|
TaKaRa
terratm pcr direct polymerase mix Terratm Pcr Direct Polymerase Mix, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/terratm pcr direct polymerase mix/product/TaKaRa Average 96 stars, based on 1 article reviews
terratm pcr direct polymerase mix - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
PCR Biosystems Ltd
qpcrbio probe mix hirox Qpcrbio Probe Mix Hirox, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/qpcrbio probe mix hirox/product/PCR Biosystems Ltd Average 96 stars, based on 1 article reviews
qpcrbio probe mix hirox - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
TaKaRa
matchmaker tm insert check pcr mix 2 Matchmaker Tm Insert Check Pcr Mix 2, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/matchmaker tm insert check pcr mix 2/product/TaKaRa Average 93 stars, based on 1 article reviews
matchmaker tm insert check pcr mix 2 - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Bio-Rad
master mix Master Mix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/master mix/product/Bio-Rad Average 96 stars, based on 1 article reviews
master mix - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
PCR Biosystems Ltd
sygreen blue mix hi rox Sygreen Blue Mix Hi Rox, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sygreen blue mix hi rox/product/PCR Biosystems Ltd Average 97 stars, based on 1 article reviews
sygreen blue mix hi rox - by Bioz Stars,
2026-04
97/100 stars
|
Buy from Supplier |
|
PCR Biosystems Ltd
qpcrbio sygreen mix Qpcrbio Sygreen Mix, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/qpcrbio sygreen mix/product/PCR Biosystems Ltd Average 97 stars, based on 1 article reviews
qpcrbio sygreen mix - by Bioz Stars,
2026-04
97/100 stars
|
Buy from Supplier |
|
PCR Biosystems Ltd
qpcr bio probe blue mix ![]() Qpcr Bio Probe Blue Mix, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/qpcr bio probe blue mix/product/PCR Biosystems Ltd Average 94 stars, based on 1 article reviews
qpcr bio probe blue mix - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
|
TaKaRa
matchmaker insert check pcr mix 1 ![]() Matchmaker Insert Check Pcr Mix 1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/matchmaker insert check pcr mix 1/product/TaKaRa Average 96 stars, based on 1 article reviews
matchmaker insert check pcr mix 1 - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Integrated DNA Technologies
human hprt pcr primer mix ![]() Human Hprt Pcr Primer Mix, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human hprt pcr primer mix/product/Integrated DNA Technologies Average 95 stars, based on 1 article reviews
human hprt pcr primer mix - by Bioz Stars,
2026-04
95/100 stars
|
Buy from Supplier |
|
PCR Biosystems Ltd
pcr amplification by2x pcrbio hs taq mix red ![]() Pcr Amplification By2x Pcrbio Hs Taq Mix Red, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcr amplification by2x pcrbio hs taq mix red/product/PCR Biosystems Ltd Average 95 stars, based on 1 article reviews
pcr amplification by2x pcrbio hs taq mix red - by Bioz Stars,
2026-04
95/100 stars
|
Buy from Supplier |
|
Bio-Rad
pcr tube strips ![]() Pcr Tube Strips, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcr tube strips/product/Bio-Rad Average 95 stars, based on 1 article reviews
pcr tube strips - by Bioz Stars,
2026-04
95/100 stars
|
Buy from Supplier |
|
101Bio
1 drop pcr master mix ![]() 1 Drop Pcr Master Mix, supplied by 101Bio, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/1 drop pcr master mix/product/101Bio Average 92 stars, based on 1 article reviews
1 drop pcr master mix - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
Image Search Results
Journal: iScience
Article Title: SNAP23 regulates KCC2 membrane insertion and activity following mZnR/GPR39 activation in hippocampalneurons
doi: 10.1016/j.isci.2022.103751
Figure Lengend Snippet:
Article Snippet: SNAP23: forward primer- GCCACAGCATTTGTTGAGTTC reverse primer- GCAGGAATC AAGACCATCACT probe ACCGCATAGAAGAAGGCTTGGACC primer, Actin: forward primer ACAGAGCCTCGCCTTTG, reverse primer CCTTGCACATGC CGGAG, probe TCATCCATGGTGAGCTGGCGG. qPCR assay was performed using
Techniques: Recombinant, Modification, Protease Inhibitor, Blocking Assay, Mutagenesis, In Situ
Journal: Frontiers in Plant Science
Article Title: CRISPR-Cas9: Tool for Qualitative and Quantitative Plant Genome Editing
doi: 10.3389/fpls.2016.01740
Figure Lengend Snippet: Specific commercial products and services available to the researchers to implement CRISPR technology.
Article Snippet:
Techniques: CRISPR, Genome Wide, Clone Assay, Stable Transfection, Selection, Transfection, Plasmid Preparation, Mutagenesis, Expressing, Negative Control, Positive Control, Construct, Knock-In, Multiplex Assay, Amplification, Sequencing