Journal: PLoS ONE

Article Title: Ezh2 does not mediate retinal ganglion cell homeostasis or their susceptibility to injury

doi: 10.1371/journal.pone.0191853

Figure Lengend Snippet: Primer sequences for RT-PCR.

Article Snippet: To detect the Ezh2 floxed gene, one μl of genomic DNA from a mouse tail and primers for Ezh2 ( F: CTGCTCTGAATGGCAACTCC ; R: TTATTCATAGAGCCACCTGG ) were added to a mixture of solution containing Apex TaqDNA Polymerase (Cat. No. 42–409), Apex buffer, and MgCl 2 from Genesee Scientific (San Diego, CA), and dNTP (Cat. No. 10297–018; Invitrogen).

Techniques:

Journal: PLoS ONE

Article Title: Ezh2 does not mediate retinal ganglion cell homeostasis or their susceptibility to injury

doi: 10.1371/journal.pone.0191853

Figure Lengend Snippet: (A) PCR genotyping of Ezh2 and Cre genes. (B) Representative result of Western blot of Ezh2 expression in RGCs purified from P0 WT and mKO mice. GAPDH was used as a loading control. A strongly reduced level of Ezh2 was found in mKO RGCs as compared to WT RGCs. ( C) Epifluorescence images of retinal sections taken from P0 WT and mKO mice that were immunolabeled for H3K27me3 (red) and nuclear marker 4’,6-Diamidino-2-Phenylindole (DAPI; blue). Note the higher level of H3K27me3 signals in the mKO retina compared to WT retina. Scale bar: 50 μm.

Article Snippet: To detect the Ezh2 floxed gene, one μl of genomic DNA from a mouse tail and primers for Ezh2 ( F: CTGCTCTGAATGGCAACTCC ; R: TTATTCATAGAGCCACCTGG ) were added to a mixture of solution containing Apex TaqDNA Polymerase (Cat. No. 42–409), Apex buffer, and MgCl 2 from Genesee Scientific (San Diego, CA), and dNTP (Cat. No. 10297–018; Invitrogen).

Techniques: Western Blot, Expressing, Purification, Control, Immunolabeling, Marker

Journal: PLoS ONE

Article Title: Ezh2 does not mediate retinal ganglion cell homeostasis or their susceptibility to injury

doi: 10.1371/journal.pone.0191853

Figure Lengend Snippet: (A) Volcano plot showing fold changes (fc) of all genes detected from RGCs of mKO mice against control mice. Statistical significance (green dots) was defined as P <0.05 with a fold change ≥ +1.5 or ≤ -1.5 when compared to WT; non-significant changes (orange dots) fulfill either one or none of these two criteria. 997 genes were found with fc ≥ +1.5 and 1,220 genes with fc ≤ -1.5. Arrow points to the Ezh2 site. (B,C ) Pie charts represent depicted GO terms for upregulated (B) and downregulated (C) genes with │fc│ ≥ 1.5. No GO term in either up- or downregulated gene group were found to be specifically related to eye development. ( D) RT-PCR verification of mRNA levels of retinal related genes in RGCs purified from P5 floxed littermate control (white bar; n = 4) and mKO (black bar; n = 7) mouse pups. CRAL: Cellular retinaldehyde binding protein ; Tuj1: βIII-tubulin (Tubb3) ; Brn: Brn3a (Pou4f1) ; Rho: Rhodopsin ; Rec: Recoverin (* P < 0 . 05 by one-way ANOVA ).

Article Snippet: To detect the Ezh2 floxed gene, one μl of genomic DNA from a mouse tail and primers for Ezh2 ( F: CTGCTCTGAATGGCAACTCC ; R: TTATTCATAGAGCCACCTGG ) were added to a mixture of solution containing Apex TaqDNA Polymerase (Cat. No. 42–409), Apex buffer, and MgCl 2 from Genesee Scientific (San Diego, CA), and dNTP (Cat. No. 10297–018; Invitrogen).

Techniques: Control, Reverse Transcription Polymerase Chain Reaction, Purification, Binding Assay

Journal: STAR Protocols

Article Title: Protocol for isolation and proteostatic analysis of sub-populations of spermatogenic cells in mouse

doi: 10.1016/j.xpro.2022.101398

Figure Lengend Snippet:

Article Snippet: Taq DNA polymerase , TIANGEN , Cat#ET101.

Techniques: Recombinant, Reverse Transcription, Saline, Protease Inhibitor, Purification, Bicinchoninic Acid Protein Assay, Software, Laser-Scanning Microscopy, Microscopy, Imaging, Membrane, Cell Culture