pcr mixture Search Results


96
TaKaRa terratm pcr direct polymerase mix
Terratm Pcr Direct Polymerase Mix, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/terratm pcr direct polymerase mix/product/TaKaRa
Average 96 stars, based on 1 article reviews
terratm pcr direct polymerase mix - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

96
PCR Biosystems Ltd qpcrbio probe mix hirox
Qpcrbio Probe Mix Hirox, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qpcrbio probe mix hirox/product/PCR Biosystems Ltd
Average 96 stars, based on 1 article reviews
qpcrbio probe mix hirox - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

93
TaKaRa matchmaker tm insert check pcr mix 2
Matchmaker Tm Insert Check Pcr Mix 2, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/matchmaker tm insert check pcr mix 2/product/TaKaRa
Average 93 stars, based on 1 article reviews
matchmaker tm insert check pcr mix 2 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

96
Bio-Rad master mix
Master Mix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/master mix/product/Bio-Rad
Average 96 stars, based on 1 article reviews
master mix - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

97
PCR Biosystems Ltd sygreen blue mix hi rox
Sygreen Blue Mix Hi Rox, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sygreen blue mix hi rox/product/PCR Biosystems Ltd
Average 97 stars, based on 1 article reviews
sygreen blue mix hi rox - by Bioz Stars, 2026-04
97/100 stars
  Buy from Supplier

97
PCR Biosystems Ltd qpcrbio sygreen mix
Qpcrbio Sygreen Mix, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qpcrbio sygreen mix/product/PCR Biosystems Ltd
Average 97 stars, based on 1 article reviews
qpcrbio sygreen mix - by Bioz Stars, 2026-04
97/100 stars
  Buy from Supplier

94
PCR Biosystems Ltd qpcr bio probe blue mix

Qpcr Bio Probe Blue Mix, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qpcr bio probe blue mix/product/PCR Biosystems Ltd
Average 94 stars, based on 1 article reviews
qpcr bio probe blue mix - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

96
TaKaRa matchmaker insert check pcr mix 1

Matchmaker Insert Check Pcr Mix 1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/matchmaker insert check pcr mix 1/product/TaKaRa
Average 96 stars, based on 1 article reviews
matchmaker insert check pcr mix 1 - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

95
Integrated DNA Technologies human hprt pcr primer mix
Specific commercial products and services available to the researchers to implement CRISPR technology.
Human Hprt Pcr Primer Mix, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human hprt pcr primer mix/product/Integrated DNA Technologies
Average 95 stars, based on 1 article reviews
human hprt pcr primer mix - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

95
PCR Biosystems Ltd pcr amplification by2x pcrbio hs taq mix red
Specific commercial products and services available to the researchers to implement CRISPR technology.
Pcr Amplification By2x Pcrbio Hs Taq Mix Red, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr amplification by2x pcrbio hs taq mix red/product/PCR Biosystems Ltd
Average 95 stars, based on 1 article reviews
pcr amplification by2x pcrbio hs taq mix red - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

95
Bio-Rad pcr tube strips
Specific commercial products and services available to the researchers to implement CRISPR technology.
Pcr Tube Strips, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr tube strips/product/Bio-Rad
Average 95 stars, based on 1 article reviews
pcr tube strips - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

92
101Bio 1 drop pcr master mix
Specific commercial products and services available to the researchers to implement CRISPR technology.
1 Drop Pcr Master Mix, supplied by 101Bio, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1 drop pcr master mix/product/101Bio
Average 92 stars, based on 1 article reviews
1 drop pcr master mix - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

Image Search Results


Journal: iScience

Article Title: SNAP23 regulates KCC2 membrane insertion and activity following mZnR/GPR39 activation in hippocampalneurons

doi: 10.1016/j.isci.2022.103751

Figure Lengend Snippet:

Article Snippet: SNAP23: forward primer- GCCACAGCATTTGTTGAGTTC reverse primer- GCAGGAATC AAGACCATCACT probe ACCGCATAGAAGAAGGCTTGGACC primer, Actin: forward primer ACAGAGCCTCGCCTTTG, reverse primer CCTTGCACATGC CGGAG, probe TCATCCATGGTGAGCTGGCGG. qPCR assay was performed using qPCR bio probe blue mix (pb20.25–05, PCR biosystem).

Techniques: Recombinant, Modification, Protease Inhibitor, Blocking Assay, Mutagenesis, In Situ

Specific commercial products and services available to the researchers to implement CRISPR technology.

Journal: Frontiers in Plant Science

Article Title: CRISPR-Cas9: Tool for Qualitative and Quantitative Plant Genome Editing

doi: 10.3389/fpls.2016.01740

Figure Lengend Snippet: Specific commercial products and services available to the researchers to implement CRISPR technology.

Article Snippet: Integrated DNA technologies (IDT) , Human HPRT PCR Primer Mix, Mouse HPRT PCR Primer Mix, Nuclease Free Duplex Buffer , S.p. Cas9 Expression Plasmid , S.p. Cas9 Nuclease 3NLS (100, 500 μg) , CRISPR Negative Control crRNA, CRISPR Positive Control crRNA.

Techniques: CRISPR, Genome Wide, Clone Assay, Stable Transfection, Selection, Transfection, Plasmid Preparation, Mutagenesis, Expressing, Negative Control, Positive Control, Construct, Knock-In, Multiplex Assay, Amplification, Sequencing