βactin Search Results


92
Addgene inc bact
Bact, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bact/product/Addgene inc
Average 92 stars, based on 1 article reviews
bact - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

90
CMCTAG Inc anti-actin
Anti Actin, supplied by CMCTAG Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-actin/product/CMCTAG Inc
Average 90 stars, based on 1 article reviews
anti-actin - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Merck & Co anti-βactin
Anti βactin, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-βactin/product/Merck & Co
Average 90 stars, based on 1 article reviews
anti-βactin - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Merck & Co ßactin
ßactin, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ßactin/product/Merck & Co
Average 90 stars, based on 1 article reviews
ßactin - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
FineTest Biotech Inc β-actin fnab00872 antibody
β Actin Fnab00872 Antibody, supplied by FineTest Biotech Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/β-actin fnab00872 antibody/product/FineTest Biotech Inc
Average 90 stars, based on 1 article reviews
β-actin fnab00872 antibody - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
ImmunoWay Biotechnology Company anti-β-actin mouse polyclonal antibody
Anti β Actin Mouse Polyclonal Antibody, supplied by ImmunoWay Biotechnology Company, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-β-actin mouse polyclonal antibody/product/ImmunoWay Biotechnology Company
Average 90 stars, based on 1 article reviews
anti-β-actin mouse polyclonal antibody - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Oligos Etc primers for il-21, -23 and -27 genes and also, βactin, as an internal control
Primers For Il 21, 23 And 27 Genes And Also, βactin, As An Internal Control, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers for il-21, -23 and -27 genes and also, βactin, as an internal control/product/Oligos Etc
Average 90 stars, based on 1 article reviews
primers for il-21, -23 and -27 genes and also, βactin, as an internal control - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Merck KGaA anti-βactin, clone 4c2
Anti βactin, Clone 4c2, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-βactin, clone 4c2/product/Merck KGaA
Average 90 stars, based on 1 article reviews
anti-βactin, clone 4c2 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Tanabe cmv-βactin promoter
Cmv βactin Promoter, supplied by Tanabe, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cmv-βactin promoter/product/Tanabe
Average 90 stars, based on 1 article reviews
cmv-βactin promoter - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Affinity Biosciences primary antibodies for β-actin
Primary Antibodies For β Actin, supplied by Affinity Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primary antibodies for β-actin/product/Affinity Biosciences
Average 90 stars, based on 1 article reviews
primary antibodies for β-actin - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
SuperArray Bioscience Corporation βactin superarray commercial q-pcr primers
Role of Tif-1γ/Smad4-independent signaling in the control of iNKT maturation. (A) tgf-b receptor expression analysis by RT-PCR performed on purified CD1d-αGalCer thymocytes from 16-d-old C57BL/6 mice. Relative gene expression are normalized on both hprt and g3pdh expression. (B) Flow cytometric analysis of CD1d-αGalCer tetramer + cells from iNKT cell-enriched thymocytes of C57BL/6 mice, stained for TGF-βRII. Means of fluorescence intensity (MFI) are reported with their SD. (C) jun-b , p21 , pme-pai expression analysis by RT-PCR performed on purified CD1d-αGalCer thymocytes from C57BL/6 mice. Relative gene expression was normalized on <t>βactin</t> expression. The results are representative of three different experiments from five to eight mice. (D) Flow cytometric analysis of the presence of iNKT cells in thymuses from either 13–14-d-old CD4-Cre x Tif-1γ fl/fl x Smad4 fl/fl mice or wild-type littermate mice and staining for CD44 and NK1.1 on CD1d-αGalCer tetramer + cells from the same thymuses. Absolute numbers of CD1d-αGalCer tetramer + cells among HSA low cells are illustrated by graphs, and absolute numbers for each development stage are illustrated in Table S1. The results are representative of three different experiments with at least three mice per group.
βactin Superarray Commercial Q Pcr Primers, supplied by SuperArray Bioscience Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/βactin superarray commercial q-pcr primers/product/SuperArray Bioscience Corporation
Average 90 stars, based on 1 article reviews
βactin superarray commercial q-pcr primers - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Fisher Scientific forward primer of βactin rt-pcr

Forward Primer Of βactin Rt Pcr, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer of βactin rt-pcr/product/Fisher Scientific
Average 90 stars, based on 1 article reviews
forward primer of βactin rt-pcr - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


Role of Tif-1γ/Smad4-independent signaling in the control of iNKT maturation. (A) tgf-b receptor expression analysis by RT-PCR performed on purified CD1d-αGalCer thymocytes from 16-d-old C57BL/6 mice. Relative gene expression are normalized on both hprt and g3pdh expression. (B) Flow cytometric analysis of CD1d-αGalCer tetramer + cells from iNKT cell-enriched thymocytes of C57BL/6 mice, stained for TGF-βRII. Means of fluorescence intensity (MFI) are reported with their SD. (C) jun-b , p21 , pme-pai expression analysis by RT-PCR performed on purified CD1d-αGalCer thymocytes from C57BL/6 mice. Relative gene expression was normalized on βactin expression. The results are representative of three different experiments from five to eight mice. (D) Flow cytometric analysis of the presence of iNKT cells in thymuses from either 13–14-d-old CD4-Cre x Tif-1γ fl/fl x Smad4 fl/fl mice or wild-type littermate mice and staining for CD44 and NK1.1 on CD1d-αGalCer tetramer + cells from the same thymuses. Absolute numbers of CD1d-αGalCer tetramer + cells among HSA low cells are illustrated by graphs, and absolute numbers for each development stage are illustrated in Table S1. The results are representative of three different experiments with at least three mice per group.

Journal: The Journal of Experimental Medicine

Article Title: iNKT cell development is orchestrated by different branches of TGF-β signaling

doi: 10.1084/jem.20090127

Figure Lengend Snippet: Role of Tif-1γ/Smad4-independent signaling in the control of iNKT maturation. (A) tgf-b receptor expression analysis by RT-PCR performed on purified CD1d-αGalCer thymocytes from 16-d-old C57BL/6 mice. Relative gene expression are normalized on both hprt and g3pdh expression. (B) Flow cytometric analysis of CD1d-αGalCer tetramer + cells from iNKT cell-enriched thymocytes of C57BL/6 mice, stained for TGF-βRII. Means of fluorescence intensity (MFI) are reported with their SD. (C) jun-b , p21 , pme-pai expression analysis by RT-PCR performed on purified CD1d-αGalCer thymocytes from C57BL/6 mice. Relative gene expression was normalized on βactin expression. The results are representative of three different experiments from five to eight mice. (D) Flow cytometric analysis of the presence of iNKT cells in thymuses from either 13–14-d-old CD4-Cre x Tif-1γ fl/fl x Smad4 fl/fl mice or wild-type littermate mice and staining for CD44 and NK1.1 on CD1d-αGalCer tetramer + cells from the same thymuses. Absolute numbers of CD1d-αGalCer tetramer + cells among HSA low cells are illustrated by graphs, and absolute numbers for each development stage are illustrated in Table S1. The results are representative of three different experiments with at least three mice per group.

Article Snippet: The primers used are as follows: hprt , 5′-TCATTATGCCGAGGATTTGGA-3′ and 5′-CAGAGGGCCACAATGTGATG-3′; g3pdh , 5′-GCATGGCCTTCCGTGTCC-3′ and 5′-TGTCATCATACTTGGCAGGTTTCT-3′; tgfβRI , 5′-CAGACGAAGCAGACTGGACCAG-3′ and 5′-TGCTGCAATCAGGACCACTGC-3′; tgfβRII , 5′-GAAGAATACACCACCAGCAGTC-3′ ανδ 5′-ATGATGACAGCTATGGCAATCC-3′; p38 , 5′-ACCTAAAGCCCAGCAACCTAGC-3′ and 5′-GGTAGCCACGTAGCCTGTCATC-3′; mek1 , 5′-AACTGGGAGCTGGCAACGG-3′ and 5′-TGCGGGTTTGATCTCCAGGTG-3′; erk , 5′-GCTGACTCCAAAGCTCTGGATTTAC-3′ and 5′-CTCCTTAGGTAAGTCGTCCAACTCC-3′; p21 , 5′-TTGCACTCTGGTGTCTGAGC-3′ and 5′-GGGCACTTCAGGGTTTTCTC-3′; junB , 5′-GACGACCTGCACAAGATGAA-3′ and 5′-TGCTGAGGTTGGTGTAGACG-3′; pmepai , 5′-CAGGAGGAGAGACGATGGAC-3′ and 5′-AGGTAGGGGTAGGTGGGTTG-3′; and βactin SuperArray commercial Q-PCR primers.

Techniques: Control, Expressing, Reverse Transcription Polymerase Chain Reaction, Purification, Gene Expression, Staining, Fluorescence

Journal: eLife

Article Title: Keratins and plakin family cytolinker proteins control the length of epithelial microridge protrusions

doi: 10.7554/eLife.58149

Figure Lengend Snippet:

Article Snippet: Sequence-based reagent , Forward primer of Epl RT-PCR , Fisher Scientific , , 5’- CGTCAGCATGGTCGACCATC -3’.

Techniques: Mutagenesis, Recombinant, Sequencing, Homologous Recombination, Plasmid Preparation, Software, Microscopy