|
Matrix Science
initial analysis used mascot protein identification software Initial Analysis Used Mascot Protein Identification Software, supplied by Matrix Science, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Protein+Analysis+Software/engine+mascot%E2%80%99%E2%80%99+search/pm42095258-79-0-7 Average 86 stars, based on 1 article reviews
initial analysis used mascot protein identification software - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
|
Bioedit Company
p protein domains bioedit software analysis P Protein Domains Bioedit Software Analysis, supplied by Bioedit Company, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Protein+Analysis+Software/analysis+bioedit+domains+p+protein+software/pm41812744-128-5-8 Average 86 stars, based on 1 article reviews
p protein domains bioedit software analysis - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
protein identification and quantitative analysis software proteome discoverertm Protein Identification And Quantitative Analysis Software Proteome Discoverertm, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Protein+Analysis+Software/protein+identification+and+quantitative+analysis+software+proteome+discoverertm/pm40649918-224-8-10 Average 90 stars, based on 1 article reviews
protein identification and quantitative analysis software proteome discoverertm - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
Roche
lightcycler 480 protein melting analysis software Lightcycler 480 Protein Melting Analysis Software, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Protein+Analysis+Software/LightCycler+480+System/pm40407321-286-11-10 Average 99 stars, based on 1 article reviews
lightcycler 480 protein melting analysis software - by Bioz Stars,
2026-11
99/100 stars
|
Buy from Supplier |
|
Thermo Fisher
protein thermal shift analysis software Protein Thermal Shift Analysis Software, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Protein+Analysis+Software/protein+thermal+shift+software/pm40089858-303-7-12 Average 90 stars, based on 1 article reviews
protein thermal shift analysis software - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
DNASTAR
protein sequences analysis software Protein Sequences Analysis Software, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Protein+Analysis+Software/protein+sequence+analysis/pm40031963-56-1-6 Average 90 stars, based on 1 article reviews
protein sequences analysis software - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
Bio-Rad
protein 1 wrnip1 tggtaaggtttgccagcgag ggccagaagcacctcacact densitometric analysis Protein 1 Wrnip1 Tggtaaggtttgccagcgag Ggccagaagcacctcacact Densitometric Analysis, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Protein+Analysis+Software/Image+Lab+Software/pm39799073-75-51-67 Average 99 stars, based on 1 article reviews
protein 1 wrnip1 tggtaaggtttgccagcgag ggccagaagcacctcacact densitometric analysis - by Bioz Stars,
2026-11
99/100 stars
|
Buy from Supplier |
|
Molecular Dynamics Inc
protein visualization and analysis software visualization molecular dynamics Protein Visualization And Analysis Software Visualization Molecular Dynamics, supplied by Molecular Dynamics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Protein+Analysis+Software/protein+visualization+and+analysis+software+visualization+molecular+dynamics/pmc11668583-155-28-34 Average 90 stars, based on 1 article reviews
protein visualization and analysis software visualization molecular dynamics - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
Taxon Biosciences
software for taxon-aware analysis of clustered protein sequences Software For Taxon Aware Analysis Of Clustered Protein Sequences, supplied by Taxon Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Protein+Analysis+Software/software+for+taxon+aware+analysis+of+clustered+protein+sequences/pm39277725-608-0-3 Average 90 stars, based on 1 article reviews
software for taxon-aware analysis of clustered protein sequences - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
Taxon Biosciences
kinfin: software for taxon-aware analysis of clustered protein sequences Kinfin: Software For Taxon Aware Analysis Of Clustered Protein Sequences, supplied by Taxon Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Protein+Analysis+Software/software+for+taxon+aware+analysis+of+clustered+protein+sequences/pm39109890-543-3-3 Average 90 stars, based on 1 article reviews
kinfin: software for taxon-aware analysis of clustered protein sequences - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |