Review



guinea pig complement  (Rockland Immunochemicals)


Bioz Verified Symbol Rockland Immunochemicals is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Rockland Immunochemicals guinea pig complement
    Guinea Pig Complement, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 93/100, based on 100 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/complement+c3/Guinea+Pig+Complement/pm21597239-51-25-28
    Average 93 stars, based on 100 article reviews
    guinea pig complement - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Gel Permeation Chromatography:

    Article Title: Potent neutralization by antibodies targeting the MPXV A28 protein
    Article Snippet: Following five additional washes, TMB/E (Abcam) was added, and optical density (O.D.) .. MAbs were mixed at a 1:1 ratio with cell medium containing MPXV in the presence or absence of 40% Guinea pig complement (GPC- Rockland) or 4% NHS. ..

    Article Title: Potent neutralization by antibodies targeting the MPXV A28 protein.
    Article Snippet: .. MAbs were mixed at a 1:1 ratio with cell medium containing MPXV in the presence or absence of 40% Guinea pig complement (GPC- Rockland) or 4% NHS. ..

    Incubation:

    Article Title: Ring finger protein 213 regulates B-cell receptor signaling, metabolism, and development in B lymphocytes.
    Article Snippet: Splenocytes were isolated via Ficoll-Paque PLUS (Cytiva, 17144003) density gradient centrifugation. .. Afterward, the T cells were depleted by incubation with Guinea Pig Complement (Rockland Immunochemicals, C300- Fig. 5 RNF213 regulated AKT-mTOR signaling via PIK3C3. a Strategy for performing overlap analysis with the RNA-Seq and ATAC-Seq datasets. ..

    Article Title: Ring finger protein 213 regulates B-cell receptor signaling, metabolism, and development in B lymphocytes
    Article Snippet: Splenocytes were isolated via Ficoll-Paque PLUS (Cytiva, 17144003) density gradient centrifugation. .. Afterward, the T cells were depleted by incubation with Guinea Pig Complement (Rockland Immunochemicals, C300-0500) and anti-Thy-1.2 (BioLegend, 105301) for 30 min at 37 °C. ..

    RNA sequencing:

    Article Title: Ring finger protein 213 regulates B-cell receptor signaling, metabolism, and development in B lymphocytes.
    Article Snippet: Splenocytes were isolated via Ficoll-Paque PLUS (Cytiva, 17144003) density gradient centrifugation. .. Afterward, the T cells were depleted by incubation with Guinea Pig Complement (Rockland Immunochemicals, C300- Fig. 5 RNF213 regulated AKT-mTOR signaling via PIK3C3. a Strategy for performing overlap analysis with the RNA-Seq and ATAC-Seq datasets. ..

    Vaccines:

    Article Title: Synthetic progestin treatment alters cytokine expression and impairs vaccine response in horses.
    Article Snippet: Altrenogest is commonly used in equine veterinary medicine for the control of estrus, behavioral modifications, and maintenance of pregnancy.. Recent studies have found that altrenogest may impact aspects of the immune system, including altering cytokine production in circulation and within the reproductive tract.. Therefore, we hypothesize that this alteration may lead to a deviated immune response to vaccination.

    Virus:

    Article Title: Synthetic progestin treatment alters cytokine expression and impairs vaccine response in horses.
    Article Snippet: Altrenogest is commonly used in equine veterinary medicine for the control of estrus, behavioral modifications, and maintenance of pregnancy.. Recent studies have found that altrenogest may impact aspects of the immune system, including altering cytokine production in circulation and within the reproductive tract.. Therefore, we hypothesize that this alteration may lead to a deviated immune response to vaccination.

    Suspension:

    Article Title: Synthetic progestin treatment alters cytokine expression and impairs vaccine response in horses.
    Article Snippet: Altrenogest is commonly used in equine veterinary medicine for the control of estrus, behavioral modifications, and maintenance of pregnancy.. Recent studies have found that altrenogest may impact aspects of the immune system, including altering cytokine production in circulation and within the reproductive tract.. Therefore, we hypothesize that this alteration may lead to a deviated immune response to vaccination.

    other:

    Article Title: HMGB1 couples LEF1 to regulate B cell immunity
    Article Snippet: Splenic lymphocytes were isolated by Ficoll-Paque Premium (17-5446-02; GE Healthcare, now Cytiva).

    Article Title: HMGB1 couples LEF1 to regulate B cell immunity.
    Article Snippet: Hmgb1-cKO mice on the C57BL/6 background were obtained by crossing Cd19-Cre mice from Jackson Laboratory with Hmgb1fl/fl mice from Cyagen Biosciences.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Structural basis for broad orthopoxvirus neutralization by two antibodies targeting distinct L1R epitopes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human/NHP CD3/PerCP BD PharmingenTM Cat#552581 Anti-human CD19/APC Beckman Coulter Cat#IM2470; RRID:AB_130789 Anti-human IgG/PE BD PharmingenTM Cat#555787 Anti-human CD27/PE-Cy7 Beckman Coulter Cat#A54823 Streptavidin/AF488 Biolegend Cat#405235 Streptavidin/BV421 Biolegend Cat#405226 L1R 7D11, mAb Su et al.27 N/A RSV-F antibody McLellan et al.37 N/A Goat anti-monkey IgG (HRP) antibody Abcam Cat#Ab112767 Goat anti-human IgG (HRP) antibody Abcam Cat#Ab97225 A33R A27D7, mAb Matho et al.42 N/A D8 MV33, mAb Noy-Porat et al.43,44 N/A Rabbit anti-vaccinia virus antibody Abcam Cat#Ab35219 Goat anti-rabbit IgG (HRP) antibody Abcam Cat#Ab6721; RRID:AB_955447 Bacterial and virus strains VACV WR (Western Reserve) ATCC Cat#VR-119 ECTV Moscow ATCC Cat#VR-1347 MPXV (hMpxV/China/GZ8H-01/2023) Eighth Affiliated Hospital of Guangzhou Medical University N/A VACV-Fluc WR strain VectorBuilder Cat#P240423-1002ske VACV-Fluc WR strain (MV) VectorBuilder Cat#P240422-1031ahf VACV-Fluc WR strain (EV) VectorBuilder Cat#P240422-1030akq Biological samples Serum samples This paper N/A PBMC samples This paper N/A Chemicals, peptides, and recombinant proteins VACV L1R protein (NC_006998) This paper N/A VARV L1R protein (NC_001611) This paper N/A CPXV L1R protein (NC_003663) This paper N/A ECTV L1R protein (NC_004105) This paper N/A MPXV M1R protein (ON563414.3) This paper N/A MPXV M1R_Q24A protein This paper N/A MPXV M1R_E25A protein This paper N/A MPXV M1R_A26S protein This paper N/A MPXV M1R_N27A protein This paper N/A MPXV M1R_S29A protein This paper N/A MPXV M1R_Q31A protein This paper N/A MPXV M1R_T32A protein This paper N/A MPXV M1R_K33A protein This paper N/A MPXV M1R_D35N protein This paper N/A MPXV M1R_S58A protein This paper N/A MPXV M1R_A59S protein This paper N/A MPXV M1R_D60A protein This paper N/A MPXV M1R_A61S protein This paper N/A (Continued on next page) Cell Reports Medicine 7, 103077, October 20, 2026 e1 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER MPXV M1R_D62A protein This paper N/A MPXV M1R_A63S protein This paper N/A MPXV M1R_D66A protein This paper N/A ELISA Coating Buffer Solarbio Cat#C1055 Bovine Serum Albumin Solarbio Cat#A8010 TMB Single-Component Substrate solution Solarbio Cat#PR1200 ELISA Stop Buffer Solarbio Cat#C1058 Passive Lysis 5× Buffer Promega Cat#E194A Carboxymethyl cellulose Merck Cat#419338 0.1% crystal violet Solarbio Cat#G1063 Guinea pig complement Rockland CatC200-0005 Octet Kinetics buffer Sartorius Cat#18–1105 Critical commercial assays BCA Protein Assay Kit ThermoFisher Scientific Cat#23227 Expi293TM Expression System Kit ThermoFisher Scientific Cat#A14635 Luciferase Assay System Promega Cat#E1501 RNeasy Mini Kit Qiagen Cat#74104 One-step QuantiNova Probe RT-qPCR Kit Qiagen Cat#208354 Genomic DNA extraction kit TIANGEN Cat#DP304 TB Green Premix Ex TaqTM II Takara Cat#RR820A CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7571 Deposited data B9/M1R complex structure This paper PDB: 9XJK G4/M1R complex structure This paper PDB: 22LL Experimental models: Cell lines BS-C-1 cells ATCC Cat#CCL-26 Expi293FTM cells ThermoFisher Scientific Cat#A14527 Experimental models: Organisms/strains Mouse: BALB/c Charles River Laboratories Cat#01011 Macaca fascicularis Beijing Institute of Biotechnology’s animal center N/A Oligonucleotides Primer: P4b-F: AGAAGATATCAGACGATCCACAATC Cheng et al.45 N/A Primer: P4b-R: GTAGAACGACGCCAGAATAAGAATA Cheng et al.45 N/A Probe: P4b-probe: FAM-TTGGTCTCCGAGTTTATAACAGAC TGCGGAC- BHQ Cheng et al.45 N/A Primer: MPXV-F: ATGTTGGATATGA GGTTATTGGTGT This paper N/A Primer: MPXV-R: TATCACATTTTTGT TGACATGATGGA This paper N/A Probe: MPXV-probe: FAM-TTGGTATA TAAGTTGTACGGCT-MGB This paper N/A Recombinant DNA Plasmid pcDNA3.1 -hIgG1 General Biosystems N/A Plasmid pTIG General Biosystems N/A Plasmid pcDNA3.4 -hIgG1 General Biosystems N/A (Continued on next page) e2 Cell Reports Medicine 7, 103077, October 20, 2026 Article ll OPEN ACCESS .. Six-to eight-week-old female BALB/c mice were obtained from Charles River Laboratories.

    Lysis:

    Article Title: Structural basis for broad orthopoxvirus neutralization by two antibodies targeting distinct L1R epitopes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human/NHP CD3/PerCP BD PharmingenTM Cat#552581 Anti-human CD19/APC Beckman Coulter Cat#IM2470; RRID:AB_130789 Anti-human IgG/PE BD PharmingenTM Cat#555787 Anti-human CD27/PE-Cy7 Beckman Coulter Cat#A54823 Streptavidin/AF488 Biolegend Cat#405235 Streptavidin/BV421 Biolegend Cat#405226 L1R 7D11, mAb Su et al.27 N/A RSV-F antibody McLellan et al.37 N/A Goat anti-monkey IgG (HRP) antibody Abcam Cat#Ab112767 Goat anti-human IgG (HRP) antibody Abcam Cat#Ab97225 A33R A27D7, mAb Matho et al.42 N/A D8 MV33, mAb Noy-Porat et al.43,44 N/A Rabbit anti-vaccinia virus antibody Abcam Cat#Ab35219 Goat anti-rabbit IgG (HRP) antibody Abcam Cat#Ab6721; RRID:AB_955447 Bacterial and virus strains VACV WR (Western Reserve) ATCC Cat#VR-119 ECTV Moscow ATCC Cat#VR-1347 MPXV (hMpxV/China/GZ8H-01/2023) Eighth Affiliated Hospital of Guangzhou Medical University N/A VACV-Fluc WR strain VectorBuilder Cat#P240423-1002ske VACV-Fluc WR strain (MV) VectorBuilder Cat#P240422-1031ahf VACV-Fluc WR strain (EV) VectorBuilder Cat#P240422-1030akq Biological samples Serum samples This paper N/A PBMC samples This paper N/A Chemicals, peptides, and recombinant proteins VACV L1R protein (NC_006998) This paper N/A VARV L1R protein (NC_001611) This paper N/A CPXV L1R protein (NC_003663) This paper N/A ECTV L1R protein (NC_004105) This paper N/A MPXV M1R protein (ON563414.3) This paper N/A MPXV M1R_Q24A protein This paper N/A MPXV M1R_E25A protein This paper N/A MPXV M1R_A26S protein This paper N/A MPXV M1R_N27A protein This paper N/A MPXV M1R_S29A protein This paper N/A MPXV M1R_Q31A protein This paper N/A MPXV M1R_T32A protein This paper N/A MPXV M1R_K33A protein This paper N/A MPXV M1R_D35N protein This paper N/A MPXV M1R_S58A protein This paper N/A MPXV M1R_A59S protein This paper N/A MPXV M1R_D60A protein This paper N/A MPXV M1R_A61S protein This paper N/A (Continued on next page) Cell Reports Medicine 7, 103077, October 20, 2026 e1 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER MPXV M1R_D62A protein This paper N/A MPXV M1R_A63S protein This paper N/A MPXV M1R_D66A protein This paper N/A ELISA Coating Buffer Solarbio Cat#C1055 Bovine Serum Albumin Solarbio Cat#A8010 TMB Single-Component Substrate solution Solarbio Cat#PR1200 ELISA Stop Buffer Solarbio Cat#C1058 Passive Lysis 5× Buffer Promega Cat#E194A Carboxymethyl cellulose Merck Cat#419338 0.1% crystal violet Solarbio Cat#G1063 Guinea pig complement Rockland CatC200-0005 Octet Kinetics buffer Sartorius Cat#18–1105 Critical commercial assays BCA Protein Assay Kit ThermoFisher Scientific Cat#23227 Expi293TM Expression System Kit ThermoFisher Scientific Cat#A14635 Luciferase Assay System Promega Cat#E1501 RNeasy Mini Kit Qiagen Cat#74104 One-step QuantiNova Probe RT-qPCR Kit Qiagen Cat#208354 Genomic DNA extraction kit TIANGEN Cat#DP304 TB Green Premix Ex TaqTM II Takara Cat#RR820A CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7571 Deposited data B9/M1R complex structure This paper PDB: 9XJK G4/M1R complex structure This paper PDB: 22LL Experimental models: Cell lines BS-C-1 cells ATCC Cat#CCL-26 Expi293FTM cells ThermoFisher Scientific Cat#A14527 Experimental models: Organisms/strains Mouse: BALB/c Charles River Laboratories Cat#01011 Macaca fascicularis Beijing Institute of Biotechnology’s animal center N/A Oligonucleotides Primer: P4b-F: AGAAGATATCAGACGATCCACAATC Cheng et al.45 N/A Primer: P4b-R: GTAGAACGACGCCAGAATAAGAATA Cheng et al.45 N/A Probe: P4b-probe: FAM-TTGGTCTCCGAGTTTATAACAGAC TGCGGAC- BHQ Cheng et al.45 N/A Primer: MPXV-F: ATGTTGGATATGA GGTTATTGGTGT This paper N/A Primer: MPXV-R: TATCACATTTTTGT TGACATGATGGA This paper N/A Probe: MPXV-probe: FAM-TTGGTATA TAAGTTGTACGGCT-MGB This paper N/A Recombinant DNA Plasmid pcDNA3.1 -hIgG1 General Biosystems N/A Plasmid pTIG General Biosystems N/A Plasmid pcDNA3.4 -hIgG1 General Biosystems N/A (Continued on next page) e2 Cell Reports Medicine 7, 103077, October 20, 2026 Article ll OPEN ACCESS .. Six-to eight-week-old female BALB/c mice were obtained from Charles River Laboratories.

    K-Buffer:

    Article Title: Structural basis for broad orthopoxvirus neutralization by two antibodies targeting distinct L1R epitopes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human/NHP CD3/PerCP BD PharmingenTM Cat#552581 Anti-human CD19/APC Beckman Coulter Cat#IM2470; RRID:AB_130789 Anti-human IgG/PE BD PharmingenTM Cat#555787 Anti-human CD27/PE-Cy7 Beckman Coulter Cat#A54823 Streptavidin/AF488 Biolegend Cat#405235 Streptavidin/BV421 Biolegend Cat#405226 L1R 7D11, mAb Su et al.27 N/A RSV-F antibody McLellan et al.37 N/A Goat anti-monkey IgG (HRP) antibody Abcam Cat#Ab112767 Goat anti-human IgG (HRP) antibody Abcam Cat#Ab97225 A33R A27D7, mAb Matho et al.42 N/A D8 MV33, mAb Noy-Porat et al.43,44 N/A Rabbit anti-vaccinia virus antibody Abcam Cat#Ab35219 Goat anti-rabbit IgG (HRP) antibody Abcam Cat#Ab6721; RRID:AB_955447 Bacterial and virus strains VACV WR (Western Reserve) ATCC Cat#VR-119 ECTV Moscow ATCC Cat#VR-1347 MPXV (hMpxV/China/GZ8H-01/2023) Eighth Affiliated Hospital of Guangzhou Medical University N/A VACV-Fluc WR strain VectorBuilder Cat#P240423-1002ske VACV-Fluc WR strain (MV) VectorBuilder Cat#P240422-1031ahf VACV-Fluc WR strain (EV) VectorBuilder Cat#P240422-1030akq Biological samples Serum samples This paper N/A PBMC samples This paper N/A Chemicals, peptides, and recombinant proteins VACV L1R protein (NC_006998) This paper N/A VARV L1R protein (NC_001611) This paper N/A CPXV L1R protein (NC_003663) This paper N/A ECTV L1R protein (NC_004105) This paper N/A MPXV M1R protein (ON563414.3) This paper N/A MPXV M1R_Q24A protein This paper N/A MPXV M1R_E25A protein This paper N/A MPXV M1R_A26S protein This paper N/A MPXV M1R_N27A protein This paper N/A MPXV M1R_S29A protein This paper N/A MPXV M1R_Q31A protein This paper N/A MPXV M1R_T32A protein This paper N/A MPXV M1R_K33A protein This paper N/A MPXV M1R_D35N protein This paper N/A MPXV M1R_S58A protein This paper N/A MPXV M1R_A59S protein This paper N/A MPXV M1R_D60A protein This paper N/A MPXV M1R_A61S protein This paper N/A (Continued on next page) Cell Reports Medicine 7, 103077, October 20, 2026 e1 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER MPXV M1R_D62A protein This paper N/A MPXV M1R_A63S protein This paper N/A MPXV M1R_D66A protein This paper N/A ELISA Coating Buffer Solarbio Cat#C1055 Bovine Serum Albumin Solarbio Cat#A8010 TMB Single-Component Substrate solution Solarbio Cat#PR1200 ELISA Stop Buffer Solarbio Cat#C1058 Passive Lysis 5× Buffer Promega Cat#E194A Carboxymethyl cellulose Merck Cat#419338 0.1% crystal violet Solarbio Cat#G1063 Guinea pig complement Rockland CatC200-0005 Octet Kinetics buffer Sartorius Cat#18–1105 Critical commercial assays BCA Protein Assay Kit ThermoFisher Scientific Cat#23227 Expi293TM Expression System Kit ThermoFisher Scientific Cat#A14635 Luciferase Assay System Promega Cat#E1501 RNeasy Mini Kit Qiagen Cat#74104 One-step QuantiNova Probe RT-qPCR Kit Qiagen Cat#208354 Genomic DNA extraction kit TIANGEN Cat#DP304 TB Green Premix Ex TaqTM II Takara Cat#RR820A CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7571 Deposited data B9/M1R complex structure This paper PDB: 9XJK G4/M1R complex structure This paper PDB: 22LL Experimental models: Cell lines BS-C-1 cells ATCC Cat#CCL-26 Expi293FTM cells ThermoFisher Scientific Cat#A14527 Experimental models: Organisms/strains Mouse: BALB/c Charles River Laboratories Cat#01011 Macaca fascicularis Beijing Institute of Biotechnology’s animal center N/A Oligonucleotides Primer: P4b-F: AGAAGATATCAGACGATCCACAATC Cheng et al.45 N/A Primer: P4b-R: GTAGAACGACGCCAGAATAAGAATA Cheng et al.45 N/A Probe: P4b-probe: FAM-TTGGTCTCCGAGTTTATAACAGAC TGCGGAC- BHQ Cheng et al.45 N/A Primer: MPXV-F: ATGTTGGATATGA GGTTATTGGTGT This paper N/A Primer: MPXV-R: TATCACATTTTTGT TGACATGATGGA This paper N/A Probe: MPXV-probe: FAM-TTGGTATA TAAGTTGTACGGCT-MGB This paper N/A Recombinant DNA Plasmid pcDNA3.1 -hIgG1 General Biosystems N/A Plasmid pTIG General Biosystems N/A Plasmid pcDNA3.4 -hIgG1 General Biosystems N/A (Continued on next page) e2 Cell Reports Medicine 7, 103077, October 20, 2026 Article ll OPEN ACCESS .. Six-to eight-week-old female BALB/c mice were obtained from Charles River Laboratories.

    BIA-KA:

    Article Title: Structural basis for broad orthopoxvirus neutralization by two antibodies targeting distinct L1R epitopes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human/NHP CD3/PerCP BD PharmingenTM Cat#552581 Anti-human CD19/APC Beckman Coulter Cat#IM2470; RRID:AB_130789 Anti-human IgG/PE BD PharmingenTM Cat#555787 Anti-human CD27/PE-Cy7 Beckman Coulter Cat#A54823 Streptavidin/AF488 Biolegend Cat#405235 Streptavidin/BV421 Biolegend Cat#405226 L1R 7D11, mAb Su et al.27 N/A RSV-F antibody McLellan et al.37 N/A Goat anti-monkey IgG (HRP) antibody Abcam Cat#Ab112767 Goat anti-human IgG (HRP) antibody Abcam Cat#Ab97225 A33R A27D7, mAb Matho et al.42 N/A D8 MV33, mAb Noy-Porat et al.43,44 N/A Rabbit anti-vaccinia virus antibody Abcam Cat#Ab35219 Goat anti-rabbit IgG (HRP) antibody Abcam Cat#Ab6721; RRID:AB_955447 Bacterial and virus strains VACV WR (Western Reserve) ATCC Cat#VR-119 ECTV Moscow ATCC Cat#VR-1347 MPXV (hMpxV/China/GZ8H-01/2023) Eighth Affiliated Hospital of Guangzhou Medical University N/A VACV-Fluc WR strain VectorBuilder Cat#P240423-1002ske VACV-Fluc WR strain (MV) VectorBuilder Cat#P240422-1031ahf VACV-Fluc WR strain (EV) VectorBuilder Cat#P240422-1030akq Biological samples Serum samples This paper N/A PBMC samples This paper N/A Chemicals, peptides, and recombinant proteins VACV L1R protein (NC_006998) This paper N/A VARV L1R protein (NC_001611) This paper N/A CPXV L1R protein (NC_003663) This paper N/A ECTV L1R protein (NC_004105) This paper N/A MPXV M1R protein (ON563414.3) This paper N/A MPXV M1R_Q24A protein This paper N/A MPXV M1R_E25A protein This paper N/A MPXV M1R_A26S protein This paper N/A MPXV M1R_N27A protein This paper N/A MPXV M1R_S29A protein This paper N/A MPXV M1R_Q31A protein This paper N/A MPXV M1R_T32A protein This paper N/A MPXV M1R_K33A protein This paper N/A MPXV M1R_D35N protein This paper N/A MPXV M1R_S58A protein This paper N/A MPXV M1R_A59S protein This paper N/A MPXV M1R_D60A protein This paper N/A MPXV M1R_A61S protein This paper N/A (Continued on next page) Cell Reports Medicine 7, 103077, October 20, 2026 e1 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER MPXV M1R_D62A protein This paper N/A MPXV M1R_A63S protein This paper N/A MPXV M1R_D66A protein This paper N/A ELISA Coating Buffer Solarbio Cat#C1055 Bovine Serum Albumin Solarbio Cat#A8010 TMB Single-Component Substrate solution Solarbio Cat#PR1200 ELISA Stop Buffer Solarbio Cat#C1058 Passive Lysis 5× Buffer Promega Cat#E194A Carboxymethyl cellulose Merck Cat#419338 0.1% crystal violet Solarbio Cat#G1063 Guinea pig complement Rockland CatC200-0005 Octet Kinetics buffer Sartorius Cat#18–1105 Critical commercial assays BCA Protein Assay Kit ThermoFisher Scientific Cat#23227 Expi293TM Expression System Kit ThermoFisher Scientific Cat#A14635 Luciferase Assay System Promega Cat#E1501 RNeasy Mini Kit Qiagen Cat#74104 One-step QuantiNova Probe RT-qPCR Kit Qiagen Cat#208354 Genomic DNA extraction kit TIANGEN Cat#DP304 TB Green Premix Ex TaqTM II Takara Cat#RR820A CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7571 Deposited data B9/M1R complex structure This paper PDB: 9XJK G4/M1R complex structure This paper PDB: 22LL Experimental models: Cell lines BS-C-1 cells ATCC Cat#CCL-26 Expi293FTM cells ThermoFisher Scientific Cat#A14527 Experimental models: Organisms/strains Mouse: BALB/c Charles River Laboratories Cat#01011 Macaca fascicularis Beijing Institute of Biotechnology’s animal center N/A Oligonucleotides Primer: P4b-F: AGAAGATATCAGACGATCCACAATC Cheng et al.45 N/A Primer: P4b-R: GTAGAACGACGCCAGAATAAGAATA Cheng et al.45 N/A Probe: P4b-probe: FAM-TTGGTCTCCGAGTTTATAACAGAC TGCGGAC- BHQ Cheng et al.45 N/A Primer: MPXV-F: ATGTTGGATATGA GGTTATTGGTGT This paper N/A Primer: MPXV-R: TATCACATTTTTGT TGACATGATGGA This paper N/A Probe: MPXV-probe: FAM-TTGGTATA TAAGTTGTACGGCT-MGB This paper N/A Recombinant DNA Plasmid pcDNA3.1 -hIgG1 General Biosystems N/A Plasmid pTIG General Biosystems N/A Plasmid pcDNA3.4 -hIgG1 General Biosystems N/A (Continued on next page) e2 Cell Reports Medicine 7, 103077, October 20, 2026 Article ll OPEN ACCESS .. Six-to eight-week-old female BALB/c mice were obtained from Charles River Laboratories.

    Luciferase:

    Article Title: Structural basis for broad orthopoxvirus neutralization by two antibodies targeting distinct L1R epitopes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human/NHP CD3/PerCP BD PharmingenTM Cat#552581 Anti-human CD19/APC Beckman Coulter Cat#IM2470; RRID:AB_130789 Anti-human IgG/PE BD PharmingenTM Cat#555787 Anti-human CD27/PE-Cy7 Beckman Coulter Cat#A54823 Streptavidin/AF488 Biolegend Cat#405235 Streptavidin/BV421 Biolegend Cat#405226 L1R 7D11, mAb Su et al.27 N/A RSV-F antibody McLellan et al.37 N/A Goat anti-monkey IgG (HRP) antibody Abcam Cat#Ab112767 Goat anti-human IgG (HRP) antibody Abcam Cat#Ab97225 A33R A27D7, mAb Matho et al.42 N/A D8 MV33, mAb Noy-Porat et al.43,44 N/A Rabbit anti-vaccinia virus antibody Abcam Cat#Ab35219 Goat anti-rabbit IgG (HRP) antibody Abcam Cat#Ab6721; RRID:AB_955447 Bacterial and virus strains VACV WR (Western Reserve) ATCC Cat#VR-119 ECTV Moscow ATCC Cat#VR-1347 MPXV (hMpxV/China/GZ8H-01/2023) Eighth Affiliated Hospital of Guangzhou Medical University N/A VACV-Fluc WR strain VectorBuilder Cat#P240423-1002ske VACV-Fluc WR strain (MV) VectorBuilder Cat#P240422-1031ahf VACV-Fluc WR strain (EV) VectorBuilder Cat#P240422-1030akq Biological samples Serum samples This paper N/A PBMC samples This paper N/A Chemicals, peptides, and recombinant proteins VACV L1R protein (NC_006998) This paper N/A VARV L1R protein (NC_001611) This paper N/A CPXV L1R protein (NC_003663) This paper N/A ECTV L1R protein (NC_004105) This paper N/A MPXV M1R protein (ON563414.3) This paper N/A MPXV M1R_Q24A protein This paper N/A MPXV M1R_E25A protein This paper N/A MPXV M1R_A26S protein This paper N/A MPXV M1R_N27A protein This paper N/A MPXV M1R_S29A protein This paper N/A MPXV M1R_Q31A protein This paper N/A MPXV M1R_T32A protein This paper N/A MPXV M1R_K33A protein This paper N/A MPXV M1R_D35N protein This paper N/A MPXV M1R_S58A protein This paper N/A MPXV M1R_A59S protein This paper N/A MPXV M1R_D60A protein This paper N/A MPXV M1R_A61S protein This paper N/A (Continued on next page) Cell Reports Medicine 7, 103077, October 20, 2026 e1 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER MPXV M1R_D62A protein This paper N/A MPXV M1R_A63S protein This paper N/A MPXV M1R_D66A protein This paper N/A ELISA Coating Buffer Solarbio Cat#C1055 Bovine Serum Albumin Solarbio Cat#A8010 TMB Single-Component Substrate solution Solarbio Cat#PR1200 ELISA Stop Buffer Solarbio Cat#C1058 Passive Lysis 5× Buffer Promega Cat#E194A Carboxymethyl cellulose Merck Cat#419338 0.1% crystal violet Solarbio Cat#G1063 Guinea pig complement Rockland CatC200-0005 Octet Kinetics buffer Sartorius Cat#18–1105 Critical commercial assays BCA Protein Assay Kit ThermoFisher Scientific Cat#23227 Expi293TM Expression System Kit ThermoFisher Scientific Cat#A14635 Luciferase Assay System Promega Cat#E1501 RNeasy Mini Kit Qiagen Cat#74104 One-step QuantiNova Probe RT-qPCR Kit Qiagen Cat#208354 Genomic DNA extraction kit TIANGEN Cat#DP304 TB Green Premix Ex TaqTM II Takara Cat#RR820A CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7571 Deposited data B9/M1R complex structure This paper PDB: 9XJK G4/M1R complex structure This paper PDB: 22LL Experimental models: Cell lines BS-C-1 cells ATCC Cat#CCL-26 Expi293FTM cells ThermoFisher Scientific Cat#A14527 Experimental models: Organisms/strains Mouse: BALB/c Charles River Laboratories Cat#01011 Macaca fascicularis Beijing Institute of Biotechnology’s animal center N/A Oligonucleotides Primer: P4b-F: AGAAGATATCAGACGATCCACAATC Cheng et al.45 N/A Primer: P4b-R: GTAGAACGACGCCAGAATAAGAATA Cheng et al.45 N/A Probe: P4b-probe: FAM-TTGGTCTCCGAGTTTATAACAGAC TGCGGAC- BHQ Cheng et al.45 N/A Primer: MPXV-F: ATGTTGGATATGA GGTTATTGGTGT This paper N/A Primer: MPXV-R: TATCACATTTTTGT TGACATGATGGA This paper N/A Probe: MPXV-probe: FAM-TTGGTATA TAAGTTGTACGGCT-MGB This paper N/A Recombinant DNA Plasmid pcDNA3.1 -hIgG1 General Biosystems N/A Plasmid pTIG General Biosystems N/A Plasmid pcDNA3.4 -hIgG1 General Biosystems N/A (Continued on next page) e2 Cell Reports Medicine 7, 103077, October 20, 2026 Article ll OPEN ACCESS .. Six-to eight-week-old female BALB/c mice were obtained from Charles River Laboratories.

    Quantitative RT-PCR:

    Article Title: Structural basis for broad orthopoxvirus neutralization by two antibodies targeting distinct L1R epitopes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human/NHP CD3/PerCP BD PharmingenTM Cat#552581 Anti-human CD19/APC Beckman Coulter Cat#IM2470; RRID:AB_130789 Anti-human IgG/PE BD PharmingenTM Cat#555787 Anti-human CD27/PE-Cy7 Beckman Coulter Cat#A54823 Streptavidin/AF488 Biolegend Cat#405235 Streptavidin/BV421 Biolegend Cat#405226 L1R 7D11, mAb Su et al.27 N/A RSV-F antibody McLellan et al.37 N/A Goat anti-monkey IgG (HRP) antibody Abcam Cat#Ab112767 Goat anti-human IgG (HRP) antibody Abcam Cat#Ab97225 A33R A27D7, mAb Matho et al.42 N/A D8 MV33, mAb Noy-Porat et al.43,44 N/A Rabbit anti-vaccinia virus antibody Abcam Cat#Ab35219 Goat anti-rabbit IgG (HRP) antibody Abcam Cat#Ab6721; RRID:AB_955447 Bacterial and virus strains VACV WR (Western Reserve) ATCC Cat#VR-119 ECTV Moscow ATCC Cat#VR-1347 MPXV (hMpxV/China/GZ8H-01/2023) Eighth Affiliated Hospital of Guangzhou Medical University N/A VACV-Fluc WR strain VectorBuilder Cat#P240423-1002ske VACV-Fluc WR strain (MV) VectorBuilder Cat#P240422-1031ahf VACV-Fluc WR strain (EV) VectorBuilder Cat#P240422-1030akq Biological samples Serum samples This paper N/A PBMC samples This paper N/A Chemicals, peptides, and recombinant proteins VACV L1R protein (NC_006998) This paper N/A VARV L1R protein (NC_001611) This paper N/A CPXV L1R protein (NC_003663) This paper N/A ECTV L1R protein (NC_004105) This paper N/A MPXV M1R protein (ON563414.3) This paper N/A MPXV M1R_Q24A protein This paper N/A MPXV M1R_E25A protein This paper N/A MPXV M1R_A26S protein This paper N/A MPXV M1R_N27A protein This paper N/A MPXV M1R_S29A protein This paper N/A MPXV M1R_Q31A protein This paper N/A MPXV M1R_T32A protein This paper N/A MPXV M1R_K33A protein This paper N/A MPXV M1R_D35N protein This paper N/A MPXV M1R_S58A protein This paper N/A MPXV M1R_A59S protein This paper N/A MPXV M1R_D60A protein This paper N/A MPXV M1R_A61S protein This paper N/A (Continued on next page) Cell Reports Medicine 7, 103077, October 20, 2026 e1 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER MPXV M1R_D62A protein This paper N/A MPXV M1R_A63S protein This paper N/A MPXV M1R_D66A protein This paper N/A ELISA Coating Buffer Solarbio Cat#C1055 Bovine Serum Albumin Solarbio Cat#A8010 TMB Single-Component Substrate solution Solarbio Cat#PR1200 ELISA Stop Buffer Solarbio Cat#C1058 Passive Lysis 5× Buffer Promega Cat#E194A Carboxymethyl cellulose Merck Cat#419338 0.1% crystal violet Solarbio Cat#G1063 Guinea pig complement Rockland CatC200-0005 Octet Kinetics buffer Sartorius Cat#18–1105 Critical commercial assays BCA Protein Assay Kit ThermoFisher Scientific Cat#23227 Expi293TM Expression System Kit ThermoFisher Scientific Cat#A14635 Luciferase Assay System Promega Cat#E1501 RNeasy Mini Kit Qiagen Cat#74104 One-step QuantiNova Probe RT-qPCR Kit Qiagen Cat#208354 Genomic DNA extraction kit TIANGEN Cat#DP304 TB Green Premix Ex TaqTM II Takara Cat#RR820A CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7571 Deposited data B9/M1R complex structure This paper PDB: 9XJK G4/M1R complex structure This paper PDB: 22LL Experimental models: Cell lines BS-C-1 cells ATCC Cat#CCL-26 Expi293FTM cells ThermoFisher Scientific Cat#A14527 Experimental models: Organisms/strains Mouse: BALB/c Charles River Laboratories Cat#01011 Macaca fascicularis Beijing Institute of Biotechnology’s animal center N/A Oligonucleotides Primer: P4b-F: AGAAGATATCAGACGATCCACAATC Cheng et al.45 N/A Primer: P4b-R: GTAGAACGACGCCAGAATAAGAATA Cheng et al.45 N/A Probe: P4b-probe: FAM-TTGGTCTCCGAGTTTATAACAGAC TGCGGAC- BHQ Cheng et al.45 N/A Primer: MPXV-F: ATGTTGGATATGA GGTTATTGGTGT This paper N/A Primer: MPXV-R: TATCACATTTTTGT TGACATGATGGA This paper N/A Probe: MPXV-probe: FAM-TTGGTATA TAAGTTGTACGGCT-MGB This paper N/A Recombinant DNA Plasmid pcDNA3.1 -hIgG1 General Biosystems N/A Plasmid pTIG General Biosystems N/A Plasmid pcDNA3.4 -hIgG1 General Biosystems N/A (Continued on next page) e2 Cell Reports Medicine 7, 103077, October 20, 2026 Article ll OPEN ACCESS .. Six-to eight-week-old female BALB/c mice were obtained from Charles River Laboratories.

    DNA Extraction:

    Article Title: Structural basis for broad orthopoxvirus neutralization by two antibodies targeting distinct L1R epitopes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human/NHP CD3/PerCP BD PharmingenTM Cat#552581 Anti-human CD19/APC Beckman Coulter Cat#IM2470; RRID:AB_130789 Anti-human IgG/PE BD PharmingenTM Cat#555787 Anti-human CD27/PE-Cy7 Beckman Coulter Cat#A54823 Streptavidin/AF488 Biolegend Cat#405235 Streptavidin/BV421 Biolegend Cat#405226 L1R 7D11, mAb Su et al.27 N/A RSV-F antibody McLellan et al.37 N/A Goat anti-monkey IgG (HRP) antibody Abcam Cat#Ab112767 Goat anti-human IgG (HRP) antibody Abcam Cat#Ab97225 A33R A27D7, mAb Matho et al.42 N/A D8 MV33, mAb Noy-Porat et al.43,44 N/A Rabbit anti-vaccinia virus antibody Abcam Cat#Ab35219 Goat anti-rabbit IgG (HRP) antibody Abcam Cat#Ab6721; RRID:AB_955447 Bacterial and virus strains VACV WR (Western Reserve) ATCC Cat#VR-119 ECTV Moscow ATCC Cat#VR-1347 MPXV (hMpxV/China/GZ8H-01/2023) Eighth Affiliated Hospital of Guangzhou Medical University N/A VACV-Fluc WR strain VectorBuilder Cat#P240423-1002ske VACV-Fluc WR strain (MV) VectorBuilder Cat#P240422-1031ahf VACV-Fluc WR strain (EV) VectorBuilder Cat#P240422-1030akq Biological samples Serum samples This paper N/A PBMC samples This paper N/A Chemicals, peptides, and recombinant proteins VACV L1R protein (NC_006998) This paper N/A VARV L1R protein (NC_001611) This paper N/A CPXV L1R protein (NC_003663) This paper N/A ECTV L1R protein (NC_004105) This paper N/A MPXV M1R protein (ON563414.3) This paper N/A MPXV M1R_Q24A protein This paper N/A MPXV M1R_E25A protein This paper N/A MPXV M1R_A26S protein This paper N/A MPXV M1R_N27A protein This paper N/A MPXV M1R_S29A protein This paper N/A MPXV M1R_Q31A protein This paper N/A MPXV M1R_T32A protein This paper N/A MPXV M1R_K33A protein This paper N/A MPXV M1R_D35N protein This paper N/A MPXV M1R_S58A protein This paper N/A MPXV M1R_A59S protein This paper N/A MPXV M1R_D60A protein This paper N/A MPXV M1R_A61S protein This paper N/A (Continued on next page) Cell Reports Medicine 7, 103077, October 20, 2026 e1 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER MPXV M1R_D62A protein This paper N/A MPXV M1R_A63S protein This paper N/A MPXV M1R_D66A protein This paper N/A ELISA Coating Buffer Solarbio Cat#C1055 Bovine Serum Albumin Solarbio Cat#A8010 TMB Single-Component Substrate solution Solarbio Cat#PR1200 ELISA Stop Buffer Solarbio Cat#C1058 Passive Lysis 5× Buffer Promega Cat#E194A Carboxymethyl cellulose Merck Cat#419338 0.1% crystal violet Solarbio Cat#G1063 Guinea pig complement Rockland CatC200-0005 Octet Kinetics buffer Sartorius Cat#18–1105 Critical commercial assays BCA Protein Assay Kit ThermoFisher Scientific Cat#23227 Expi293TM Expression System Kit ThermoFisher Scientific Cat#A14635 Luciferase Assay System Promega Cat#E1501 RNeasy Mini Kit Qiagen Cat#74104 One-step QuantiNova Probe RT-qPCR Kit Qiagen Cat#208354 Genomic DNA extraction kit TIANGEN Cat#DP304 TB Green Premix Ex TaqTM II Takara Cat#RR820A CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7571 Deposited data B9/M1R complex structure This paper PDB: 9XJK G4/M1R complex structure This paper PDB: 22LL Experimental models: Cell lines BS-C-1 cells ATCC Cat#CCL-26 Expi293FTM cells ThermoFisher Scientific Cat#A14527 Experimental models: Organisms/strains Mouse: BALB/c Charles River Laboratories Cat#01011 Macaca fascicularis Beijing Institute of Biotechnology’s animal center N/A Oligonucleotides Primer: P4b-F: AGAAGATATCAGACGATCCACAATC Cheng et al.45 N/A Primer: P4b-R: GTAGAACGACGCCAGAATAAGAATA Cheng et al.45 N/A Probe: P4b-probe: FAM-TTGGTCTCCGAGTTTATAACAGAC TGCGGAC- BHQ Cheng et al.45 N/A Primer: MPXV-F: ATGTTGGATATGA GGTTATTGGTGT This paper N/A Primer: MPXV-R: TATCACATTTTTGT TGACATGATGGA This paper N/A Probe: MPXV-probe: FAM-TTGGTATA TAAGTTGTACGGCT-MGB This paper N/A Recombinant DNA Plasmid pcDNA3.1 -hIgG1 General Biosystems N/A Plasmid pTIG General Biosystems N/A Plasmid pcDNA3.4 -hIgG1 General Biosystems N/A (Continued on next page) e2 Cell Reports Medicine 7, 103077, October 20, 2026 Article ll OPEN ACCESS .. Six-to eight-week-old female BALB/c mice were obtained from Charles River Laboratories.

    Cell Viability Assay:

    Article Title: Structural basis for broad orthopoxvirus neutralization by two antibodies targeting distinct L1R epitopes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human/NHP CD3/PerCP BD PharmingenTM Cat#552581 Anti-human CD19/APC Beckman Coulter Cat#IM2470; RRID:AB_130789 Anti-human IgG/PE BD PharmingenTM Cat#555787 Anti-human CD27/PE-Cy7 Beckman Coulter Cat#A54823 Streptavidin/AF488 Biolegend Cat#405235 Streptavidin/BV421 Biolegend Cat#405226 L1R 7D11, mAb Su et al.27 N/A RSV-F antibody McLellan et al.37 N/A Goat anti-monkey IgG (HRP) antibody Abcam Cat#Ab112767 Goat anti-human IgG (HRP) antibody Abcam Cat#Ab97225 A33R A27D7, mAb Matho et al.42 N/A D8 MV33, mAb Noy-Porat et al.43,44 N/A Rabbit anti-vaccinia virus antibody Abcam Cat#Ab35219 Goat anti-rabbit IgG (HRP) antibody Abcam Cat#Ab6721; RRID:AB_955447 Bacterial and virus strains VACV WR (Western Reserve) ATCC Cat#VR-119 ECTV Moscow ATCC Cat#VR-1347 MPXV (hMpxV/China/GZ8H-01/2023) Eighth Affiliated Hospital of Guangzhou Medical University N/A VACV-Fluc WR strain VectorBuilder Cat#P240423-1002ske VACV-Fluc WR strain (MV) VectorBuilder Cat#P240422-1031ahf VACV-Fluc WR strain (EV) VectorBuilder Cat#P240422-1030akq Biological samples Serum samples This paper N/A PBMC samples This paper N/A Chemicals, peptides, and recombinant proteins VACV L1R protein (NC_006998) This paper N/A VARV L1R protein (NC_001611) This paper N/A CPXV L1R protein (NC_003663) This paper N/A ECTV L1R protein (NC_004105) This paper N/A MPXV M1R protein (ON563414.3) This paper N/A MPXV M1R_Q24A protein This paper N/A MPXV M1R_E25A protein This paper N/A MPXV M1R_A26S protein This paper N/A MPXV M1R_N27A protein This paper N/A MPXV M1R_S29A protein This paper N/A MPXV M1R_Q31A protein This paper N/A MPXV M1R_T32A protein This paper N/A MPXV M1R_K33A protein This paper N/A MPXV M1R_D35N protein This paper N/A MPXV M1R_S58A protein This paper N/A MPXV M1R_A59S protein This paper N/A MPXV M1R_D60A protein This paper N/A MPXV M1R_A61S protein This paper N/A (Continued on next page) Cell Reports Medicine 7, 103077, October 20, 2026 e1 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER MPXV M1R_D62A protein This paper N/A MPXV M1R_A63S protein This paper N/A MPXV M1R_D66A protein This paper N/A ELISA Coating Buffer Solarbio Cat#C1055 Bovine Serum Albumin Solarbio Cat#A8010 TMB Single-Component Substrate solution Solarbio Cat#PR1200 ELISA Stop Buffer Solarbio Cat#C1058 Passive Lysis 5× Buffer Promega Cat#E194A Carboxymethyl cellulose Merck Cat#419338 0.1% crystal violet Solarbio Cat#G1063 Guinea pig complement Rockland CatC200-0005 Octet Kinetics buffer Sartorius Cat#18–1105 Critical commercial assays BCA Protein Assay Kit ThermoFisher Scientific Cat#23227 Expi293TM Expression System Kit ThermoFisher Scientific Cat#A14635 Luciferase Assay System Promega Cat#E1501 RNeasy Mini Kit Qiagen Cat#74104 One-step QuantiNova Probe RT-qPCR Kit Qiagen Cat#208354 Genomic DNA extraction kit TIANGEN Cat#DP304 TB Green Premix Ex TaqTM II Takara Cat#RR820A CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7571 Deposited data B9/M1R complex structure This paper PDB: 9XJK G4/M1R complex structure This paper PDB: 22LL Experimental models: Cell lines BS-C-1 cells ATCC Cat#CCL-26 Expi293FTM cells ThermoFisher Scientific Cat#A14527 Experimental models: Organisms/strains Mouse: BALB/c Charles River Laboratories Cat#01011 Macaca fascicularis Beijing Institute of Biotechnology’s animal center N/A Oligonucleotides Primer: P4b-F: AGAAGATATCAGACGATCCACAATC Cheng et al.45 N/A Primer: P4b-R: GTAGAACGACGCCAGAATAAGAATA Cheng et al.45 N/A Probe: P4b-probe: FAM-TTGGTCTCCGAGTTTATAACAGAC TGCGGAC- BHQ Cheng et al.45 N/A Primer: MPXV-F: ATGTTGGATATGA GGTTATTGGTGT This paper N/A Primer: MPXV-R: TATCACATTTTTGT TGACATGATGGA This paper N/A Probe: MPXV-probe: FAM-TTGGTATA TAAGTTGTACGGCT-MGB This paper N/A Recombinant DNA Plasmid pcDNA3.1 -hIgG1 General Biosystems N/A Plasmid pTIG General Biosystems N/A Plasmid pcDNA3.4 -hIgG1 General Biosystems N/A (Continued on next page) e2 Cell Reports Medicine 7, 103077, October 20, 2026 Article ll OPEN ACCESS .. Six-to eight-week-old female BALB/c mice were obtained from Charles River Laboratories.

    Recombinant:

    Article Title: Structural basis for broad orthopoxvirus neutralization by two antibodies targeting distinct L1R epitopes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human/NHP CD3/PerCP BD PharmingenTM Cat#552581 Anti-human CD19/APC Beckman Coulter Cat#IM2470; RRID:AB_130789 Anti-human IgG/PE BD PharmingenTM Cat#555787 Anti-human CD27/PE-Cy7 Beckman Coulter Cat#A54823 Streptavidin/AF488 Biolegend Cat#405235 Streptavidin/BV421 Biolegend Cat#405226 L1R 7D11, mAb Su et al.27 N/A RSV-F antibody McLellan et al.37 N/A Goat anti-monkey IgG (HRP) antibody Abcam Cat#Ab112767 Goat anti-human IgG (HRP) antibody Abcam Cat#Ab97225 A33R A27D7, mAb Matho et al.42 N/A D8 MV33, mAb Noy-Porat et al.43,44 N/A Rabbit anti-vaccinia virus antibody Abcam Cat#Ab35219 Goat anti-rabbit IgG (HRP) antibody Abcam Cat#Ab6721; RRID:AB_955447 Bacterial and virus strains VACV WR (Western Reserve) ATCC Cat#VR-119 ECTV Moscow ATCC Cat#VR-1347 MPXV (hMpxV/China/GZ8H-01/2023) Eighth Affiliated Hospital of Guangzhou Medical University N/A VACV-Fluc WR strain VectorBuilder Cat#P240423-1002ske VACV-Fluc WR strain (MV) VectorBuilder Cat#P240422-1031ahf VACV-Fluc WR strain (EV) VectorBuilder Cat#P240422-1030akq Biological samples Serum samples This paper N/A PBMC samples This paper N/A Chemicals, peptides, and recombinant proteins VACV L1R protein (NC_006998) This paper N/A VARV L1R protein (NC_001611) This paper N/A CPXV L1R protein (NC_003663) This paper N/A ECTV L1R protein (NC_004105) This paper N/A MPXV M1R protein (ON563414.3) This paper N/A MPXV M1R_Q24A protein This paper N/A MPXV M1R_E25A protein This paper N/A MPXV M1R_A26S protein This paper N/A MPXV M1R_N27A protein This paper N/A MPXV M1R_S29A protein This paper N/A MPXV M1R_Q31A protein This paper N/A MPXV M1R_T32A protein This paper N/A MPXV M1R_K33A protein This paper N/A MPXV M1R_D35N protein This paper N/A MPXV M1R_S58A protein This paper N/A MPXV M1R_A59S protein This paper N/A MPXV M1R_D60A protein This paper N/A MPXV M1R_A61S protein This paper N/A (Continued on next page) Cell Reports Medicine 7, 103077, October 20, 2026 e1 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER MPXV M1R_D62A protein This paper N/A MPXV M1R_A63S protein This paper N/A MPXV M1R_D66A protein This paper N/A ELISA Coating Buffer Solarbio Cat#C1055 Bovine Serum Albumin Solarbio Cat#A8010 TMB Single-Component Substrate solution Solarbio Cat#PR1200 ELISA Stop Buffer Solarbio Cat#C1058 Passive Lysis 5× Buffer Promega Cat#E194A Carboxymethyl cellulose Merck Cat#419338 0.1% crystal violet Solarbio Cat#G1063 Guinea pig complement Rockland CatC200-0005 Octet Kinetics buffer Sartorius Cat#18–1105 Critical commercial assays BCA Protein Assay Kit ThermoFisher Scientific Cat#23227 Expi293TM Expression System Kit ThermoFisher Scientific Cat#A14635 Luciferase Assay System Promega Cat#E1501 RNeasy Mini Kit Qiagen Cat#74104 One-step QuantiNova Probe RT-qPCR Kit Qiagen Cat#208354 Genomic DNA extraction kit TIANGEN Cat#DP304 TB Green Premix Ex TaqTM II Takara Cat#RR820A CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7571 Deposited data B9/M1R complex structure This paper PDB: 9XJK G4/M1R complex structure This paper PDB: 22LL Experimental models: Cell lines BS-C-1 cells ATCC Cat#CCL-26 Expi293FTM cells ThermoFisher Scientific Cat#A14527 Experimental models: Organisms/strains Mouse: BALB/c Charles River Laboratories Cat#01011 Macaca fascicularis Beijing Institute of Biotechnology’s animal center N/A Oligonucleotides Primer: P4b-F: AGAAGATATCAGACGATCCACAATC Cheng et al.45 N/A Primer: P4b-R: GTAGAACGACGCCAGAATAAGAATA Cheng et al.45 N/A Probe: P4b-probe: FAM-TTGGTCTCCGAGTTTATAACAGAC TGCGGAC- BHQ Cheng et al.45 N/A Primer: MPXV-F: ATGTTGGATATGA GGTTATTGGTGT This paper N/A Primer: MPXV-R: TATCACATTTTTGT TGACATGATGGA This paper N/A Probe: MPXV-probe: FAM-TTGGTATA TAAGTTGTACGGCT-MGB This paper N/A Recombinant DNA Plasmid pcDNA3.1 -hIgG1 General Biosystems N/A Plasmid pTIG General Biosystems N/A Plasmid pcDNA3.4 -hIgG1 General Biosystems N/A (Continued on next page) e2 Cell Reports Medicine 7, 103077, October 20, 2026 Article ll OPEN ACCESS .. Six-to eight-week-old female BALB/c mice were obtained from Charles River Laboratories.

    Plasmid Preparation:

    Article Title: Structural basis for broad orthopoxvirus neutralization by two antibodies targeting distinct L1R epitopes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human/NHP CD3/PerCP BD PharmingenTM Cat#552581 Anti-human CD19/APC Beckman Coulter Cat#IM2470; RRID:AB_130789 Anti-human IgG/PE BD PharmingenTM Cat#555787 Anti-human CD27/PE-Cy7 Beckman Coulter Cat#A54823 Streptavidin/AF488 Biolegend Cat#405235 Streptavidin/BV421 Biolegend Cat#405226 L1R 7D11, mAb Su et al.27 N/A RSV-F antibody McLellan et al.37 N/A Goat anti-monkey IgG (HRP) antibody Abcam Cat#Ab112767 Goat anti-human IgG (HRP) antibody Abcam Cat#Ab97225 A33R A27D7, mAb Matho et al.42 N/A D8 MV33, mAb Noy-Porat et al.43,44 N/A Rabbit anti-vaccinia virus antibody Abcam Cat#Ab35219 Goat anti-rabbit IgG (HRP) antibody Abcam Cat#Ab6721; RRID:AB_955447 Bacterial and virus strains VACV WR (Western Reserve) ATCC Cat#VR-119 ECTV Moscow ATCC Cat#VR-1347 MPXV (hMpxV/China/GZ8H-01/2023) Eighth Affiliated Hospital of Guangzhou Medical University N/A VACV-Fluc WR strain VectorBuilder Cat#P240423-1002ske VACV-Fluc WR strain (MV) VectorBuilder Cat#P240422-1031ahf VACV-Fluc WR strain (EV) VectorBuilder Cat#P240422-1030akq Biological samples Serum samples This paper N/A PBMC samples This paper N/A Chemicals, peptides, and recombinant proteins VACV L1R protein (NC_006998) This paper N/A VARV L1R protein (NC_001611) This paper N/A CPXV L1R protein (NC_003663) This paper N/A ECTV L1R protein (NC_004105) This paper N/A MPXV M1R protein (ON563414.3) This paper N/A MPXV M1R_Q24A protein This paper N/A MPXV M1R_E25A protein This paper N/A MPXV M1R_A26S protein This paper N/A MPXV M1R_N27A protein This paper N/A MPXV M1R_S29A protein This paper N/A MPXV M1R_Q31A protein This paper N/A MPXV M1R_T32A protein This paper N/A MPXV M1R_K33A protein This paper N/A MPXV M1R_D35N protein This paper N/A MPXV M1R_S58A protein This paper N/A MPXV M1R_A59S protein This paper N/A MPXV M1R_D60A protein This paper N/A MPXV M1R_A61S protein This paper N/A (Continued on next page) Cell Reports Medicine 7, 103077, October 20, 2026 e1 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER MPXV M1R_D62A protein This paper N/A MPXV M1R_A63S protein This paper N/A MPXV M1R_D66A protein This paper N/A ELISA Coating Buffer Solarbio Cat#C1055 Bovine Serum Albumin Solarbio Cat#A8010 TMB Single-Component Substrate solution Solarbio Cat#PR1200 ELISA Stop Buffer Solarbio Cat#C1058 Passive Lysis 5× Buffer Promega Cat#E194A Carboxymethyl cellulose Merck Cat#419338 0.1% crystal violet Solarbio Cat#G1063 Guinea pig complement Rockland CatC200-0005 Octet Kinetics buffer Sartorius Cat#18–1105 Critical commercial assays BCA Protein Assay Kit ThermoFisher Scientific Cat#23227 Expi293TM Expression System Kit ThermoFisher Scientific Cat#A14635 Luciferase Assay System Promega Cat#E1501 RNeasy Mini Kit Qiagen Cat#74104 One-step QuantiNova Probe RT-qPCR Kit Qiagen Cat#208354 Genomic DNA extraction kit TIANGEN Cat#DP304 TB Green Premix Ex TaqTM II Takara Cat#RR820A CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7571 Deposited data B9/M1R complex structure This paper PDB: 9XJK G4/M1R complex structure This paper PDB: 22LL Experimental models: Cell lines BS-C-1 cells ATCC Cat#CCL-26 Expi293FTM cells ThermoFisher Scientific Cat#A14527 Experimental models: Organisms/strains Mouse: BALB/c Charles River Laboratories Cat#01011 Macaca fascicularis Beijing Institute of Biotechnology’s animal center N/A Oligonucleotides Primer: P4b-F: AGAAGATATCAGACGATCCACAATC Cheng et al.45 N/A Primer: P4b-R: GTAGAACGACGCCAGAATAAGAATA Cheng et al.45 N/A Probe: P4b-probe: FAM-TTGGTCTCCGAGTTTATAACAGAC TGCGGAC- BHQ Cheng et al.45 N/A Primer: MPXV-F: ATGTTGGATATGA GGTTATTGGTGT This paper N/A Primer: MPXV-R: TATCACATTTTTGT TGACATGATGGA This paper N/A Probe: MPXV-probe: FAM-TTGGTATA TAAGTTGTACGGCT-MGB This paper N/A Recombinant DNA Plasmid pcDNA3.1 -hIgG1 General Biosystems N/A Plasmid pTIG General Biosystems N/A Plasmid pcDNA3.4 -hIgG1 General Biosystems N/A (Continued on next page) e2 Cell Reports Medicine 7, 103077, October 20, 2026 Article ll OPEN ACCESS .. Six-to eight-week-old female BALB/c mice were obtained from Charles River Laboratories.



    Similar Products

    goat fitc anti-human c3 complement secondary antibodies  (AMS Biotechnology)
    98
    AMS Biotechnology goat fitc anti-human c3 complement secondary antibodies
    Goat Fitc Anti Human C3 Complement Secondary Antibodies, supplied by AMS Biotechnology, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/complement+c3/Goat+FITC+Anti-human+C3+Complement+Secondary+Antibodies/custom%40365%4041740231
    Average 98 stars, based on 1 article reviews
    goat fitc anti-human c3 complement secondary antibodies - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    mouse complement c3  (MedChemExpress)
    94
    MedChemExpress mouse complement c3
    Schematic illustration of in vivo tumor immunotherapy enhanced by mRNA/HNPs through intravenous injection. H18 lipid, DOPE, cholesterol, DMG-PEG 2000 and mRNA were mixed to form mRNA/H 18 NPs with the special multilamellar concentric nanostructures. Following intravenous administration, mRNA/H 18 NPs demonstrated preferential adsorption of <t>complement</t> <t>C3</t> proteins to form a characteristic protein corona, resulting in specific mRNA transfection in the spleen, especially in splenic dendritic cells. When encapsulating tumor antigen-encoding mRNA, the mRNA/H 18 NPs achieved precise transfection of the antigen mRNA in splenic dendritic cells. This targeted delivery stimulated dendritic cell maturation and subsequent antigen presentation, initiating robust T cell priming. The activated antigen-specific cytotoxic T lymphocytes then infiltrated into tumor tissues, ultimately inducing tumor cell elimination.
    Mouse Complement C3, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/complement+c3/Complement+C3%2C+Mouse/pmc12926576-58-0-6
    Average 94 stars, based on 1 article reviews
    mouse complement c3 - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    mouse complement 3 elisa kit  (Elabscience Biotechnology)
    93
    Elabscience Biotechnology mouse complement 3 elisa kit
    Schematic illustration of in vivo tumor immunotherapy enhanced by mRNA/HNPs through intravenous injection. H18 lipid, DOPE, cholesterol, DMG-PEG 2000 and mRNA were mixed to form mRNA/H 18 NPs with the special multilamellar concentric nanostructures. Following intravenous administration, mRNA/H 18 NPs demonstrated preferential adsorption of <t>complement</t> <t>C3</t> proteins to form a characteristic protein corona, resulting in specific mRNA transfection in the spleen, especially in splenic dendritic cells. When encapsulating tumor antigen-encoding mRNA, the mRNA/H 18 NPs achieved precise transfection of the antigen mRNA in splenic dendritic cells. This targeted delivery stimulated dendritic cell maturation and subsequent antigen presentation, initiating robust T cell priming. The activated antigen-specific cytotoxic T lymphocytes then infiltrated into tumor tissues, ultimately inducing tumor cell elimination.
    Mouse Complement 3 Elisa Kit, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/complement+c3/Mouse+C3+(Complement+Component+3)+ELISA+Kit/pm42887110-175-20-26
    Average 93 stars, based on 1 article reviews
    mouse complement 3 elisa kit - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    goat anti guinea pig c3 antibody  (Valiant Co Ltd)
    96
    Valiant Co Ltd goat anti guinea pig c3 antibody
    Schematic illustration of in vivo tumor immunotherapy enhanced by mRNA/HNPs through intravenous injection. H18 lipid, DOPE, cholesterol, DMG-PEG 2000 and mRNA were mixed to form mRNA/H 18 NPs with the special multilamellar concentric nanostructures. Following intravenous administration, mRNA/H 18 NPs demonstrated preferential adsorption of <t>complement</t> <t>C3</t> proteins to form a characteristic protein corona, resulting in specific mRNA transfection in the spleen, especially in splenic dendritic cells. When encapsulating tumor antigen-encoding mRNA, the mRNA/H 18 NPs achieved precise transfection of the antigen mRNA in splenic dendritic cells. This targeted delivery stimulated dendritic cell maturation and subsequent antigen presentation, initiating robust T cell priming. The activated antigen-specific cytotoxic T lymphocytes then infiltrated into tumor tissues, ultimately inducing tumor cell elimination.
    Goat Anti Guinea Pig C3 Antibody, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/complement+c3/Goat+Anti-Guinea+Pig+Complement+C3/pm42801862-227-5-10
    Average 96 stars, based on 1 article reviews
    goat anti guinea pig c3 antibody - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    guinea pig complement c3  (Valiant Co Ltd)
    96
    Valiant Co Ltd guinea pig complement c3
    Schematic illustration of in vivo tumor immunotherapy enhanced by mRNA/HNPs through intravenous injection. H18 lipid, DOPE, cholesterol, DMG-PEG 2000 and mRNA were mixed to form mRNA/H 18 NPs with the special multilamellar concentric nanostructures. Following intravenous administration, mRNA/H 18 NPs demonstrated preferential adsorption of <t>complement</t> <t>C3</t> proteins to form a characteristic protein corona, resulting in specific mRNA transfection in the spleen, especially in splenic dendritic cells. When encapsulating tumor antigen-encoding mRNA, the mRNA/H 18 NPs achieved precise transfection of the antigen mRNA in splenic dendritic cells. This targeted delivery stimulated dendritic cell maturation and subsequent antigen presentation, initiating robust T cell priming. The activated antigen-specific cytotoxic T lymphocytes then infiltrated into tumor tissues, ultimately inducing tumor cell elimination.
    Guinea Pig Complement C3, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/complement+c3/Guinea+Pig+Complement/pm42785303-577-11-15
    Average 96 stars, based on 1 article reviews
    guinea pig complement c3 - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    complement c3/c3a, mouse  (MedChemExpress)
    94
    MedChemExpress complement c3/c3a, mouse
    Schematic illustration of in vivo tumor immunotherapy enhanced by mRNA/HNPs through intravenous injection. H18 lipid, DOPE, cholesterol, DMG-PEG 2000 and mRNA were mixed to form mRNA/H 18 NPs with the special multilamellar concentric nanostructures. Following intravenous administration, mRNA/H 18 NPs demonstrated preferential adsorption of <t>complement</t> <t>C3</t> proteins to form a characteristic protein corona, resulting in specific mRNA transfection in the spleen, especially in splenic dendritic cells. When encapsulating tumor antigen-encoding mRNA, the mRNA/H 18 NPs achieved precise transfection of the antigen mRNA in splenic dendritic cells. This targeted delivery stimulated dendritic cell maturation and subsequent antigen presentation, initiating robust T cell priming. The activated antigen-specific cytotoxic T lymphocytes then infiltrated into tumor tissues, ultimately inducing tumor cell elimination.
    Complement C3/C3a, Mouse, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/complement+c3/Complement+C3%2FC3a%2C+Mouse/custom%40hy-p7863%4042464680
    Average 94 stars, based on 1 article reviews
    complement c3/c3a, mouse - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    fluorescein isothiocyanate fitc conjugated monoclonal antibody  (Valiant Co Ltd)
    96
    Valiant Co Ltd fluorescein isothiocyanate fitc conjugated monoclonal antibody
    Schematic illustration of in vivo tumor immunotherapy enhanced by mRNA/HNPs through intravenous injection. H18 lipid, DOPE, cholesterol, DMG-PEG 2000 and mRNA were mixed to form mRNA/H 18 NPs with the special multilamellar concentric nanostructures. Following intravenous administration, mRNA/H 18 NPs demonstrated preferential adsorption of <t>complement</t> <t>C3</t> proteins to form a characteristic protein corona, resulting in specific mRNA transfection in the spleen, especially in splenic dendritic cells. When encapsulating tumor antigen-encoding mRNA, the mRNA/H 18 NPs achieved precise transfection of the antigen mRNA in splenic dendritic cells. This targeted delivery stimulated dendritic cell maturation and subsequent antigen presentation, initiating robust T cell priming. The activated antigen-specific cytotoxic T lymphocytes then infiltrated into tumor tissues, ultimately inducing tumor cell elimination.
    Fluorescein Isothiocyanate Fitc Conjugated Monoclonal Antibody, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/complement+c3/FITC+IgG+Goat+Anti-Guinea+Pig+Complement+C3/10__1038_slash_s41541___026___01557___y-177-8-18
    Average 96 stars, based on 1 article reviews
    fluorescein isothiocyanate fitc conjugated monoclonal antibody - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    anti-human complement c3 goat igg fraction, fluorescein-conjugated  (Valiant Co Ltd)
    94
    Valiant Co Ltd anti-human complement c3 goat igg fraction, fluorescein-conjugated
    Schematic illustration of in vivo tumor immunotherapy enhanced by mRNA/HNPs through intravenous injection. H18 lipid, DOPE, cholesterol, DMG-PEG 2000 and mRNA were mixed to form mRNA/H 18 NPs with the special multilamellar concentric nanostructures. Following intravenous administration, mRNA/H 18 NPs demonstrated preferential adsorption of <t>complement</t> <t>C3</t> proteins to form a characteristic protein corona, resulting in specific mRNA transfection in the spleen, especially in splenic dendritic cells. When encapsulating tumor antigen-encoding mRNA, the mRNA/H 18 NPs achieved precise transfection of the antigen mRNA in splenic dendritic cells. This targeted delivery stimulated dendritic cell maturation and subsequent antigen presentation, initiating robust T cell priming. The activated antigen-specific cytotoxic T lymphocytes then infiltrated into tumor tissues, ultimately inducing tumor cell elimination.
    Anti Human Complement C3 Goat Igg Fraction, Fluorescein Conjugated, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/complement+c3/Anti-human+complement+C3+goat+IgG+fraction%2C+fluorescein-conjugated/custom%400855167%4040528637
    Average 94 stars, based on 1 article reviews
    anti-human complement c3 goat igg fraction, fluorescein-conjugated - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    complement c3, mouse  (MedChemExpress)
    94
    MedChemExpress complement c3, mouse
    Schematic illustration of in vivo tumor immunotherapy enhanced by mRNA/HNPs through intravenous injection. H18 lipid, DOPE, cholesterol, DMG-PEG 2000 and mRNA were mixed to form mRNA/H 18 NPs with the special multilamellar concentric nanostructures. Following intravenous administration, mRNA/H 18 NPs demonstrated preferential adsorption of <t>complement</t> <t>C3</t> proteins to form a characteristic protein corona, resulting in specific mRNA transfection in the spleen, especially in splenic dendritic cells. When encapsulating tumor antigen-encoding mRNA, the mRNA/H 18 NPs achieved precise transfection of the antigen mRNA in splenic dendritic cells. This targeted delivery stimulated dendritic cell maturation and subsequent antigen presentation, initiating robust T cell priming. The activated antigen-specific cytotoxic T lymphocytes then infiltrated into tumor tissues, ultimately inducing tumor cell elimination.
    Complement C3, Mouse, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/complement+c3/Complement+C3%2C+Mouse/custom%40hy-p78247%4042362102
    Average 94 stars, based on 1 article reviews
    complement c3, mouse - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    complement c3 polyclonal antibody  (Valiant Co Ltd)
    93
    Valiant Co Ltd complement c3 polyclonal antibody
    <t>C3</t> inhibitor AMY-101 inhibits the alternative but not classical pathway <t>complement-mediated</t> hemolysis in the second-generation hC3 rats in vitro. (A) The C3 inhibitor AMY-101 (0.3-20μM) was incubated with rabbit RBCs in the presence of 80% WT rat serum, or second-generation hC3 rat serum in Mg 2+ -EGTA buffer at 37°C for 30 minutes, then hemolysis was quantitated, showing that AMY-101 almost completely inhibited the second-generation hC3 rat alternative pathway-mediated hemolysis at a concentration as low as 2.5μM while did not affect the WT rat alternative pathway-mediated hemolysis at a concentration as high as 20μM. (B) The C3 inhibitor AMY-101 (0.3-10μM) were incubated with antibody-sensitized sheep RBCs in the presence of 10% second-generation hC3 rat serum in GVB ++ buffer at 37°C for 30 minutes, then hemolysis was quantitated, showing that AMY-101 did not have any effect on the second-generation hC3 rat classical pathway-mediated hemolysis at a concentration as high as 10μM. 2nd gen, second generation.
    Complement C3 Polyclonal Antibody, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/complement+c3/Complement+C3+polyclonal+antibody/pmc12966651-35-12-16
    Average 93 stars, based on 1 article reviews
    complement c3 polyclonal antibody - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    Schematic illustration of in vivo tumor immunotherapy enhanced by mRNA/HNPs through intravenous injection. H18 lipid, DOPE, cholesterol, DMG-PEG 2000 and mRNA were mixed to form mRNA/H 18 NPs with the special multilamellar concentric nanostructures. Following intravenous administration, mRNA/H 18 NPs demonstrated preferential adsorption of complement C3 proteins to form a characteristic protein corona, resulting in specific mRNA transfection in the spleen, especially in splenic dendritic cells. When encapsulating tumor antigen-encoding mRNA, the mRNA/H 18 NPs achieved precise transfection of the antigen mRNA in splenic dendritic cells. This targeted delivery stimulated dendritic cell maturation and subsequent antigen presentation, initiating robust T cell priming. The activated antigen-specific cytotoxic T lymphocytes then infiltrated into tumor tissues, ultimately inducing tumor cell elimination.

    Journal: Bioactive Materials

    Article Title: Splenic dendritic cell-targeting mRNA transfection of H-type ionizable lipid-based LNPs for enhancing tumor immunotherapy

    doi: 10.1016/j.bioactmat.2026.02.018

    Figure Lengend Snippet: Schematic illustration of in vivo tumor immunotherapy enhanced by mRNA/HNPs through intravenous injection. H18 lipid, DOPE, cholesterol, DMG-PEG 2000 and mRNA were mixed to form mRNA/H 18 NPs with the special multilamellar concentric nanostructures. Following intravenous administration, mRNA/H 18 NPs demonstrated preferential adsorption of complement C3 proteins to form a characteristic protein corona, resulting in specific mRNA transfection in the spleen, especially in splenic dendritic cells. When encapsulating tumor antigen-encoding mRNA, the mRNA/H 18 NPs achieved precise transfection of the antigen mRNA in splenic dendritic cells. This targeted delivery stimulated dendritic cell maturation and subsequent antigen presentation, initiating robust T cell priming. The activated antigen-specific cytotoxic T lymphocytes then infiltrated into tumor tissues, ultimately inducing tumor cell elimination.

    Article Snippet: Mouse Complement C3 was purchased from MedChemExpress.

    Techniques: In Vivo, Injection, Adsorption, Transfection, Immunopeptidomics

    In vivo splenic DC-specific transfection of mRNA/H 18 NPs and in vitro protein corona analysis of mRNA/H 18 NPs. (A) EGFP protein expression in splenic cell subsets of C57BL/6J mice 24 h post intravenous injection of different formulations. (B) The top 5 most abundant plasma proteins adsorbed on mRNA/H 18 NPs (C3: Complement C3; Ighm: Immunoglobulin heavy constant mu; Hbat1: Alpha-globin; Itih4: Inter alpha-trypsin inhibitor, heavy chain 4; Cnn2: Calponin). (C) Heatmap plot of major proteins in the protein corona adsorbed on mRNA/MC3-LNPs and mRNA/H 18 NPs. PBS group was used as a negative control. (D) Quantification of major adsorbed protein categories of different formulations. (E) Complement C3 abundance in protein corona adsorbed on mRNA/MC3-LNPs and mRNA/H 18 NPs. (F) Bioluminescence images of major organs and (G) Quantification of total bioluminescence flux in the spleen from C57BL/6J mice 6 h after intravenous injection of mLuc/H 18 NPs (mLuc dose of 0.25 mg kg −1 ). Mice were pre-treated with cobra venom factor (CVF) or PBS. (H) Fluorescence quantification of Cy5 mRNA delivered by uncoated or complement C3-coated Cy5-mRNA/H 18 NPs in BMDCs. BMDCs were pre-incubated with anti-CD11b (CR3) or anti-IgG blocking antibody. (I) Bioluminescence intensity of luciferase protein translated from mRNA delivered by uncoated or complement C3-coated mLuc/H 18 NPs in BMDCs. BMDCs were pre-incubated with anti-CD11b (CR3) or anti-IgG blocking antibody. Data were shown as mean ± SD (n = 3).

    Journal: Bioactive Materials

    Article Title: Splenic dendritic cell-targeting mRNA transfection of H-type ionizable lipid-based LNPs for enhancing tumor immunotherapy

    doi: 10.1016/j.bioactmat.2026.02.018

    Figure Lengend Snippet: In vivo splenic DC-specific transfection of mRNA/H 18 NPs and in vitro protein corona analysis of mRNA/H 18 NPs. (A) EGFP protein expression in splenic cell subsets of C57BL/6J mice 24 h post intravenous injection of different formulations. (B) The top 5 most abundant plasma proteins adsorbed on mRNA/H 18 NPs (C3: Complement C3; Ighm: Immunoglobulin heavy constant mu; Hbat1: Alpha-globin; Itih4: Inter alpha-trypsin inhibitor, heavy chain 4; Cnn2: Calponin). (C) Heatmap plot of major proteins in the protein corona adsorbed on mRNA/MC3-LNPs and mRNA/H 18 NPs. PBS group was used as a negative control. (D) Quantification of major adsorbed protein categories of different formulations. (E) Complement C3 abundance in protein corona adsorbed on mRNA/MC3-LNPs and mRNA/H 18 NPs. (F) Bioluminescence images of major organs and (G) Quantification of total bioluminescence flux in the spleen from C57BL/6J mice 6 h after intravenous injection of mLuc/H 18 NPs (mLuc dose of 0.25 mg kg −1 ). Mice were pre-treated with cobra venom factor (CVF) or PBS. (H) Fluorescence quantification of Cy5 mRNA delivered by uncoated or complement C3-coated Cy5-mRNA/H 18 NPs in BMDCs. BMDCs were pre-incubated with anti-CD11b (CR3) or anti-IgG blocking antibody. (I) Bioluminescence intensity of luciferase protein translated from mRNA delivered by uncoated or complement C3-coated mLuc/H 18 NPs in BMDCs. BMDCs were pre-incubated with anti-CD11b (CR3) or anti-IgG blocking antibody. Data were shown as mean ± SD (n = 3).

    Article Snippet: Mouse Complement C3 was purchased from MedChemExpress.

    Techniques: In Vivo, Transfection, In Vitro, Expressing, Injection, Clinical Proteomics, Negative Control, Combined Bisulfite Restriction Analysis Assay, Fluorescence, Incubation, Blocking Assay, Luciferase

    C3 inhibitor AMY-101 inhibits the alternative but not classical pathway complement-mediated hemolysis in the second-generation hC3 rats in vitro. (A) The C3 inhibitor AMY-101 (0.3-20μM) was incubated with rabbit RBCs in the presence of 80% WT rat serum, or second-generation hC3 rat serum in Mg 2+ -EGTA buffer at 37°C for 30 minutes, then hemolysis was quantitated, showing that AMY-101 almost completely inhibited the second-generation hC3 rat alternative pathway-mediated hemolysis at a concentration as low as 2.5μM while did not affect the WT rat alternative pathway-mediated hemolysis at a concentration as high as 20μM. (B) The C3 inhibitor AMY-101 (0.3-10μM) were incubated with antibody-sensitized sheep RBCs in the presence of 10% second-generation hC3 rat serum in GVB ++ buffer at 37°C for 30 minutes, then hemolysis was quantitated, showing that AMY-101 did not have any effect on the second-generation hC3 rat classical pathway-mediated hemolysis at a concentration as high as 10μM. 2nd gen, second generation.

    Journal: Blood Vessels, Thrombosis & Hemostasis

    Article Title: A second generation of C3 humanized rats for preclinical evaluation of human C3 inhibitors

    doi: 10.1016/j.bvth.2026.100138

    Figure Lengend Snippet: C3 inhibitor AMY-101 inhibits the alternative but not classical pathway complement-mediated hemolysis in the second-generation hC3 rats in vitro. (A) The C3 inhibitor AMY-101 (0.3-20μM) was incubated with rabbit RBCs in the presence of 80% WT rat serum, or second-generation hC3 rat serum in Mg 2+ -EGTA buffer at 37°C for 30 minutes, then hemolysis was quantitated, showing that AMY-101 almost completely inhibited the second-generation hC3 rat alternative pathway-mediated hemolysis at a concentration as low as 2.5μM while did not affect the WT rat alternative pathway-mediated hemolysis at a concentration as high as 20μM. (B) The C3 inhibitor AMY-101 (0.3-10μM) were incubated with antibody-sensitized sheep RBCs in the presence of 10% second-generation hC3 rat serum in GVB ++ buffer at 37°C for 30 minutes, then hemolysis was quantitated, showing that AMY-101 did not have any effect on the second-generation hC3 rat classical pathway-mediated hemolysis at a concentration as high as 10μM. 2nd gen, second generation.

    Article Snippet: In these assays, human and rat C3 proteins were detected using a complement C3 polyclonal antibody (MP Biomedicals, catalog no. 0855117) and a secondary anti-goat immunoglobulin G (IgG) (heavy chain+light chain [H+L]) polyclonal antibody (SouthernBiotech, catalog no. 6160-05).

    Techniques: In Vitro, Incubation, Concentration Assay