    Article Snippet: .. 52 Genotyping of embryos from Mic60 gt mice was conducted as previously described, 53 after removing the extra-embryonic tissue, the embryonic portion was treated in Lysis buffer (Promega) for at least 7 h at 55 ◦ C. PCR was carried out afterward using the following cycles and oligonucleotides: 1 × 4 min 94 ◦ C; 35 × 94 ◦ C 40sec, 56 ◦ C 30sec, 72 ◦ C 30sec; 1 × 72 ◦ C 10 min. Wild-type amplification was performed using the oligonucleotide sequences H001C10f-5 ′ -TTTGTGCATGTGTGTGGATGAGC-3 ′ and H001C10R - 5 ′ -GAACC CAGTTCGGGTGGTGTAGG-3 ′ , mutant fragments were obtained with the same reverse primer but with the primer splirev1 5 ′ - GCTAGCTTGCCAAACCTACAGGTGG -3 ′ within the gene trap vector. ..

    Mutagenesis:

    Article Title: Controlling mitochondrial membrane architecture via MIC60 determines viral replication to promote anti-viral immunity.
    Article Snippet: .. 52 Genotyping of embryos from Mic60 gt mice was conducted as previously described, 53 after removing the extra-embryonic tissue, the embryonic portion was treated in Lysis buffer (Promega) for at least 7 h at 55 ◦ C. PCR was carried out afterward using the following cycles and oligonucleotides: 1 × 4 min 94 ◦ C; 35 × 94 ◦ C 40sec, 56 ◦ C 30sec, 72 ◦ C 30sec; 1 × 72 ◦ C 10 min. Wild-type amplification was performed using the oligonucleotide sequences H001C10f-5 ′ -TTTGTGCATGTGTGTGGATGAGC-3 ′ and H001C10R - 5 ′ -GAACC CAGTTCGGGTGGTGTAGG-3 ′ , mutant fragments were obtained with the same reverse primer but with the primer splirev1 5 ′ - GCTAGCTTGCCAAACCTACAGGTGG -3 ′ within the gene trap vector. ..

    Plasmid Preparation:

    Article Title: Controlling mitochondrial membrane architecture via MIC60 determines viral replication to promote anti-viral immunity.
    Article Snippet: .. 52 Genotyping of embryos from Mic60 gt mice was conducted as previously described, 53 after removing the extra-embryonic tissue, the embryonic portion was treated in Lysis buffer (Promega) for at least 7 h at 55 ◦ C. PCR was carried out afterward using the following cycles and oligonucleotides: 1 × 4 min 94 ◦ C; 35 × 94 ◦ C 40sec, 56 ◦ C 30sec, 72 ◦ C 30sec; 1 × 72 ◦ C 10 min. Wild-type amplification was performed using the oligonucleotide sequences H001C10f-5 ′ -TTTGTGCATGTGTGTGGATGAGC-3 ′ and H001C10R - 5 ′ -GAACC CAGTTCGGGTGGTGTAGG-3 ′ , mutant fragments were obtained with the same reverse primer but with the primer splirev1 5 ′ - GCTAGCTTGCCAAACCTACAGGTGG -3 ′ within the gene trap vector. ..

    Article Title: ZFHX3 is integral to androgen/AR signaling involving protein association with AR in prostate cancer cells.
    Article Snippet: .. Forty-eight hours after plasmid transfection, including 24-hour R1881 or enzalutamide treatment, cells were lysed in 5 × lysis buffer (Promega) for 30 min, and luciferase activities were determined using the Dual-Luciferase Reporter Gene Assay Kit (Promega). ..

    Transfection:

    Article Title: ZFHX3 is integral to androgen/AR signaling involving protein association with AR in prostate cancer cells.
    Article Snippet: .. Forty-eight hours after plasmid transfection, including 24-hour R1881 or enzalutamide treatment, cells were lysed in 5 × lysis buffer (Promega) for 30 min, and luciferase activities were determined using the Dual-Luciferase Reporter Gene Assay Kit (Promega). ..

    Luciferase:

    Article Title: ZFHX3 is integral to androgen/AR signaling involving protein association with AR in prostate cancer cells.
    Article Snippet: .. Forty-eight hours after plasmid transfection, including 24-hour R1881 or enzalutamide treatment, cells were lysed in 5 × lysis buffer (Promega) for 30 min, and luciferase activities were determined using the Dual-Luciferase Reporter Gene Assay Kit (Promega). ..

    Article Title:
    Article Snippet: 100 mL of 1 passive lysis buffer (Promega) was added, and the culture vessel was gently shaken for 15 min at room temperature. .. Then 10–20 mL of lysis buffer was used to measure the firefly luciferase activity after adding 100 mL of luciferase assay reagent II (Promega), and the Renilla luciferase activity was measured after dispensing 100 mL of Stop & Glo reagent (Promega) with a Tecan Infinite 200 Pro instrument. ..

    Reporter Gene Assay:

    Article Title: ZFHX3 is integral to androgen/AR signaling involving protein association with AR in prostate cancer cells.
    Article Snippet: .. Forty-eight hours after plasmid transfection, including 24-hour R1881 or enzalutamide treatment, cells were lysed in 5 × lysis buffer (Promega) for 30 min, and luciferase activities were determined using the Dual-Luciferase Reporter Gene Assay Kit (Promega). ..

    Activity Assay:

    Article Title:
    Article Snippet: 100 mL of 1 passive lysis buffer (Promega) was added, and the culture vessel was gently shaken for 15 min at room temperature. .. Then 10–20 mL of lysis buffer was used to measure the firefly luciferase activity after adding 100 mL of luciferase assay reagent II (Promega), and the Renilla luciferase activity was measured after dispensing 100 mL of Stop & Glo reagent (Promega) with a Tecan Infinite 200 Pro instrument. ..



    Similar Products

    ns2 buffer  (Eppendorf AG)
    99
    Eppendorf AG ns2 buffer
    Ns2 Buffer, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ns2+buffer/Eppendorf+Tubes/pm40079415-119-7-15
    Average 99 stars, based on 1 article reviews
    ns2 buffer - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    ns2 buffer  (Thermo Fisher)
    99
    Thermo Fisher ns2 buffer
    Ns2 Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ns2+buffer/HEPES/pm24998444-53-48-79
    Average 99 stars, based on 1 article reviews
    ns2 buffer - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier

    Image Search Results