|
OriginLab corp
origin 2018 sr1 build 9.5.1.195 Origin 2018 Sr1 Build 9.5.1.195, supplied by OriginLab corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/zen+blue+3%2E4+software/origin+2018+sr1+build+9+5+1+195/pm37421623-377-45-51 Average 90 stars, based on 1 article reviews
origin 2018 sr1 build 9.5.1.195 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Oxford Instruments
zeiss zen blue software Zeiss Zen Blue Software, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/zen+blue+3%2E4+software/Imaris/pm33158857-273-5-15 Average 99 stars, based on 1 article reviews
zeiss zen blue software - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
|
Bio-Rad
coomassie brilliant blue Coomassie Brilliant Blue, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/zen+blue+3%2E4+software/Coomassie+Brilliant+Blue+G-250/pmc05151214-265-11-52 Average 96 stars, based on 1 article reviews
coomassie brilliant blue - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Genechem
algorithms imagej software nih image n a graphpad prism 8 graphpad n a zen blu edition zeiss n a gene expression omnibus ncbi Algorithms Imagej Software Nih Image N A Graphpad Prism 8 Graphpad N A Zen Blu Edition Zeiss N A Gene Expression Omnibus Ncbi, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/zen+blue+3%2E4+software/a+a+a+agr2c81a+expression+genechem+genechem+genechem+gv354+gv715+identifier+luciferase+luciferase+n+n+n+resource+software+source+vector+vector+vector/pm40581931-206-207-203 Average 86 stars, based on 1 article reviews
algorithms imagej software nih image n a graphpad prism 8 graphpad n a zen blu edition zeiss n a gene expression omnibus ncbi - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Carl Zeiss
zen lite software Zen Lite Software, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/zen+blue+3%2E4+software/ZEN+lite+%2F+starter+Module+Image+Analysis/pmc07339180-44-16-23 Average 96 stars, based on 1 article reviews
zen lite software - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Carl Zeiss
zen software Zen Software, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/zen+blue+3%2E4+software/ZEN+Module+Image+Analysis/pmc05361591-563-19-25 Average 95 stars, based on 1 article reviews
zen software - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
|
Carl Zeiss
camera axiocam 305 color Camera Axiocam 305 Color, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/zen+blue+3%2E4+software/Inverted+microscope+Axio+Vert%2EA1/pmc09535858-54-19-23 Average 97 stars, based on 1 article reviews
camera axiocam 305 color - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
Carl Zeiss
axio zoom microscope Axio Zoom Microscope, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/zen+blue+3%2E4+software/Zoom+microscope+Axio+Zoom%2EV16+(7x+%2E%2E%2E+112x)/pm39983293-107-13-16 Average 96 stars, based on 1 article reviews
axio zoom microscope - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Carl Zeiss
zen blue software Zen Blue Software, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/zen+blue+3%2E4+software/ZEN+3%2E1+system/10__3390_slash_epigenomes8030033-147-7-6 Average 96 stars, based on 1 article reviews
zen blue software - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Bio-Rad
algorithms imagej nih  Algorithms Imagej Nih, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/zen+blue+3%2E4+software/Image+Lab+Software/pmc08172529-1137-258-268 Average 99 stars, based on 1 article reviews
algorithms imagej nih - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
|
OriginLab corp
originpro 2020 Originpro 2020, supplied by OriginLab corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/zen+blue+3%2E4+software/originpro+software/pm37210726-167-19-36 Average 90 stars, based on 1 article reviews
originpro 2020 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
MetaMorph Inc
zen blue 3.4 imaging software Zen Blue 3.4 Imaging Software, supplied by MetaMorph Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/zen+blue+3%2E4+software/zen+blue+3+4+imaging+software/pm37317179-62-7-5 Average 90 stars, based on 1 article reviews
zen blue 3.4 imaging software - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell metabolism
Article Title: A methionine-Mettl3- N 6 -methyladenosine axis promotes polycystic kidney disease
doi: 10.1016/j.cmet.2021.03.024
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-METTL3 Abcam ab195352 Anti-METTL3 Invitrogen MA5-27527 Anti-m 6 A Abcam ab151230 Anti-c-Myc Abcam ab185656 Anti-c-Myc Sigma OP10-200UG Anti-Avpr2 EMD AB1797P Anti-Puromycin Developmental Studies Hybridoma Bank PMY-2A4 Anti-HA Cell Signaling #3724 Anti-PCNA Santa Cruz sc-7907 Anti-pHH3 Sigma H0412 Anti-pCreb1 Cell Signaling 9198S Anti-Yap Cell Signaling #4912 Anti-GFP Aves GFP-1020 Anti-DBA Vector Laboratories B-1035 Anti-Mettl14 Sigma HPA038002 Bacterial and Virus Strains Ad-CMV-iCre virus Vector Biolabs #1045 Biological Samples Normal human and ADPKD kidney samples PKD Biomarkers and Biomaterials Core in the Kansas PKD Center at the Kansas University Medical Center (KUMC) Chemicals, Peptides, and Recombinant Proteins Puromycin Invitrogen A1113803 O-Propargyl-Puromycin JenaBioScience NU-931-5 8-Br-cAMP Sigma B7880 alamarBlue Invitrogen DAL1025 methionine Sigma M5308 s-adenosylmethionine Cayman Chemicals 13956 s-adenosylhomocysteine Cayman Chemicals 13603 Critical Commercial Assays m 6 A elisa kit Epigentek P-9005-96 SAM elisa kit Cell Biolabs STA-671-C Magna MeRIPTM m 6 A Kit EMD Millipore 17-10499 Submitted data MeRIP-seq NCBI Gene Expression Omnibus GSE165956 RNA-seq NCBI Gene Expression Omnibus GSE165956 Experimental Models: Organisms/Strains Ksp/Cre Shibazaki et al., 2008 N/A Ksp/rtTA Pan et al., 2013 N/A tetO-Cre Jackson Laboratories Stock No: 006234 Pkd1 F/F Jackson Laboratories Stock No: 010671 Pkd1 RC/RC ( PKD1 p.R3277C) Hopp et al., 2012 N/A Mettl3 F/F UT Southwestern Med Ctr N/A Mettl3 Tg UT Southwestern Med Ctr N/A mIMCD3 cells ATCC CRL 2123 Oligonucleotides siRNA against Mettl3 (UGGUUUACAUGUCGACUAA, UGGUUUACAUGUUGUGUGA, UGGUUUACAUGUUUUCUGA, UGGUUUACAUGUUUUCCUA) Dharmacon L-049446-01-0020 Scrambled siRNAs (ACAGCAGGCACAGACAGGCAGU) Dharmacon D-001810-10-20 Recombinant DNA Plasmid - CAG-LSL-Mettl3cDNA-HA/HA/HA-IRES-GFP This paper N/A Plasmid - pLightSwitch Empty (pLS) 3′-UTR Switchgear Genomics S890005 Plasmid - pGL3 Promega E1751 Software and
Techniques: Plasmid Preparation, Virus, Recombinant, Enzyme-linked Immunosorbent Assay, Gene Expression, Software