Journal: The Journal of Biological Chemistry

Article Title: RNA-binding protein tristetraprolin inhibits Th2 cell activation and differentiation in allergic rhinitis by promoting TRIM18 mRNA decay

doi: 10.1016/j.jbc.2026.111240

Figure Lengend Snippet: The highly expressed TTP was identified as a crucial factor in response to the IgE-mediated inflammatory syndrome. A , the robust rank aggregation (RRA) algorithm integrated upregulated genes (Log 2 Foldchange>1 and p < 0.05) from three datasets of three IgE-mediated inflammatory syndromes (allergic rhinitis, asthma, and atopic dermatitis) and their corresponding normal samples. B , the ranking graph displayed the genes that were upregulated in at least two datasets. Among them, the genes corresponding to the red dots (Frequency = 3) showed a significant increase in all three disease datasets, including TTP. C , intersection of the genes encoding CCCH-ZF (zinc finger)-type proteins with the genes upregulated in the nasal mucosa of patients with allergic rhinitis. D , the assessment of evolutionary conservation of amino acid positions, especially two CCCH-ZF repeat regions, in the mouse TTP protein. Conservation scores ranged from 1 to 9, where one was the most highly variable, five was of intermediate conservation, and nine was the most highly conserved position. E , experimental scheme of ragweed pollen (RW)-induced AR model, divided into the sensitization stage (0 and 7 days) and the stimulation stage (14–17 days). The control mice were treated with PBS instead of RW (N = 6 per group). F , relative RNA expressions of TTP in nasal tissues of RW-induced AR mice and control mice. G , compare the frequencies of sneezing and nose-rubbing within 10 min between control mice and AR mice after 14 days. H , immunofluorescence staining of TTP protein ( red ) and CD4 protein ( green ) was performed in normal and RW nasal tissues. DAPI ( blue ) was used for nuclear staining (Scale bar = 50 μm). I , quantitative analyses of CD4 + T cell percentages and TTP fluorescence intensity in nasal mucosal tissues from sham and AR model mice. Data are shown as means ± SD (N = 6), Student's t test was used for statistical analysis of control mice and AR mice.

Article Snippet: Then, the sections were co-incubated with antibodies against TTP (1:100 dilution, Proteintech, Cat No.66938-1-Ig) and CD4 (1:50 dilution, Abclonal, Cat No.A0363) overnight at 4 °C.

Techniques: Control, Immunofluorescence, Staining, Fluorescence

Journal: The Journal of Biological Chemistry

Article Title: RNA-binding protein tristetraprolin inhibits Th2 cell activation and differentiation in allergic rhinitis by promoting TRIM18 mRNA decay

doi: 10.1016/j.jbc.2026.111240

Figure Lengend Snippet: TTP suppressed T helper 2 (Th2)-type inflammation in AR mice. A , schematics of splenocytes isolation from AR-mice and the differentiation of splenic naive CD4+ T cells model in vitro . B , the levels of Interleukin (IL)-4, IL-5, and IL-13, which belong to the Th2 cytokine family, were measured by ELISA assays in the cell supernatant. The cell supernatant was collected from mononuclear cells of the spleen that had been treated with ionomycin and phorbol 12-myristate 13-acetate (PMA) for 6 h. C , after treatment with ionomycin, PMA, and GolgiPlug, the cells with the double stain of anti-CD4 and anti-IL-4-APC were detected by flow cytometry to analyze the percentage of Th2 cells. Data are shown as means ± SD (N = 3 or 6). One-way analysis of variance (ANOVA) was used for statistical analysis of control mice, AR mice, and AR mice transduced with control vectors or TTP overexpression vectors.

Article Snippet: Then, the sections were co-incubated with antibodies against TTP (1:100 dilution, Proteintech, Cat No.66938-1-Ig) and CD4 (1:50 dilution, Abclonal, Cat No.A0363) overnight at 4 °C.

Techniques: Isolation, In Vitro, Enzyme-linked Immunosorbent Assay, Staining, Flow Cytometry, Control, Transduction, Over Expression

Journal: The Journal of Biological Chemistry

Article Title: RNA-binding protein tristetraprolin inhibits Th2 cell activation and differentiation in allergic rhinitis by promoting TRIM18 mRNA decay

doi: 10.1016/j.jbc.2026.111240

Figure Lengend Snippet: TTP overexpression inhibited Th2 differentiation in vitro . A , schematics of naive CD4+ isolation, activation, and Th2 differentiation. B , a representative flow cytometric plot and the percentage of Th2 cells was detected using flow cytometry. C , the protein and mRNA expression of TTP in CD4+ T cells. D , the protein and mRNA expression of TTP in Th2 cells after virus infection. E , the levels of IL-5 were detected using real-time PCR and ELISA, respectively, in Th2 cells after virus infection. F , the percentage of Th2 cells was detected using flow cytometry in Th2 cells after virus infection. Data are shown as means ± SD (N = 3). Student's t test and one-way ANOVA were used for statistical analysis.

Article Snippet: Then, the sections were co-incubated with antibodies against TTP (1:100 dilution, Proteintech, Cat No.66938-1-Ig) and CD4 (1:50 dilution, Abclonal, Cat No.A0363) overnight at 4 °C.

Techniques: Over Expression, In Vitro, Isolation, Activation Assay, Flow Cytometry, Expressing, Virus, Infection, Real-time Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay

Journal: The Journal of Biological Chemistry

Article Title: RNA-binding protein tristetraprolin inhibits Th2 cell activation and differentiation in allergic rhinitis by promoting TRIM18 mRNA decay

doi: 10.1016/j.jbc.2026.111240

Figure Lengend Snippet: TTP knockdown exacerbated allergic phenotypes and promoted Th2-type inflammation in AR mice. A , experimental scheme of RW-induced AR mice with or without TTP knockdown via intravenous injection of lentiviral vectors (Lv-shNC or Lv-shTTP). B , expression of TTP mRNA in AR mice with or without TTP knockdown. C , immunofluorescence staining for TTP protein ( red ) and CD4 protein ( green ) in normal and RW-exposed nasal tissues. DAPI ( blue ) was used for nuclear staining (Scale bar = 50 μm). D , quantitative analysis of TTP fluorescence intensity in nasal mucosal tissues from lentivirus-injected mice. E , hematoxylin-eosin (H&E)-stained nasal mucosal tissue sections, showing nasal mucosa thickness (Scale bar = 100 μm). Dashed lines indicate the boundary between the epithelial layer and lamina propria. F and G , changes in the number of sneezes and nasal rubbings after TTP knockdown in AR mice. H , schematic of splenocyte isolation from AR mice and in vitro treatment. I – K , Levels of IL-4, IL-5, and IL-13 in the cell culture supernatant of splenocytes treated with ionomycin and PMA for 6 h. Data are presented as means ± SD (N = 3 or 6). Student's t test was used for statistical analysis of AR mice transduced with shNC or shTTP.

Article Snippet: Then, the sections were co-incubated with antibodies against TTP (1:100 dilution, Proteintech, Cat No.66938-1-Ig) and CD4 (1:50 dilution, Abclonal, Cat No.A0363) overnight at 4 °C.

Techniques: Knockdown, Injection, Expressing, Immunofluorescence, Staining, Fluorescence, Isolation, In Vitro, Cell Culture, Transduction

Journal: The Journal of Biological Chemistry

Article Title: RNA-binding protein tristetraprolin inhibits Th2 cell activation and differentiation in allergic rhinitis by promoting TRIM18 mRNA decay

doi: 10.1016/j.jbc.2026.111240

Figure Lengend Snippet: Transcriptional profiles of CD4+ T cell isolated from AR mouse spleen reveal categories of genes associated with TTP. A , RNA transcriptome microarray analysis of CD4+ T cell isolated from mouse. B , a volcano plot of all DEGs between CD4+ T cells isolated from LV-TTP and LV-Vector infected AR mouse. C , GSEA analysis identified significant enrichment of signaling pathways based on KEGG and GO analysis following TTP overexpression. D , KEGG pathway enrichment and GO functional classification analysis of DEGs. Data are shown as means ± SD (N = 3).

Article Snippet: Then, the sections were co-incubated with antibodies against TTP (1:100 dilution, Proteintech, Cat No.66938-1-Ig) and CD4 (1:50 dilution, Abclonal, Cat No.A0363) overnight at 4 °C.

Techniques: Isolation, Microarray, Plasmid Preparation, Infection, Protein-Protein interactions, Over Expression, Functional Assay

Journal: The Journal of Biological Chemistry

Article Title: RNA-binding protein tristetraprolin inhibits Th2 cell activation and differentiation in allergic rhinitis by promoting TRIM18 mRNA decay

doi: 10.1016/j.jbc.2026.111240

Figure Lengend Snippet: The TTP protein acted as a negative regulator of TRIM18-mediated Th2-type inflammation by reducing TRIM18 mRNA stability. A , protein–protein interaction network of 16 potential substrates of E3 ubiquitin ligase TRIM18, constructed using the STRING database and supplemented with functional annotations via GO (Gene Ontology) pathway enrichment analyses, highlighting key biological processes and signaling pathways associated with these substrates. B and C , the qRT-PCR and ELISA were performed to detect the mRNA level and secreted protein concentration of IL-5, respectively, in naive CD4+ T cells or in vitro differentiated Th2 cells transfected with TRIM18 overexpression vector or empty vector. D , schematic diagram of the experimental workflow: Naive CD4+ T cells were induced to differentiate into Th2 cells under in vitro and were co-transfected with combinations of TTP overexpression vector, TRIM18 overexpression vector, or corresponding empty vectors. E , the mRNA level of TRIM18 in differentiated Th2 cells from the three groups (Control, TTP-OE, TTP+TRIM18-OE) was detected by qRT-PCR assays. F and G , The mRNA level and secreted protein concentration of IL-5 were measured by qRT-PCR and ELISA, respectively, in differentiated Th2 cells from the three groups (Control, TTP-OE, TTP+TRIM18-OE). H , flow cytometric analysis of the percentage of CD4+IL-4+ Th2 cells among the three groups after in vitro differentiation, and the proportion of double-positive cells was quantified to assess the impact of TTP and/or TRIM18 overexpression on Th2 cell differentiation. Data are shown as means ± SD (N = 3), One-way ANOVA was used for statistical analysis.

Article Snippet: Then, the sections were co-incubated with antibodies against TTP (1:100 dilution, Proteintech, Cat No.66938-1-Ig) and CD4 (1:50 dilution, Abclonal, Cat No.A0363) overnight at 4 °C.

Techniques: Ubiquitin Proteomics, Construct, Functional Assay, Protein-Protein interactions, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Protein Concentration, In Vitro, Transfection, Over Expression, Plasmid Preparation, Control, Cell Differentiation

Journal: Research

Article Title: ZFP36 Protects against Abdominal Aortic Aneurysm Formation by Regulating Vascular Smooth Muscle Phenotypic Switch

doi: 10.34133/research.1078

Figure Lengend Snippet: ZFP36 is down-regulated during AAA progression. (A and B) Relative mRNA expression of RNA-binding proteins among DEGs in the microarray dataset ( GSE47472 ). The data were log2-transformed. The log2 FC and P values were calculated, and multiple testing using the Benjamini–Hochberg method was applied to adjust the P values. With a Benjamini–Hochberg-adjusted P < 0.05 and |log2FC| ≥ 1 as the criteria. (C) RT-qPCR validation of the top 3 up-regulated genes and the top 3 down-regulated genes in (B) between murine normal aorta and AAA ( n = 6 per group). Statistical comparisons were performed using unpaired t tests. The false discovery rate (FDR) was controlled for multiple comparisons using the 2-stage step-up method of Benjamini, Krieger, and Yekutieli. (D) Representative images of ZFP36 expression by IF staining of human AAA and normal aorta sections and quantification of fluorescence intensity. Scale bar indicates 50 μm ( n = 6 per group). (E) Protein levels of ZFP36 in murine normal aorta and AAA ( n = 6 per group). (F) Relative mRNA level of Zfp36 in murine normal aorta and AAA ( n = 6 per group). (G) Representative images of ZFP36 expression by IF staining of mouse AAA and normal aorta sections and quantification of fluorescence intensity. Scale bar indicates 50 μm ( n = 6 per group). (H and I) Protein levels and relative mRNA level of Zfp36 of ZFP36 in VSMCs treated with PBS or AngII (1 μM) for 48 h ( n = 6 per group). (J) Representative images of ZFP36 expression by IF staining of mouse VSMCs treated with PBS or AngII (1 μM) for 48 h and quantification of fluorescence intensity ( n = 6 per group). Scale bar indicates 20 μm. Statistical analyses of (D) to (J) were performed using unpaired t test. ns indicates not significant; * P < 0.05; ** P < 0.01; *** P < 0.001.

Article Snippet: Zfp36 flox/flox mice were kindly given by Prof. Pavel Kovarik (Max Perutz Labs, University of Vienna, Vienna BioCenter, Vienna, Austria) and Tagln -Cre mice were purchased from Cyagen Biosciences.

Techniques: Expressing, RNA Binding Assay, Microarray, Transformation Assay, Quantitative RT-PCR, Biomarker Discovery, Staining, Fluorescence

Journal: Research

Article Title: ZFP36 Protects against Abdominal Aortic Aneurysm Formation by Regulating Vascular Smooth Muscle Phenotypic Switch

doi: 10.34133/research.1078

Figure Lengend Snippet: VSMC-specific Zfp36 deletion augmented AngII-induced AAA formation. (A) Diagram of the experimental procedure. (B) Body weights, total cholesterol, and total triglyceride of plasma in Zfp36 △SMC mice and Zfp36 flox/flox mice treated with saline or AngII ( n = 11 to 14 per group). Statistical analyses were analyzed by 2-way analysis of variance (ANOVA) following Tukey’s multiple comparisons. (C) Representative images of macroscopic features and HE staining of cross-sections of abdominal aortas. Scale bar indicates 4 mm. (D) Incidence of AAA induced by AngII in indicated groups ( n = 11 for saline administration; n = 14 for AngII administration). Data were analyzed by a Fisher exact test. (E) Quantification of the maximal diameter of suprarenal abdominal aortas ( n = 11 for saline administration; n = 14 for AngII administration). Data were analyzed by 2-way ANOVA following Tukey’s multiple comparisons test. (F) Representative images of abdominal aortas visualized by using the ultrasound imaging in indicated groups. ns indicates not significant; * P < 0.05; *** P < 0.001.

Article Snippet: Zfp36 flox/flox mice were kindly given by Prof. Pavel Kovarik (Max Perutz Labs, University of Vienna, Vienna BioCenter, Vienna, Austria) and Tagln -Cre mice were purchased from Cyagen Biosciences.

Techniques: Clinical Proteomics, Saline, Staining, Imaging

Journal: Research

Article Title: ZFP36 Protects against Abdominal Aortic Aneurysm Formation by Regulating Vascular Smooth Muscle Phenotypic Switch

doi: 10.34133/research.1078

Figure Lengend Snippet: VSMC-specific Zfp36 deletion augmented AngII-induced aortic remodeling. (A) Representative images of Masson and EVG staining of suprarenal abdominal aortas of mice in indicated groups. Scale bar indicates 100 μm. (B) Grade of elastin degradation ( n = 10 per group). Data were analyzed by nonparametric Kruskal–Wallis test with Dunn’s post-hoc test, and quantitative analysis of collagen deposition ( n = 10 per group). Data were expressed as the mean ± SEM and analyzed by 2-way ANOVA following Tukey’s multiple comparisons test. (C) Protein levels of MMP2 of abdominal aortic tissues in indicated groups ( n = 6 per group) and activities of MMPs of abdominal aortic tissues in indicated groups were determined by a gelatin zymography assay ( n = 6 per group). (D and E) Quantification of MMP2 protein level and activities in (C). Data analyses of (D) and (E) are performed using 2-way ANOVA following Tukey’s multiple comparisons test. (F) Relative mRNA level of Il-1β , Il-6 , Tnf , and Ccl-2 of abdominal aortic tissues in indicated groups ( n = 6 per group). (G) Protein levels of Bax, Bcl2, Caspase 3, and cleaved Caspase 3 of abdominal aortic tissues in indicated groups ( n = 6 per group). (H) TUNEL staining of suprarenal abdominal aortas of mice in indicated groups ( n = 6 per group). Scale bar indicates 50 μm. Statistical analyses of (F) and (G) were performed using unpaired t test. ns indicates not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Article Snippet: Zfp36 flox/flox mice were kindly given by Prof. Pavel Kovarik (Max Perutz Labs, University of Vienna, Vienna BioCenter, Vienna, Austria) and Tagln -Cre mice were purchased from Cyagen Biosciences.

Techniques: Staining, Zymography Assay, TUNEL Assay

Journal: Research

Article Title: ZFP36 Protects against Abdominal Aortic Aneurysm Formation by Regulating Vascular Smooth Muscle Phenotypic Switch

doi: 10.34133/research.1078

Figure Lengend Snippet: ZFP36 knockdown accelerated AngII-induced VSMC phenotypic switch. (A) Heatmap of DEGs in the Zfp36 △SMC group and the Zfp36 flox/flox group ( n = 4 per group). (B) Visualization of DEGs related to smooth muscle phenotypic switch, inflammation, apoptosis, and extracellular matrix. (C and D) Expressions of contractile phenotype-related proteins of VSMCs transfected with Si-Scramble or Si- Zfp36 and treated with saline or AngII (1 μM) for 48 h ( n = 6 per group), and quantification of protein expression levels was analyzed by 2-way ANOVA following Tukey’s multiple comparisons test. (E and F) Expressions of synthetic phenotype-related proteins of VSMCs transfected with Si-Scramble or Si- Zfp36 and treated with saline or AngII (1 μM) for 48 h ( n = 6 per group), and quantification of protein expression levels was analyzed by 2-way ANOVA following Tukey’s multiple comparisons test. ns indicates not significant; * P < 0.05; ** P < 0.01; *** P < 0.001.

Article Snippet: Zfp36 flox/flox mice were kindly given by Prof. Pavel Kovarik (Max Perutz Labs, University of Vienna, Vienna BioCenter, Vienna, Austria) and Tagln -Cre mice were purchased from Cyagen Biosciences.

Techniques: Knockdown, Transfection, Saline, Expressing

Journal: Research

Article Title: ZFP36 Protects against Abdominal Aortic Aneurysm Formation by Regulating Vascular Smooth Muscle Phenotypic Switch

doi: 10.34133/research.1078

Figure Lengend Snippet: GBP2 is the direct target of ZFP36 during AAA progression. (A) The top 10 Gene Ontology (GO) enrichment pathways of differentially expressed genes. (B) Volcano plot reveals altered genes in bulk sequencing. Differentially expressed genes were defined as genes with a Benjamini–Hochberg-adjusted P value <0.05 and |log2(FC)| ≥ 1. (C) Visualization of DEGs of the GBP family. (D) Expression of GBP2 in aortic tissues ( n = 6 per group). (E) Relative mRNA expression of Gbp2 in aortic tissues ( n = 6 per group). Analyses of protein expression in (D), and mRNA expression in (E) were performed by 2-way ANOVA following Tukey’s multiple comparisons test. (F) Representative images of GBP2 expression by IF staining of VSMCs and quantification ( n = 6 per group). Scale bar indicates 20 μm. Statistical analysis was performed by unpaired t test. (G) RNA immunoprecipitation was performed with antibodies to ZFP36, and the target 3′UTR region of Gbp2 was amplified by PCR. (H) Relative mRNA expression of Gbp2 in indicated groups infected with Ad-Ctrl or Ad- Zfp36 for 48 h and treated with actinomycin D (ActD, 10 μg/ml) for different periods. Statistical analysis was performed by unpaired t test. (I) Luciferase reporter assay. Firefly luciferase activity was normalized to Renilla activity and expressed as relative luciferase activity ( n = 6 per group). Statistical analysis was performed by 2-way ANOVA following Tukey’s multiple comparisons test. ns indicates not significant; * P < 0.05; ** P < 0.01; *** P < 0.001.

Article Snippet: Zfp36 flox/flox mice were kindly given by Prof. Pavel Kovarik (Max Perutz Labs, University of Vienna, Vienna BioCenter, Vienna, Austria) and Tagln -Cre mice were purchased from Cyagen Biosciences.

Techniques: Sequencing, Expressing, Staining, RNA Immunoprecipitation, Amplification, Infection, Luciferase, Reporter Assay, Activity Assay

Journal: Research

Article Title: ZFP36 Protects against Abdominal Aortic Aneurysm Formation by Regulating Vascular Smooth Muscle Phenotypic Switch

doi: 10.34133/research.1078

Figure Lengend Snippet: ZFP36 inhibits VSMC phenotypic switch in a GBP2/YAP1/TEAD1-dependent manner. (A) Expressions of contractile phenotype-related proteins and synthetic phenotype-related proteins in VSMCs treated with AngII (1 μM) for 48 h after transfection ( n = 6 per group), and quantifications of protein expression levels were analyzed by 2-way ANOVA following Tukey’s multiple comparisons test. (B) Co-immunoprecipitation of HEK-293T cells transfected with Flag-GBP2 plasmid and HA-TEAD1 plasmid. (C) Protein levels of VSMCs transfecting with Ad-Ctrl or Ad- Gbp2 ( n = 6 per group) . (D) Relative mRNA levels in VSMCs transfecting with Ad-Ctrl or Ad- Gbp2 ( n = 6 per group) . Statistical analyses of (C) and (D) were performed by unpaired t test. (E) Protein levels of VSMCs infecting with Ad-Ctrl or Ad- Gbp2 after MG-132 or chloroquine treatment ( n = 6 per group). Statistical analysis was performed by 2-way ANOVA following Tukey’s multiple comparisons test. ns indicates not significant; * P < 0.05; ** P < 0.01; *** P < 0.001.

Article Snippet: Zfp36 flox/flox mice were kindly given by Prof. Pavel Kovarik (Max Perutz Labs, University of Vienna, Vienna BioCenter, Vienna, Austria) and Tagln -Cre mice were purchased from Cyagen Biosciences.

Techniques: Transfection, Expressing, Immunoprecipitation, Plasmid Preparation

Journal: Research

Article Title: ZFP36 Protects against Abdominal Aortic Aneurysm Formation by Regulating Vascular Smooth Muscle Phenotypic Switch

doi: 10.34133/research.1078

Figure Lengend Snippet: Dexamethasone transcriptionally activates ZFP36 via promoting glucocorticoid receptor nuclear translocation. (A and B) Protein levels and relative mRNA levels of VSMCs treated with DMSO or dexamethasone (0.5 μM) for 48 h ( n = 6 per group). (C) Representative images of NR3C1 expression by IF staining of VSMCs treated with DMSO or dexamethasone (0.5 μM) for 48 h and quantification ( n = 6 per group). Scale bar indicates 20 μm. (D) Nuclear and cytoplasmic protein levels of VSMCs treated with DMSO or dexamethasone (0.5 μM) for 48 h ( n = 6 per group). (E) Representative images of ZFP36 expression by IF staining of VSMCs treated with DMSO or dexamethasone (0.5 μM) for 48 h ( n = 6 per group) and quantification. Scale bar indicates 20 μm ( n = 6 per group). Statistical analyses of (A), (B), (C), (D), and (E) were analyzed by unpaired t test. (F) ChIP was performed with antibodies to NR3C1, and the target promoter region of Zfp36 was amplified by qPCR ( n = 6 per group). (G) Luciferase reporter assay. Firefly luciferase activity was normalized to Renilla activity and expressed as relative luciferase activity ( n = 6 per group). (H) Protein levels of VSMCs treated with DMSO or dexamethasone (0.5 μM) for 48 h after transfecting with Si-Scramble or Si- Nr3c1 ( n = 6 per group). (I) Protein levels of VSMCs treated with DMSO or dexamethasone (0.5 μM) for 48 h after transfecting with Si-Scramble or Si- Zfp36 ( n = 6 per group). Statistical analyses of (F), (G), (H), and (I) were analyzed by 2-way ANOVA following Tukey’s multiple comparisons test. ns indicates not significant; * P < 0.05; ** P < 0.01; *** P < 0.001.

Article Snippet: Zfp36 flox/flox mice were kindly given by Prof. Pavel Kovarik (Max Perutz Labs, University of Vienna, Vienna BioCenter, Vienna, Austria) and Tagln -Cre mice were purchased from Cyagen Biosciences.

Techniques: Translocation Assay, Expressing, Staining, Amplification, Luciferase, Reporter Assay, Activity Assay

Journal: Research

Article Title: ZFP36 Protects against Abdominal Aortic Aneurysm Formation by Regulating Vascular Smooth Muscle Phenotypic Switch

doi: 10.34133/research.1078

Figure Lengend Snippet: Administration of low-dose dexamethasone prevents AAA formation in a ZFP36-dependent manner. (A) Representative images of macroscopic features of cross-sections of abdominal aortas. Scale bar indicates 2 mm. (B) Incidence of AAA induced by AngII in indicated groups ( n = 10 for saline administration; n = 20 to 25 for AngII administration). Data were analyzed by a Fisher exact test. (C) Quantification of the maximal diameter of suprarenal abdominal aortas ( n = 11 for saline administration; n = 14 for AngII administration). Data were expressed as the mean ± SEM and analyzed by 2-way ANOVA following Tukey’s multiple comparisons test. (D) Grade of elastin degradation ( n = 10 per group). Data were expressed as median with interquartile range and analyzed by nonparametric Kruskal–Wallis test with Dunn’s post-hoc test. (E) Quantitative analysis of collagen deposition ( n = 10 per group). Data were expressed as the mean ± SEM and analyzed by 2-way ANOVA following Tukey’s multiple comparisons test. (F) Representative images of HE, Masson, and EVG staining of cross-sections of abdominal aortas. ns indicates not significant; * P < 0.05; ** P < 0.01; *** P < 0.001.

Article Snippet: Zfp36 flox/flox mice were kindly given by Prof. Pavel Kovarik (Max Perutz Labs, University of Vienna, Vienna BioCenter, Vienna, Austria) and Tagln -Cre mice were purchased from Cyagen Biosciences.

Techniques: Saline, Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) Forest plots depicting RNA and IHC-based for ZFP36 /TTP expression related to clinical outcomes (biochemical recurrence and disease-free survival) and risk of lethal prostate cancer (case-control cohorts). (B) (left) Upregulated and downregulated genes were identified by differential expression analysis of TCGA PRAD cases divided by lower quartile expression of ZFP36 ; (right). (C) Representative images of IF staining in human PCa used for expression analysis. Benign glands (arrowheads) stain for pan-cytokeratin (yellow) and basal (red) cocktails; tumor cells (arrows) demonstrate absent basal expression (panels ii & iv). Corresponding sections (i & iii) demonstrate intact epithelial staining for TTP (green). Panels v-vi: Diffuse prostate tumor with absent TTP expression. (D) Kaplan Meier survival analysis demonstrating that TTP deficiency, measured by protein expression (DFCI ( , )) and ZFP36 mRNA expression (TCGA PRAD ; Taylor et al ), results in shorter disease-free-survival, and even shorter disease-free-survival in combination with PTEN deficiency.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Expressing, Control, Quantitative Proteomics, Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) hematoxylin and eosin staining of murine tumors highlighting morphological progression of wild-type (WT), Pten f/f / Zfp36 +/+ ( Pten -/-), Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 +/-) and Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 -/-) dorsolateral prostate tissue at 8 18, and 38 weeks. Scale bar 100 μm. (B) Comparative weight of dorsolateral and ventral prostate tissue in GEMMs at 18 and 38 weeks. (C) Kaplan Meier graphs from GEMM aging studies show that prostate-specific deletion of Zfp36 significantly reduces time-to-ethical endpoint in PCa driven by loss of Pten. *p<0.05, **p<0.005.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting positively and negatively enriched Hallmark pathways. (B) Phos-p65 IF and Masson’s Trichrome staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: RNA Sequencing, Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting significant positively and negatively enriched GOBP pathways. (B) Ki-67 IHC, and Krt18 and αSMA IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Increased tumor cell proliferation and basement membrane breakdown is observed with loss of Zfp36 . (C) Number of mice that displayed PCa cells in distant organs by recombination PCR in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMMs. (D) Representative androgen receptor (AR) IF staining in pelvic lymph nodes of Pten -/- and Pten -/- Zfp36 -/- GEMMs highlighting local dissemination of prostate cells. Scale bar 100 μm. AR staining was over exposed during imaging to assist with prostate cell identification. (E) Representative images and quantification of budding in GEMM-derived organoids highlighting increased invasive and metastatic potential of Pten -/- Zfp36 -/-organoids. (F) Scratch assay in GEMM-derived 2D cells, comparing Pten -/- and Pten -/- Zfp36 -/- wound healing with that of Pten -/- Rb1 -/-, a previously described metastatic, neuroendocrine PCa murine cell line . *p<0.05, **p<0.005, ***p<0.001, ****p<0.0001.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: RNA Sequencing, Staining, Membrane, Imaging, Derivative Assay, Wound Healing Assay

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) AR, synaptophysin (Syp) and CD45 IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005. (B) Dual Krt8 and CD45 IF staining in Pten -/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks. Scale bar 50 μm.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) Kaplan Meier graph from GEMM aging studies where mice were surgically castrated at 38 weeks comparing Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- mice, and whole prostate weights and representative images from mice 12 weeks post-castration. (B) Quantification of GEMM-derived Pten -/- and Pten -/- Zfp36 -/- organoid growth in the presence and absence of enzalutamide (10 μM). (C) Allograft tumor growth in mice treated with DMAPT (100 mg/kg/day) or water vehicle ± surgical castration, n=5 mice per treatment group. (D) End-point tumor volumes from allograft therapy studies. (E) Representative images and (F) quantification of cell death (green) in GEMM-derived PCa organoids treated with DMAPT (5 μM), enzalutamide (10 μM) or the combination of both for 72 hours, n=10 organoids per treatment group. (G) Representative images and flow cytometry quantification for CD45, synaptophysin, and AR expression in GEMM-derived PCa organoids treated with DMAPT (5 μM) or DMSO vehicle for 72 hours. (H) Fold-change in expression of the AR response gene – Fkbp5 in GEMM-derived 2D cell lines treated with DMAPT (5 μM) or DMSO vehicle for 72 hours, R1881 (10nM was used to stimulate AR activity. *p<0.05, **p<0.005, ***p<0.001. (I) Schematic overview: i) when ZFP36 is intact epithelial cells present with a luminal lineage phenotype and sensitivity to AR inhibition. ii) loss of ZFP36 results in an alternative epithelial cell lineage phenotype with reduced AR expression, increased SYP and CD45 expression, and increased NF-κB activation and inflammation, leading to lack of response to AR inhibition. iii) DMAPT treatment inhibits NF-κB and inflammation signaling and restores a more luminal epithelial cell type and responsiveness to AR inhibition.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Derivative Assay, Flow Cytometry, Expressing, Activity Assay, Inhibition, Activation Assay

Journal: Molecular Biology of the Cell

Article Title: Multilevel regulation of HIF-1 signaling by TTP

doi: 10.1091/mbc.E11-11-0949

Figure Lengend Snippet: Mathematical model of HIF-1α regulation under normoxic condition predicts the dual role of TTP. For each potential structure of the networks depicted in A–C, a model based on modular response analysis was constructed. Parameters were chosen randomly in a Monte Carlo approach, and the frequency of positive and negative coregulation of ZFP36 and HIF-1 targets (both marked as yellow filled ovals) upon stimulation was calculated and evaluated using the Matthews correlation coefficient (mcc). (A) Negative feedback model: TTP mRNA (ZFP36) is constitutively expressed, and TTP protein destabilizes both its own and mRNA of HIF-1α (HIF1A). Model simulation predicts that TTP mRNA is anticorrelated with HIF-1 target mRNAs. (B) TTP protein sequestration model: If in addition TTP is phosphorylated, and the phosphorylated form does not destabilize 3′ UTR–containing mRNA, model simulation predicts no correlation between mRNA levels of TTP and HIF-1 targets. (C) Competition model: If either binding of phosphorylated TTP actively stabilizes the bound mRNA (scenario1) or phosphorylated TTP competes with TTP for limited binding sites (scenario 2), model simulation predicts positive correlation of the two mRNAs. Both mechanisms in combination would further increase the positive correlation (scenarios 1 + 2).

Article Snippet: The following primary antibodies were used: 1) polyclonal mouse anti–human HIF-1α (H72320; BD Biosciences, Heidelberg, Germany), 2) polyclonal rabbit anti–human ZFP36 (tristetraprolin) antibody (ARP34385; Aviva Systems Biology, San Diego, CA), and 3) polyclonal goat anti–human β-actin (sc-47778; Santa Cruz Biotechnology).

Techniques: Construct, Binding Assay