Review





Similar Products

78c  (MedChemExpress)
94
MedChemExpress 78c
Enhanced CD38 ecto‐NADase activity in BMMs during skeletal aging impairs NMN availability to BMSCs. (a) qPCR analysis of Cd38 , Cdkn2a , Cdkn1a , Nos2 , Tnfα , IL1b , IL6 , Ym1 , Fizz1 , and Arg1 mRNA levels in bone marrow from 3‐ or 18‐month‐old WT and 18‐month‐old Sting ΔMφ mice ( n = 6 biological replicates). (b—d) Representative micro‐CT images (b) and quantitative analysis of BV/TV, Tb. N, Tb.Th, and Tb.Sp (c,d) from AAV9‐BMM‐shNC‐treated or AAV9‐BMM‐sh Cd38 ‐treated male mice ( n = 6 biological replicates). (e) WST‐8 analysis of NAD + levels in 3, 10, 18, and 24 M‐BMSCs ( n = 6 biological replicates). (f) WST‐8 analysis of NAD + levels in BMSCs under co‐culture conditions ( n = 6 biological replicates). (g) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice treated with PBS or <t>78c</t> from 16‐ to 18‐month‐old ( n = 6 biological replicates). (h) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice injected with AAV9 for BMM‐specific overexpression of WT or Δ49 mouse Cd38 ( n = 6 biological replicates). Data are shown as mean ± SD.
78c, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/CD38+inhibitor+1/pmc13669683-309-7-8
Average 94 stars, based on 1 article reviews
78c - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier
anti mouse cd38 pe vio770  (Miltenyi Biotec)
93
Miltenyi Biotec anti mouse cd38 pe vio770
Enhanced CD38 ecto‐NADase activity in BMMs during skeletal aging impairs NMN availability to BMSCs. (a) qPCR analysis of Cd38 , Cdkn2a , Cdkn1a , Nos2 , Tnfα , IL1b , IL6 , Ym1 , Fizz1 , and Arg1 mRNA levels in bone marrow from 3‐ or 18‐month‐old WT and 18‐month‐old Sting ΔMφ mice ( n = 6 biological replicates). (b—d) Representative micro‐CT images (b) and quantitative analysis of BV/TV, Tb. N, Tb.Th, and Tb.Sp (c,d) from AAV9‐BMM‐shNC‐treated or AAV9‐BMM‐sh Cd38 ‐treated male mice ( n = 6 biological replicates). (e) WST‐8 analysis of NAD + levels in 3, 10, 18, and 24 M‐BMSCs ( n = 6 biological replicates). (f) WST‐8 analysis of NAD + levels in BMSCs under co‐culture conditions ( n = 6 biological replicates). (g) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice treated with PBS or <t>78c</t> from 16‐ to 18‐month‐old ( n = 6 biological replicates). (h) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice injected with AAV9 for BMM‐specific overexpression of WT or Δ49 mouse Cd38 ( n = 6 biological replicates). Data are shown as mean ± SD.
Anti Mouse Cd38 Pe Vio770, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/CD38+Antibody%2C+anti-mouse/pmc13337242-96-3-7
Average 93 stars, based on 1 article reviews
anti mouse cd38 pe vio770 - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier
cd38 inhibitor 78c  (MedChemExpress)
94
MedChemExpress cd38 inhibitor 78c
Enhanced CD38 ecto‐NADase activity in BMMs during skeletal aging impairs NMN availability to BMSCs. (a) qPCR analysis of Cd38 , Cdkn2a , Cdkn1a , Nos2 , Tnfα , IL1b , IL6 , Ym1 , Fizz1 , and Arg1 mRNA levels in bone marrow from 3‐ or 18‐month‐old WT and 18‐month‐old Sting ΔMφ mice ( n = 6 biological replicates). (b—d) Representative micro‐CT images (b) and quantitative analysis of BV/TV, Tb. N, Tb.Th, and Tb.Sp (c,d) from AAV9‐BMM‐shNC‐treated or AAV9‐BMM‐sh Cd38 ‐treated male mice ( n = 6 biological replicates). (e) WST‐8 analysis of NAD + levels in 3, 10, 18, and 24 M‐BMSCs ( n = 6 biological replicates). (f) WST‐8 analysis of NAD + levels in BMSCs under co‐culture conditions ( n = 6 biological replicates). (g) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice treated with PBS or <t>78c</t> from 16‐ to 18‐month‐old ( n = 6 biological replicates). (h) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice injected with AAV9 for BMM‐specific overexpression of WT or Δ49 mouse Cd38 ( n = 6 biological replicates). Data are shown as mean ± SD.
Cd38 Inhibitor 78c, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/CD38+inhibitor+1/pm42814413-242-21-26
Average 94 stars, based on 1 article reviews
cd38 inhibitor 78c - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier
anti cd38 antibody  (MedChemExpress)
93
MedChemExpress anti cd38 antibody
Enhanced CD38 ecto‐NADase activity in BMMs during skeletal aging impairs NMN availability to BMSCs. (a) qPCR analysis of Cd38 , Cdkn2a , Cdkn1a , Nos2 , Tnfα , IL1b , IL6 , Ym1 , Fizz1 , and Arg1 mRNA levels in bone marrow from 3‐ or 18‐month‐old WT and 18‐month‐old Sting ΔMφ mice ( n = 6 biological replicates). (b—d) Representative micro‐CT images (b) and quantitative analysis of BV/TV, Tb. N, Tb.Th, and Tb.Sp (c,d) from AAV9‐BMM‐shNC‐treated or AAV9‐BMM‐sh Cd38 ‐treated male mice ( n = 6 biological replicates). (e) WST‐8 analysis of NAD + levels in 3, 10, 18, and 24 M‐BMSCs ( n = 6 biological replicates). (f) WST‐8 analysis of NAD + levels in BMSCs under co‐culture conditions ( n = 6 biological replicates). (g) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice treated with PBS or <t>78c</t> from 16‐ to 18‐month‐old ( n = 6 biological replicates). (h) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice injected with AAV9 for BMM‐specific overexpression of WT or Δ49 mouse Cd38 ( n = 6 biological replicates). Data are shown as mean ± SD.
Anti Cd38 Antibody, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/CD38+Antibody/pm42814413-313-4-7
Average 93 stars, based on 1 article reviews
anti cd38 antibody - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier
anti cd38 antibody  (Proteintech)
94
Proteintech anti cd38 antibody
Enhanced CD38 ecto‐NADase activity in BMMs during skeletal aging impairs NMN availability to BMSCs. (a) qPCR analysis of Cd38 , Cdkn2a , Cdkn1a , Nos2 , Tnfα , IL1b , IL6 , Ym1 , Fizz1 , and Arg1 mRNA levels in bone marrow from 3‐ or 18‐month‐old WT and 18‐month‐old Sting ΔMφ mice ( n = 6 biological replicates). (b—d) Representative micro‐CT images (b) and quantitative analysis of BV/TV, Tb. N, Tb.Th, and Tb.Sp (c,d) from AAV9‐BMM‐shNC‐treated or AAV9‐BMM‐sh Cd38 ‐treated male mice ( n = 6 biological replicates). (e) WST‐8 analysis of NAD + levels in 3, 10, 18, and 24 M‐BMSCs ( n = 6 biological replicates). (f) WST‐8 analysis of NAD + levels in BMSCs under co‐culture conditions ( n = 6 biological replicates). (g) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice treated with PBS or <t>78c</t> from 16‐ to 18‐month‐old ( n = 6 biological replicates). (h) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice injected with AAV9 for BMM‐specific overexpression of WT or Δ49 mouse Cd38 ( n = 6 biological replicates). Data are shown as mean ± SD.
Anti Cd38 Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/CD38+Antibody/pm42814413-315-14-17
Average 94 stars, based on 1 article reviews
anti cd38 antibody - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier
anti cd38  (Proteintech)
94
Proteintech anti cd38
Enhanced CD38 ecto‐NADase activity in BMMs during skeletal aging impairs NMN availability to BMSCs. (a) qPCR analysis of Cd38 , Cdkn2a , Cdkn1a , Nos2 , Tnfα , IL1b , IL6 , Ym1 , Fizz1 , and Arg1 mRNA levels in bone marrow from 3‐ or 18‐month‐old WT and 18‐month‐old Sting ΔMφ mice ( n = 6 biological replicates). (b—d) Representative micro‐CT images (b) and quantitative analysis of BV/TV, Tb. N, Tb.Th, and Tb.Sp (c,d) from AAV9‐BMM‐shNC‐treated or AAV9‐BMM‐sh Cd38 ‐treated male mice ( n = 6 biological replicates). (e) WST‐8 analysis of NAD + levels in 3, 10, 18, and 24 M‐BMSCs ( n = 6 biological replicates). (f) WST‐8 analysis of NAD + levels in BMSCs under co‐culture conditions ( n = 6 biological replicates). (g) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice treated with PBS or <t>78c</t> from 16‐ to 18‐month‐old ( n = 6 biological replicates). (h) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice injected with AAV9 for BMM‐specific overexpression of WT or Δ49 mouse Cd38 ( n = 6 biological replicates). Data are shown as mean ± SD.
Anti Cd38, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/CD38+Antibody/pm42775811-424-64-67
Average 94 stars, based on 1 article reviews
anti cd38 - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier
apc anti human cd38 antibody  (Elabscience Biotechnology)
93
Elabscience Biotechnology apc anti human cd38 antibody
Enhanced CD38 ecto‐NADase activity in BMMs during skeletal aging impairs NMN availability to BMSCs. (a) qPCR analysis of Cd38 , Cdkn2a , Cdkn1a , Nos2 , Tnfα , IL1b , IL6 , Ym1 , Fizz1 , and Arg1 mRNA levels in bone marrow from 3‐ or 18‐month‐old WT and 18‐month‐old Sting ΔMφ mice ( n = 6 biological replicates). (b—d) Representative micro‐CT images (b) and quantitative analysis of BV/TV, Tb. N, Tb.Th, and Tb.Sp (c,d) from AAV9‐BMM‐shNC‐treated or AAV9‐BMM‐sh Cd38 ‐treated male mice ( n = 6 biological replicates). (e) WST‐8 analysis of NAD + levels in 3, 10, 18, and 24 M‐BMSCs ( n = 6 biological replicates). (f) WST‐8 analysis of NAD + levels in BMSCs under co‐culture conditions ( n = 6 biological replicates). (g) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice treated with PBS or <t>78c</t> from 16‐ to 18‐month‐old ( n = 6 biological replicates). (h) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice injected with AAV9 for BMM‐specific overexpression of WT or Δ49 mouse Cd38 ( n = 6 biological replicates). Data are shown as mean ± SD.
Apc Anti Human Cd38 Antibody, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/APC+Anti-Human+CD38+Antibody/10__1007_slash_s00262___026___04553___2-119-53-57
Average 93 stars, based on 1 article reviews
apc anti human cd38 antibody - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier
ggtccaagtgatgctcaatggg  (OriGene)
94
OriGene ggtccaagtgatgctcaatggg
Enhanced CD38 ecto‐NADase activity in BMMs during skeletal aging impairs NMN availability to BMSCs. (a) qPCR analysis of Cd38 , Cdkn2a , Cdkn1a , Nos2 , Tnfα , IL1b , IL6 , Ym1 , Fizz1 , and Arg1 mRNA levels in bone marrow from 3‐ or 18‐month‐old WT and 18‐month‐old Sting ΔMφ mice ( n = 6 biological replicates). (b—d) Representative micro‐CT images (b) and quantitative analysis of BV/TV, Tb. N, Tb.Th, and Tb.Sp (c,d) from AAV9‐BMM‐shNC‐treated or AAV9‐BMM‐sh Cd38 ‐treated male mice ( n = 6 biological replicates). (e) WST‐8 analysis of NAD + levels in 3, 10, 18, and 24 M‐BMSCs ( n = 6 biological replicates). (f) WST‐8 analysis of NAD + levels in BMSCs under co‐culture conditions ( n = 6 biological replicates). (g) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice treated with PBS or <t>78c</t> from 16‐ to 18‐month‐old ( n = 6 biological replicates). (h) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice injected with AAV9 for BMM‐specific overexpression of WT or Δ49 mouse Cd38 ( n = 6 biological replicates). Data are shown as mean ± SD.
Ggtccaagtgatgctcaatggg, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/Cd38+Mouse+qPCR+Primer+Pair/pm42244013-162-8-13
Average 94 stars, based on 1 article reviews
ggtccaagtgatgctcaatggg - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier
daratumumab cd38  (Johnson & Johnson)
86
Johnson & Johnson daratumumab cd38
Enhanced CD38 ecto‐NADase activity in BMMs during skeletal aging impairs NMN availability to BMSCs. (a) qPCR analysis of Cd38 , Cdkn2a , Cdkn1a , Nos2 , Tnfα , IL1b , IL6 , Ym1 , Fizz1 , and Arg1 mRNA levels in bone marrow from 3‐ or 18‐month‐old WT and 18‐month‐old Sting ΔMφ mice ( n = 6 biological replicates). (b—d) Representative micro‐CT images (b) and quantitative analysis of BV/TV, Tb. N, Tb.Th, and Tb.Sp (c,d) from AAV9‐BMM‐shNC‐treated or AAV9‐BMM‐sh Cd38 ‐treated male mice ( n = 6 biological replicates). (e) WST‐8 analysis of NAD + levels in 3, 10, 18, and 24 M‐BMSCs ( n = 6 biological replicates). (f) WST‐8 analysis of NAD + levels in BMSCs under co‐culture conditions ( n = 6 biological replicates). (g) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice treated with PBS or <t>78c</t> from 16‐ to 18‐month‐old ( n = 6 biological replicates). (h) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice injected with AAV9 for BMM‐specific overexpression of WT or Δ49 mouse Cd38 ( n = 6 biological replicates). Data are shown as mean ± SD.
Daratumumab Cd38, supplied by Johnson & Johnson, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd38/cd38+daratumumab/pmc13059328-67-0-17
Average 86 stars, based on 1 article reviews
daratumumab cd38 - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

Image Search Results


Enhanced CD38 ecto‐NADase activity in BMMs during skeletal aging impairs NMN availability to BMSCs. (a) qPCR analysis of Cd38 , Cdkn2a , Cdkn1a , Nos2 , Tnfα , IL1b , IL6 , Ym1 , Fizz1 , and Arg1 mRNA levels in bone marrow from 3‐ or 18‐month‐old WT and 18‐month‐old Sting ΔMφ mice ( n = 6 biological replicates). (b—d) Representative micro‐CT images (b) and quantitative analysis of BV/TV, Tb. N, Tb.Th, and Tb.Sp (c,d) from AAV9‐BMM‐shNC‐treated or AAV9‐BMM‐sh Cd38 ‐treated male mice ( n = 6 biological replicates). (e) WST‐8 analysis of NAD + levels in 3, 10, 18, and 24 M‐BMSCs ( n = 6 biological replicates). (f) WST‐8 analysis of NAD + levels in BMSCs under co‐culture conditions ( n = 6 biological replicates). (g) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice treated with PBS or 78c from 16‐ to 18‐month‐old ( n = 6 biological replicates). (h) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice injected with AAV9 for BMM‐specific overexpression of WT or Δ49 mouse Cd38 ( n = 6 biological replicates). Data are shown as mean ± SD.

Journal: Advanced Science

Article Title: Bone Marrow Macrophage STING Signaling is a Direct Nexus Linking Marrow Adipose Expansion to NAD + Depletion and Osteogenic Decline in Skeletal Aging

doi: 10.1002/advs.77571

Figure Lengend Snippet: Enhanced CD38 ecto‐NADase activity in BMMs during skeletal aging impairs NMN availability to BMSCs. (a) qPCR analysis of Cd38 , Cdkn2a , Cdkn1a , Nos2 , Tnfα , IL1b , IL6 , Ym1 , Fizz1 , and Arg1 mRNA levels in bone marrow from 3‐ or 18‐month‐old WT and 18‐month‐old Sting ΔMφ mice ( n = 6 biological replicates). (b—d) Representative micro‐CT images (b) and quantitative analysis of BV/TV, Tb. N, Tb.Th, and Tb.Sp (c,d) from AAV9‐BMM‐shNC‐treated or AAV9‐BMM‐sh Cd38 ‐treated male mice ( n = 6 biological replicates). (e) WST‐8 analysis of NAD + levels in 3, 10, 18, and 24 M‐BMSCs ( n = 6 biological replicates). (f) WST‐8 analysis of NAD + levels in BMSCs under co‐culture conditions ( n = 6 biological replicates). (g) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice treated with PBS or 78c from 16‐ to 18‐month‐old ( n = 6 biological replicates). (h) WST‐8 analysis of NAD + levels in BMSCs from the bone marrow of mice injected with AAV9 for BMM‐specific overexpression of WT or Δ49 mouse Cd38 ( n = 6 biological replicates). Data are shown as mean ± SD.

Article Snippet: In parallel, 16‐month‐old male C57BL/6J mice received 78c (MedChemExpress, HY‐123999; 10 mg/kg) or PBS intraperitoneally 5 days per week for 8 weeks.

Techniques: Activity Assay, Analysis, Micro-CT, Co-culture Assay, Injection, Over Expression