ybx1 Search Results


94
MedChemExpress anti ybx1 mouse
A Bubble chart shows the result of KEGG enrichment analysis with the RNA-seq from <t>piR-YBX1</t> OE and control cells. B Bar chart shows the results of GO analysis of piR-YBX1 group and control group. C ssGSEA analysis of genes related to the MAPK signaling pathway of YBX1 . D Co-immunoprecipitation (Co-IP) experiments were carried out to investigate the interaction between YBX1 and RAF1 in TNBC cells. IP: <t>mouse</t> <t>anti-YBX1</t> antibody; mouse-anti-IgG as a control. IB: rabbit anti-YBX1 and rabbit anti-RAF1. E Western blot shows that YBX1 reverted the effect of piR-YBX1 on the expression of p-MEK, p-ERK1/2 and other markers of the MAPK signaling pathway. F Western blot analysis of relative expression of protein level, protein levels are normalized to β-actin. The data are showed as the mean ± SD, * P < 0.05 ** P < 0.01, *** P < 0.001, **** P < 0.0001. Data were analyzed by ( F ) one-way ANOVA.
Anti Ybx1 Mouse, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ybx1/YBX1%2C+Mouse/pmc10770055-254-9-26
Average 94 stars, based on 1 article reviews
anti ybx1 mouse - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

96
Proteintech ybx1 antibody
A Protein levels of <t>YBX1</t> in 10 different types of tumors from the CPTAC database. B mRNA levels of YBX1 in 21 different types of tumors from the TCGA database. C–G Enrichment functional analysis of proteins interacting with YBX1 in ccRCC cell line 786-O through Co-IP pull-down and identified by mass spectrometry. C Mass spectrometry identification schematic. D Gene Ontology Biological Process (GO-BP) enrichment. E KEGG pathway enrichment. F UniPort annotation keywords. G Wiki Pathways enrichment analysis. ** P < 0.01, *** P < 0.001, **** P < 0.0001. Unpaired two-sided Student’s t -test in A and B. Data are presented as mean ± SD.
Ybx1 Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ybx1/YBX1+Antibody/pmc12783105-166-24-26
Average 96 stars, based on 1 article reviews
ybx1 antibody - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

94
OriGene 1999 n a recombinant human ybx1 origene cat
Figure 2. Structure of IMP1 and <t>YBX1</t> mRNP Granules (A) HeLa cells were stained with anti-IMP1 and anti-YBX1 antibodies followed by Alexa Fluor 488 (green) and Alexa Fluor 647 (red) secondary antibodies, respectively. (A1–A3) Overview of the cell. Scale bars, 5 mm. (A4–A6) Blow-up of IMP1 and YBX1 granules in the indicated area (white square) in (A3). Scale bar, 0.2 mm. (A7) P bodies depicted by DCP1a-EGFP in combination with IMP1 staining and A8, pHcRed-G3BP in stress granules in combination with IMP1 staining. (B) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with ACTB mRNA FISH (cyan) using 48 Quasar 570 dye-labeled oligonucleotides corresponding to the entire ACTB mRNA. (B1–B4) Overview of a HeLa cell. Scale bars, 5 mm. (B5–B9) blow up of ACTB mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B5) and 0.1 mm (B6–B9). (B10–B19) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with GAPDH mRNA FISH (cyan) using 48 Quasar 570 dye-labeled (cyan) oligonucleotides corresponding to the entire GAPDH mRNA. (B10–B14) Overview of a HeLa cell. Scale bars, 5 mm. (B15–B19) Blow-up of GAPDH mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B15) and 0.1 mm (B16–B19). (B20 and B21) Double FISH with ACTB mRNA (red, Quasar 670-conjugated probes) and GAPDH mRNA (green, Quasar 570-conjugated probes) in combination with YBX1 immunostaining (gray, Alexa Fluor 488). (C) EGFP immunoprecipitation of transiently transfected HeLa cells with pEGFP-C1 (control) and pEGFP-IMP1. Immunodetection of GFP and GFP-IMP1, endogenous IMP1, YBX1, and GADPH, respectively, was performed in total lysate and immunoprecipitated (IP) fractions without () or with (+) RNase A treatment.
1999 N A Recombinant Human Ybx1 Origene Cat, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ybx1/YB1+(YBX1)+(NM_004559)+Human+Recombinant+Protein/pm31618640-220-74-79
Average 94 stars, based on 1 article reviews
1999 n a recombinant human ybx1 origene cat - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

90
OriGene ybx1
Figure 2. Structure of IMP1 and <t>YBX1</t> mRNP Granules (A) HeLa cells were stained with anti-IMP1 and anti-YBX1 antibodies followed by Alexa Fluor 488 (green) and Alexa Fluor 647 (red) secondary antibodies, respectively. (A1–A3) Overview of the cell. Scale bars, 5 mm. (A4–A6) Blow-up of IMP1 and YBX1 granules in the indicated area (white square) in (A3). Scale bar, 0.2 mm. (A7) P bodies depicted by DCP1a-EGFP in combination with IMP1 staining and A8, pHcRed-G3BP in stress granules in combination with IMP1 staining. (B) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with ACTB mRNA FISH (cyan) using 48 Quasar 570 dye-labeled oligonucleotides corresponding to the entire ACTB mRNA. (B1–B4) Overview of a HeLa cell. Scale bars, 5 mm. (B5–B9) blow up of ACTB mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B5) and 0.1 mm (B6–B9). (B10–B19) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with GAPDH mRNA FISH (cyan) using 48 Quasar 570 dye-labeled (cyan) oligonucleotides corresponding to the entire GAPDH mRNA. (B10–B14) Overview of a HeLa cell. Scale bars, 5 mm. (B15–B19) Blow-up of GAPDH mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B15) and 0.1 mm (B16–B19). (B20 and B21) Double FISH with ACTB mRNA (red, Quasar 670-conjugated probes) and GAPDH mRNA (green, Quasar 570-conjugated probes) in combination with YBX1 immunostaining (gray, Alexa Fluor 488). (C) EGFP immunoprecipitation of transiently transfected HeLa cells with pEGFP-C1 (control) and pEGFP-IMP1. Immunodetection of GFP and GFP-IMP1, endogenous IMP1, YBX1, and GADPH, respectively, was performed in total lysate and immunoprecipitated (IP) fractions without () or with (+) RNase A treatment.
Ybx1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ybx1/YB1+(YBX1)+(NM_004559)+Human+Tagged+ORF+Clone/pmc05774586-106-14-16
Average 90 stars, based on 1 article reviews
ybx1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

94
Cyagen Biosciences ybx1
Figure 1: Immunohistochemical analyses of CDC25a and <t>YBX1</t> proteins in different subtypes of lung adenocarcinoma. The expression of CDC25a and YBX1 in MIA was detected by IHC assay. MIA, minimally invasive adenocarcinoma; Lep, lepidic predominant adenocarcinoma; Aci, acinar predominant adenocarcinoma; Pap, papillary predominant adenocarcinoma; Mp, micropapillary predominant adenocarcinoma; Sci, solid predominant adenocarcinoma; Mu, mucinous predominant adenocarcinoma.100X magnification of the micrographs as insert in the figure.
Ybx1, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ybx1/Ybx1/pm27384875-150-4-16
Average 94 stars, based on 1 article reviews
ybx1 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

92
Thermo Fisher gene exp ybx1 hs00898625 g1
Figure 1: Immunohistochemical analyses of CDC25a and <t>YBX1</t> proteins in different subtypes of lung adenocarcinoma. The expression of CDC25a and YBX1 in MIA was detected by IHC assay. MIA, minimally invasive adenocarcinoma; Lep, lepidic predominant adenocarcinoma; Aci, acinar predominant adenocarcinoma; Pap, papillary predominant adenocarcinoma; Mp, micropapillary predominant adenocarcinoma; Sci, solid predominant adenocarcinoma; Mu, mucinous predominant adenocarcinoma.100X magnification of the micrographs as insert in the figure.
Gene Exp Ybx1 Hs00898625 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ybx1/Gene+Exp%2E+YBX1%2C+Hs00898625_g1/pm25871401-135-25-30
Average 92 stars, based on 1 article reviews
gene exp ybx1 hs00898625 g1 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

91
Addgene inc targeting construct c3gic9n
Figure 1: Immunohistochemical analyses of CDC25a and <t>YBX1</t> proteins in different subtypes of lung adenocarcinoma. The expression of CDC25a and YBX1 in MIA was detected by IHC assay. MIA, minimally invasive adenocarcinoma; Lep, lepidic predominant adenocarcinoma; Aci, acinar predominant adenocarcinoma; Pap, papillary predominant adenocarcinoma; Mp, micropapillary predominant adenocarcinoma; Sci, solid predominant adenocarcinoma; Mu, mucinous predominant adenocarcinoma.100X magnification of the micrographs as insert in the figure.
Targeting Construct C3gic9n, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ybx1/pBS+YBX1+(Plasmid+%2319217)/pm37217526-80-22-25
Average 91 stars, based on 1 article reviews
targeting construct c3gic9n - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

93
MedChemExpress rabbit
Figure 1: Immunohistochemical analyses of CDC25a and <t>YBX1</t> proteins in different subtypes of lung adenocarcinoma. The expression of CDC25a and YBX1 in MIA was detected by IHC assay. MIA, minimally invasive adenocarcinoma; Lep, lepidic predominant adenocarcinoma; Aci, acinar predominant adenocarcinoma; Pap, papillary predominant adenocarcinoma; Mp, micropapillary predominant adenocarcinoma; Sci, solid predominant adenocarcinoma; Mu, mucinous predominant adenocarcinoma.100X magnification of the micrographs as insert in the figure.
Rabbit, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ybx1/YB1+Antibody/pm38849679-36-41-44
Average 93 stars, based on 1 article reviews
rabbit - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

86
Addgene inc prset ybx1 plasmid
IP-MS indicates that <t>YBX1</t> as a direct target of NEK6. (A) The heatmap of identified interacting proteins. (B) IP-western blot analysis validated the interaction of NEK6 and YBX1. (C) The YBX1 mRNA expression in endometrial cancer and normal breast tissues was analyzed based on TCGA databases. (D) the overall survival curve analysis of YBX1 between high and low YBX1 expression group in TCGA EC cohort. (E) The co-localization of NEK6 and YBX1 was assessed by immunofluorescence. Scale bar: 5 μm. (F) Representative immunohistochemical staining of NEK6 and YBX1 in the EC specimens on a TMA (n = 88). Linear regression analysis of the expression of NEK6 and YBX1. (G) YBX1 mRNA was determined by qRT-PCR after NEK6 overexpression knockdown in EC cells. (H) Altered nuclear translocation of YBX1 in response to NEK6 overexpression or knockdown in Ishikawa and HEC-1A cells analyzed by Western blotting. (I) The expression of YBX1 in nucleus and cytoplasm of NEK6-overexpressing HEC-1A cells were shown by Western blot. (J) immunofluorescence assay was performed to observe the localization of YBX1 in HEC-1A cells.
Prset Ybx1 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ybx1/pRSET+YBX-1+(Plasmid+%2313035)/pmc12813190-41-0-6
Average 86 stars, based on 1 article reviews
prset ybx1 plasmid - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

93
Cusabio anti phospho yb1 ser102 antibody
Primer sequences in this paper
Anti Phospho Yb1 Ser102 Antibody, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ybx1/Rabbit+anti-+Phospho-YBX1+Polyclonal+Antibody/pmc07006413-126-13-17
Average 93 stars, based on 1 article reviews
anti phospho yb1 ser102 antibody - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Novus Biologicals ybx1
A Quantitative RT‒PCR analysis confirmed the effect of <t>YBX1</t> on TAGLN2-mediated ISG upregulation. B The endogenous interaction between TAGLN2 and the YBX1 promoter was evaluated by ChIP‒qPCR in BGC-823 cells. C The dual-luciferase reporter assay results showed that overexpression of TAGLN2 activated the transcriptional activity of YBX1 by binding to the promoter region (−334 to −1 bp). D The transcriptional regulation effect of YBX1 and 11 candidate transcription factors (ETV4, E2F1, GATA4, ELK1, ZNF263, TFAP2A, TEAD4, c-Myc, SOX9, SP1 and Twist) was evaluated by luciferase reporter assays in both BGC-823 and MGC-803 cells. YBX1-8 promoter region was abbreviated as Y8 for short. E Co-IP assays demonstrated that SOX9 and c-Myc, but not SP1, interacted with TAGLN2. * P < 0.05, ** P < 0.01, *** P < 0.001.
Ybx1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ybx1/YB1+Antibody+(YBX1%2F2430)/pmc11339399-373-35-37
Average 93 stars, based on 1 article reviews
ybx1 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results


A Bubble chart shows the result of KEGG enrichment analysis with the RNA-seq from piR-YBX1 OE and control cells. B Bar chart shows the results of GO analysis of piR-YBX1 group and control group. C ssGSEA analysis of genes related to the MAPK signaling pathway of YBX1 . D Co-immunoprecipitation (Co-IP) experiments were carried out to investigate the interaction between YBX1 and RAF1 in TNBC cells. IP: mouse anti-YBX1 antibody; mouse-anti-IgG as a control. IB: rabbit anti-YBX1 and rabbit anti-RAF1. E Western blot shows that YBX1 reverted the effect of piR-YBX1 on the expression of p-MEK, p-ERK1/2 and other markers of the MAPK signaling pathway. F Western blot analysis of relative expression of protein level, protein levels are normalized to β-actin. The data are showed as the mean ± SD, * P < 0.05 ** P < 0.01, *** P < 0.001, **** P < 0.0001. Data were analyzed by ( F ) one-way ANOVA.

Journal: Cell Death Discovery

Article Title: PIWI-interacting RNA-YBX1 inhibits proliferation and metastasis by the MAPK signaling pathway via YBX1 in triple-negative breast cancer

doi: 10.1038/s41420-023-01771-w

Figure Lengend Snippet: A Bubble chart shows the result of KEGG enrichment analysis with the RNA-seq from piR-YBX1 OE and control cells. B Bar chart shows the results of GO analysis of piR-YBX1 group and control group. C ssGSEA analysis of genes related to the MAPK signaling pathway of YBX1 . D Co-immunoprecipitation (Co-IP) experiments were carried out to investigate the interaction between YBX1 and RAF1 in TNBC cells. IP: mouse anti-YBX1 antibody; mouse-anti-IgG as a control. IB: rabbit anti-YBX1 and rabbit anti-RAF1. E Western blot shows that YBX1 reverted the effect of piR-YBX1 on the expression of p-MEK, p-ERK1/2 and other markers of the MAPK signaling pathway. F Western blot analysis of relative expression of protein level, protein levels are normalized to β-actin. The data are showed as the mean ± SD, * P < 0.05 ** P < 0.01, *** P < 0.001, **** P < 0.0001. Data were analyzed by ( F ) one-way ANOVA.

Article Snippet: The other two aliquots were incubated with an antibody (anti-YBX1, mouse or anti-IgG, mouse) at 4 °C overnight and were then incubated with protein A/G beads (MCE, USA) with rotation for 1 h at room temperature the next day.

Techniques: RNA Sequencing, Control, Immunoprecipitation, Co-Immunoprecipitation Assay, Western Blot, Expressing

A Protein levels of YBX1 in 10 different types of tumors from the CPTAC database. B mRNA levels of YBX1 in 21 different types of tumors from the TCGA database. C–G Enrichment functional analysis of proteins interacting with YBX1 in ccRCC cell line 786-O through Co-IP pull-down and identified by mass spectrometry. C Mass spectrometry identification schematic. D Gene Ontology Biological Process (GO-BP) enrichment. E KEGG pathway enrichment. F UniPort annotation keywords. G Wiki Pathways enrichment analysis. ** P < 0.01, *** P < 0.001, **** P < 0.0001. Unpaired two-sided Student’s t -test in A and B. Data are presented as mean ± SD.

Journal: Cell Death & Disease

Article Title: YBX1 orchestrates LDHA-mediated metabolic reprogramming and NF-κB activation to drive clear cell renal cell carcinoma progression

doi: 10.1038/s41419-025-08261-0

Figure Lengend Snippet: A Protein levels of YBX1 in 10 different types of tumors from the CPTAC database. B mRNA levels of YBX1 in 21 different types of tumors from the TCGA database. C–G Enrichment functional analysis of proteins interacting with YBX1 in ccRCC cell line 786-O through Co-IP pull-down and identified by mass spectrometry. C Mass spectrometry identification schematic. D Gene Ontology Biological Process (GO-BP) enrichment. E KEGG pathway enrichment. F UniPort annotation keywords. G Wiki Pathways enrichment analysis. ** P < 0.01, *** P < 0.001, **** P < 0.0001. Unpaired two-sided Student’s t -test in A and B. Data are presented as mean ± SD.

Article Snippet: After removing the supernatant, 50 μL of Antibody Buffer was added to resuspend the beads-bound cells, followed by the addition of 1 μg of YBX1 antibody (Proteintech, USA) and Rabbit IgG (Cell Signaling Technology, USA), and left to stand overnight at 4 °C.

Techniques: Functional Assay, Co-Immunoprecipitation Assay, Mass Spectrometry

A Western blot validation of YBX1 protein expression upon knockdown and overexpression efficiency in ACHN and 786-O cells. B qRT-PCR validation of YBX1 mRNA expression upon knockdown and overexpression efficiency in ACHN and 786-O cells. C Lactate production upon YBX1 knockdown in ACHN and 786-O cells. D ATP production detection upon YBX1 knockdown in ACHN and 786-O cells. E Real-time monitoring of extracellular acidification rate (ECAR) in ACHN and 786-O cells after YBX1 knockdown, measured using a Seahorse Bioscience Analyzer. F Quantitative analysis of glycolytic capacity and glycolytic reserve. G Real-time monitoring of oxygen consumption rate (OCR) in ACHN and 786-O cells after YBX1 knockdown, measured using a Seahorse Bioscience Analyzer. H Quantitative analysis of mitochondrial respiratory capacity and respiratory reserve. I Lactate dehydrogenase (LDH) activity detection upon YBX1 knockdown and overexpression in ACHN and 786-O cells. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Unpaired two-sided Student’s t -test in B – D , F , H and I . Data are presented as mean ± SD.

Journal: Cell Death & Disease

Article Title: YBX1 orchestrates LDHA-mediated metabolic reprogramming and NF-κB activation to drive clear cell renal cell carcinoma progression

doi: 10.1038/s41419-025-08261-0

Figure Lengend Snippet: A Western blot validation of YBX1 protein expression upon knockdown and overexpression efficiency in ACHN and 786-O cells. B qRT-PCR validation of YBX1 mRNA expression upon knockdown and overexpression efficiency in ACHN and 786-O cells. C Lactate production upon YBX1 knockdown in ACHN and 786-O cells. D ATP production detection upon YBX1 knockdown in ACHN and 786-O cells. E Real-time monitoring of extracellular acidification rate (ECAR) in ACHN and 786-O cells after YBX1 knockdown, measured using a Seahorse Bioscience Analyzer. F Quantitative analysis of glycolytic capacity and glycolytic reserve. G Real-time monitoring of oxygen consumption rate (OCR) in ACHN and 786-O cells after YBX1 knockdown, measured using a Seahorse Bioscience Analyzer. H Quantitative analysis of mitochondrial respiratory capacity and respiratory reserve. I Lactate dehydrogenase (LDH) activity detection upon YBX1 knockdown and overexpression in ACHN and 786-O cells. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Unpaired two-sided Student’s t -test in B – D , F , H and I . Data are presented as mean ± SD.

Article Snippet: After removing the supernatant, 50 μL of Antibody Buffer was added to resuspend the beads-bound cells, followed by the addition of 1 μg of YBX1 antibody (Proteintech, USA) and Rabbit IgG (Cell Signaling Technology, USA), and left to stand overnight at 4 °C.

Techniques: Western Blot, Biomarker Discovery, Expressing, Knockdown, Over Expression, Quantitative RT-PCR, Activity Assay

A , B Effects of YBX1 overexpression on the proliferation of ACHN and 786-O cells. A Colony formation assay. B CCK-8 cell proliferation assay. C, D Effects of YBX1 overexpression on the migration and invasion of ACHN and 786-O cells. C Transwell cell migration assay. D Transwell cell invasion assay. E Detection of bioluminescence intensity of 8 pairs of tumors in nude mice using an in vivo imaging system. F Quantification analysis of bioluminescence intensity at the site of renal orthotopic tumors. G Statistical analysis of in situ tumor weight, expressed as the weight of the left minus the corresponding right kidney of nude mice. H Immunohistochemical staining and quantification to detect protein expression of YBX1, LDHA and Ki-67 in tumor tissues from control and YBX1 knockdown groups in nude mice. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Unpaired two-sided Student’s t -test in A , C , D , F , G and H . Two-way ANOVA with correction for multiple comparisons in B. Data are presented as mean ± SD.

Journal: Cell Death & Disease

Article Title: YBX1 orchestrates LDHA-mediated metabolic reprogramming and NF-κB activation to drive clear cell renal cell carcinoma progression

doi: 10.1038/s41419-025-08261-0

Figure Lengend Snippet: A , B Effects of YBX1 overexpression on the proliferation of ACHN and 786-O cells. A Colony formation assay. B CCK-8 cell proliferation assay. C, D Effects of YBX1 overexpression on the migration and invasion of ACHN and 786-O cells. C Transwell cell migration assay. D Transwell cell invasion assay. E Detection of bioluminescence intensity of 8 pairs of tumors in nude mice using an in vivo imaging system. F Quantification analysis of bioluminescence intensity at the site of renal orthotopic tumors. G Statistical analysis of in situ tumor weight, expressed as the weight of the left minus the corresponding right kidney of nude mice. H Immunohistochemical staining and quantification to detect protein expression of YBX1, LDHA and Ki-67 in tumor tissues from control and YBX1 knockdown groups in nude mice. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Unpaired two-sided Student’s t -test in A , C , D , F , G and H . Two-way ANOVA with correction for multiple comparisons in B. Data are presented as mean ± SD.

Article Snippet: After removing the supernatant, 50 μL of Antibody Buffer was added to resuspend the beads-bound cells, followed by the addition of 1 μg of YBX1 antibody (Proteintech, USA) and Rabbit IgG (Cell Signaling Technology, USA), and left to stand overnight at 4 °C.

Techniques: Over Expression, Colony Assay, CCK-8 Assay, Proliferation Assay, Migration, Cell Migration Assay, Invasion Assay, In Vivo Imaging, In Situ, Immunohistochemical staining, Staining, Expressing, Control, Knockdown

A, B Protein expression levels of YBX1 ( A ) and LDHA ( B ) in ccRCC from the CPTAC database. C, D Correlation of gene expression between YBX1 and LDHA in ccRCC from the TCGA database ( C ) and in an Asian population ( D ). E Western blot analysis of YBX1 and LDHA protein expression in tumor (T) and paired adjacent non-tumor (P) tissues from 27 ccRCC patients, showing representative images from 4 pairs of tissues. F Quantification of YBX1 and LDHA proteins in ccRCC and adjacent non-cancerous tissues from 27 cases using Image J software, normalized to β-actin. G Correlation of YBX1 and LDHA protein expression in tumor tissues from 27 ccRCC patients. H-M Immunohistochemical staining to assess the expression of YBX1 and LDHA in 63 pairs of ccRCC and adjacent tissues. H, I Representative immunohistochemical staining images and quantification of IHC staining using Image J software. J Correlation of quantified immunohistochemical staining of YBX1 and LDHA in tumor tissues of 63 ccRCC patients. K-M Levels of YBX1 and LDHA in ccRCC patients stratified by tumor size, T stage and Fuhrman grade. N , O Impact of YBX1 expression on overall survival (OS) ( N ) and recurrence free survival (RFS) ( O ) in ccRCC patients from the TCGA database. ** P < 0.01, *** P < 0.001, **** P < 0.0001. Unpaired two-sided Student’s t -test in A , B , K , L and M . Spearman correlation statistics in C , D , G and J . Paired t -test in F and I. Log-rank test in N and O. Data are presented as mean ± SD.

Journal: Cell Death & Disease

Article Title: YBX1 orchestrates LDHA-mediated metabolic reprogramming and NF-κB activation to drive clear cell renal cell carcinoma progression

doi: 10.1038/s41419-025-08261-0

Figure Lengend Snippet: A, B Protein expression levels of YBX1 ( A ) and LDHA ( B ) in ccRCC from the CPTAC database. C, D Correlation of gene expression between YBX1 and LDHA in ccRCC from the TCGA database ( C ) and in an Asian population ( D ). E Western blot analysis of YBX1 and LDHA protein expression in tumor (T) and paired adjacent non-tumor (P) tissues from 27 ccRCC patients, showing representative images from 4 pairs of tissues. F Quantification of YBX1 and LDHA proteins in ccRCC and adjacent non-cancerous tissues from 27 cases using Image J software, normalized to β-actin. G Correlation of YBX1 and LDHA protein expression in tumor tissues from 27 ccRCC patients. H-M Immunohistochemical staining to assess the expression of YBX1 and LDHA in 63 pairs of ccRCC and adjacent tissues. H, I Representative immunohistochemical staining images and quantification of IHC staining using Image J software. J Correlation of quantified immunohistochemical staining of YBX1 and LDHA in tumor tissues of 63 ccRCC patients. K-M Levels of YBX1 and LDHA in ccRCC patients stratified by tumor size, T stage and Fuhrman grade. N , O Impact of YBX1 expression on overall survival (OS) ( N ) and recurrence free survival (RFS) ( O ) in ccRCC patients from the TCGA database. ** P < 0.01, *** P < 0.001, **** P < 0.0001. Unpaired two-sided Student’s t -test in A , B , K , L and M . Spearman correlation statistics in C , D , G and J . Paired t -test in F and I. Log-rank test in N and O. Data are presented as mean ± SD.

Article Snippet: After removing the supernatant, 50 μL of Antibody Buffer was added to resuspend the beads-bound cells, followed by the addition of 1 μg of YBX1 antibody (Proteintech, USA) and Rabbit IgG (Cell Signaling Technology, USA), and left to stand overnight at 4 °C.

Techniques: Expressing, Gene Expression, Western Blot, Software, Immunohistochemical staining, Staining, Immunohistochemistry

A Identification of LDHA as a potential YBX1-interacting protein by IP/MS analysis. B Protein-protein interaction (PPI) network diagram of YBX1 and LDHA from the GeneMANIA and STRING databases. C Co-IP assay to verify the YBX1-LDHA interaction in ccRCC cell lines. D Immunofluorescence staining to examine the expression of YBX1 and LDHA in ACHN and 786-O cell lines, with confocal microscopy used to observe the co-localization of YBX1 and LDHA. E Molecular docking analysis of the YBX1-LDHA interaction. F Schematic diagram of GFP-tagged YBX1 structural domain peptide fragments. G 786-O cells transfected with GFP-tagged YBX1 or its truncation mutants for 48 h, followed by Co-IP using anti-GFP antibody. H Schematic representation of Flag-tagged LDHA domain protein peptides. I 786-O cells transfected with Flag-tagged LDHA or its truncation mutants for 48 h, followed by Co-IP using anti-Flag antibody. J Assessment of the impact on LDH activity after transfecting YBX1 or its truncated mutants into 786-O cells for 48 h. ** P < 0.01, **** P < 0.0001, ns: no significant difference. One-way ANOVA with correction for multiple comparisons in J. Data are presented as mean ± SD.

Journal: Cell Death & Disease

Article Title: YBX1 orchestrates LDHA-mediated metabolic reprogramming and NF-κB activation to drive clear cell renal cell carcinoma progression

doi: 10.1038/s41419-025-08261-0

Figure Lengend Snippet: A Identification of LDHA as a potential YBX1-interacting protein by IP/MS analysis. B Protein-protein interaction (PPI) network diagram of YBX1 and LDHA from the GeneMANIA and STRING databases. C Co-IP assay to verify the YBX1-LDHA interaction in ccRCC cell lines. D Immunofluorescence staining to examine the expression of YBX1 and LDHA in ACHN and 786-O cell lines, with confocal microscopy used to observe the co-localization of YBX1 and LDHA. E Molecular docking analysis of the YBX1-LDHA interaction. F Schematic diagram of GFP-tagged YBX1 structural domain peptide fragments. G 786-O cells transfected with GFP-tagged YBX1 or its truncation mutants for 48 h, followed by Co-IP using anti-GFP antibody. H Schematic representation of Flag-tagged LDHA domain protein peptides. I 786-O cells transfected with Flag-tagged LDHA or its truncation mutants for 48 h, followed by Co-IP using anti-Flag antibody. J Assessment of the impact on LDH activity after transfecting YBX1 or its truncated mutants into 786-O cells for 48 h. ** P < 0.01, **** P < 0.0001, ns: no significant difference. One-way ANOVA with correction for multiple comparisons in J. Data are presented as mean ± SD.

Article Snippet: After removing the supernatant, 50 μL of Antibody Buffer was added to resuspend the beads-bound cells, followed by the addition of 1 μg of YBX1 antibody (Proteintech, USA) and Rabbit IgG (Cell Signaling Technology, USA), and left to stand overnight at 4 °C.

Techniques: Protein-Protein interactions, Co-Immunoprecipitation Assay, Immunofluorescence, Staining, Expressing, Confocal Microscopy, Transfection, Activity Assay

A qRT-PCR analysis of LDHA mRNA expression levels in ACHN and 786-O cells following YBX1 knockdown and overexpression. B CUT&Tag peak plots and heatmap showing YBX1 binding intensity in ACHN cells. C Pie chart showing the distribution of YBX1 binding regions. D IGV plot showing the occupancy of YBX1 in the LDHA promoter region. E Motif diagram of YBX1 binding sequences from the JASPAR database. F Molecular docking analysis of YBX1 with four predicted binding sites (BS) in the LDHA promoter sequence. G The LDHA promoter sequence was divided into 3 fragments containing the predicted BS, followed by primer design and ChIP-qPCR to verify YBX1 binding to the LDHA promoter region. H The LDHA promoter sequence was divided into 4 fragments, and the BS-1 site that was mainly bound was mutated, the luciferase-tagged truncated plasmids were designed. After co-transfection of the target and control Renilla plasmids into ccRCC cells, YBX1 binding to the LDHA promoter region was verified using dual-luciferase reporter assays. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, ns: no significant difference. Unpaired two-sided Student’s t -test in A, G and H. Data are presented as mean ± SD.

Journal: Cell Death & Disease

Article Title: YBX1 orchestrates LDHA-mediated metabolic reprogramming and NF-κB activation to drive clear cell renal cell carcinoma progression

doi: 10.1038/s41419-025-08261-0

Figure Lengend Snippet: A qRT-PCR analysis of LDHA mRNA expression levels in ACHN and 786-O cells following YBX1 knockdown and overexpression. B CUT&Tag peak plots and heatmap showing YBX1 binding intensity in ACHN cells. C Pie chart showing the distribution of YBX1 binding regions. D IGV plot showing the occupancy of YBX1 in the LDHA promoter region. E Motif diagram of YBX1 binding sequences from the JASPAR database. F Molecular docking analysis of YBX1 with four predicted binding sites (BS) in the LDHA promoter sequence. G The LDHA promoter sequence was divided into 3 fragments containing the predicted BS, followed by primer design and ChIP-qPCR to verify YBX1 binding to the LDHA promoter region. H The LDHA promoter sequence was divided into 4 fragments, and the BS-1 site that was mainly bound was mutated, the luciferase-tagged truncated plasmids were designed. After co-transfection of the target and control Renilla plasmids into ccRCC cells, YBX1 binding to the LDHA promoter region was verified using dual-luciferase reporter assays. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, ns: no significant difference. Unpaired two-sided Student’s t -test in A, G and H. Data are presented as mean ± SD.

Article Snippet: After removing the supernatant, 50 μL of Antibody Buffer was added to resuspend the beads-bound cells, followed by the addition of 1 μg of YBX1 antibody (Proteintech, USA) and Rabbit IgG (Cell Signaling Technology, USA), and left to stand overnight at 4 °C.

Techniques: Quantitative RT-PCR, Expressing, Knockdown, Over Expression, Binding Assay, Sequencing, ChIP-qPCR, Luciferase, Cotransfection, Control

A Western blot analysis of LDHA protein expression levels in ACHN and 786-O cells after YBX1 knockdown and overexpression. B Dual-luciferase reporter assays evaluating the effects of YBX1 and LDHA on glycolysis-related signaling pathways in ccRCC cells co-transfected with target plasmids and control Renilla plasmids. C Western blot analysis of p-p65 (Ser536) and total p65 expression after overexpression of YBX1 and LDHA. D Immunohistochemical staining to detect protein expression of total p65 and p-p65 (Ser536) in tumor tissues from control and YBX1 knockdown groups in nude mice. Representative images and quantification. E, F Western blot ( E ) and qRT-PCR ( F ) analysis of LDHA knockdown efficiency in 786-O cells 72 h post-transfection with si- LDHA . G , H Western blot ( G ) and LDH activity ( H ) analysis of LDHA inhibition in 786-O cells treated with Oxamate (0-80 mM for 48 h). I , J Western blot analysis of p-p65 (Ser536) and total p65 in YBX1-overexpressing cells following LDHA knockdown ( I ) or Oxamate treatment (60 mM for 48 h) ( J ). K-N Lactate production ( K, L ) and cell proliferation ( M , N ) assays in YBX1-overexpressing cells after LDHA knockdown or Oxamate treatment. O Schematic diagram illustrating the YBX1-LDHA-NF-κB mechanism in ccRCC progression. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, ns: no significant difference. Unpaired two-sided Student’s t -test in B , D , F and H . One-way ANOVA with correction for multiple comparisons in K and L. Two-way ANOVA with correction for multiple comparisons in M and N. Data are presented as mean ± SD.

Journal: Cell Death & Disease

Article Title: YBX1 orchestrates LDHA-mediated metabolic reprogramming and NF-κB activation to drive clear cell renal cell carcinoma progression

doi: 10.1038/s41419-025-08261-0

Figure Lengend Snippet: A Western blot analysis of LDHA protein expression levels in ACHN and 786-O cells after YBX1 knockdown and overexpression. B Dual-luciferase reporter assays evaluating the effects of YBX1 and LDHA on glycolysis-related signaling pathways in ccRCC cells co-transfected with target plasmids and control Renilla plasmids. C Western blot analysis of p-p65 (Ser536) and total p65 expression after overexpression of YBX1 and LDHA. D Immunohistochemical staining to detect protein expression of total p65 and p-p65 (Ser536) in tumor tissues from control and YBX1 knockdown groups in nude mice. Representative images and quantification. E, F Western blot ( E ) and qRT-PCR ( F ) analysis of LDHA knockdown efficiency in 786-O cells 72 h post-transfection with si- LDHA . G , H Western blot ( G ) and LDH activity ( H ) analysis of LDHA inhibition in 786-O cells treated with Oxamate (0-80 mM for 48 h). I , J Western blot analysis of p-p65 (Ser536) and total p65 in YBX1-overexpressing cells following LDHA knockdown ( I ) or Oxamate treatment (60 mM for 48 h) ( J ). K-N Lactate production ( K, L ) and cell proliferation ( M , N ) assays in YBX1-overexpressing cells after LDHA knockdown or Oxamate treatment. O Schematic diagram illustrating the YBX1-LDHA-NF-κB mechanism in ccRCC progression. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, ns: no significant difference. Unpaired two-sided Student’s t -test in B , D , F and H . One-way ANOVA with correction for multiple comparisons in K and L. Two-way ANOVA with correction for multiple comparisons in M and N. Data are presented as mean ± SD.

Article Snippet: After removing the supernatant, 50 μL of Antibody Buffer was added to resuspend the beads-bound cells, followed by the addition of 1 μg of YBX1 antibody (Proteintech, USA) and Rabbit IgG (Cell Signaling Technology, USA), and left to stand overnight at 4 °C.

Techniques: Western Blot, Expressing, Knockdown, Over Expression, Luciferase, Protein-Protein interactions, Transfection, Control, Immunohistochemical staining, Staining, Quantitative RT-PCR, Activity Assay, Inhibition

Figure 2. Structure of IMP1 and YBX1 mRNP Granules (A) HeLa cells were stained with anti-IMP1 and anti-YBX1 antibodies followed by Alexa Fluor 488 (green) and Alexa Fluor 647 (red) secondary antibodies, respectively. (A1–A3) Overview of the cell. Scale bars, 5 mm. (A4–A6) Blow-up of IMP1 and YBX1 granules in the indicated area (white square) in (A3). Scale bar, 0.2 mm. (A7) P bodies depicted by DCP1a-EGFP in combination with IMP1 staining and A8, pHcRed-G3BP in stress granules in combination with IMP1 staining. (B) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with ACTB mRNA FISH (cyan) using 48 Quasar 570 dye-labeled oligonucleotides corresponding to the entire ACTB mRNA. (B1–B4) Overview of a HeLa cell. Scale bars, 5 mm. (B5–B9) blow up of ACTB mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B5) and 0.1 mm (B6–B9). (B10–B19) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with GAPDH mRNA FISH (cyan) using 48 Quasar 570 dye-labeled (cyan) oligonucleotides corresponding to the entire GAPDH mRNA. (B10–B14) Overview of a HeLa cell. Scale bars, 5 mm. (B15–B19) Blow-up of GAPDH mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B15) and 0.1 mm (B16–B19). (B20 and B21) Double FISH with ACTB mRNA (red, Quasar 670-conjugated probes) and GAPDH mRNA (green, Quasar 570-conjugated probes) in combination with YBX1 immunostaining (gray, Alexa Fluor 488). (C) EGFP immunoprecipitation of transiently transfected HeLa cells with pEGFP-C1 (control) and pEGFP-IMP1. Immunodetection of GFP and GFP-IMP1, endogenous IMP1, YBX1, and GADPH, respectively, was performed in total lysate and immunoprecipitated (IP) fractions without () or with (+) RNase A treatment.

Journal: Cell reports

Article Title: Single mRNP Analysis Reveals that Small Cytoplasmic mRNP Granules Represent mRNA Singletons.

doi: 10.1016/j.celrep.2019.09.018

Figure Lengend Snippet: Figure 2. Structure of IMP1 and YBX1 mRNP Granules (A) HeLa cells were stained with anti-IMP1 and anti-YBX1 antibodies followed by Alexa Fluor 488 (green) and Alexa Fluor 647 (red) secondary antibodies, respectively. (A1–A3) Overview of the cell. Scale bars, 5 mm. (A4–A6) Blow-up of IMP1 and YBX1 granules in the indicated area (white square) in (A3). Scale bar, 0.2 mm. (A7) P bodies depicted by DCP1a-EGFP in combination with IMP1 staining and A8, pHcRed-G3BP in stress granules in combination with IMP1 staining. (B) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with ACTB mRNA FISH (cyan) using 48 Quasar 570 dye-labeled oligonucleotides corresponding to the entire ACTB mRNA. (B1–B4) Overview of a HeLa cell. Scale bars, 5 mm. (B5–B9) blow up of ACTB mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B5) and 0.1 mm (B6–B9). (B10–B19) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with GAPDH mRNA FISH (cyan) using 48 Quasar 570 dye-labeled (cyan) oligonucleotides corresponding to the entire GAPDH mRNA. (B10–B14) Overview of a HeLa cell. Scale bars, 5 mm. (B15–B19) Blow-up of GAPDH mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B15) and 0.1 mm (B16–B19). (B20 and B21) Double FISH with ACTB mRNA (red, Quasar 670-conjugated probes) and GAPDH mRNA (green, Quasar 570-conjugated probes) in combination with YBX1 immunostaining (gray, Alexa Fluor 488). (C) EGFP immunoprecipitation of transiently transfected HeLa cells with pEGFP-C1 (control) and pEGFP-IMP1. Immunodetection of GFP and GFP-IMP1, endogenous IMP1, YBX1, and GADPH, respectively, was performed in total lysate and immunoprecipitated (IP) fractions without () or with (+) RNase A treatment.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-IMP1 (raised against C-terminal peptide) Nielsen et al., 1999 N/A Goat polyclonal anti-IMP1 Santa Cruz Biotechnology Cat#E-20; RRID: AB_649425 Rabbit polyclonal anti-YBX1 Abcam Cat#ab12148; RRID: AB_2219278 Rabbit polyclonal anti-GAPDH Santa Cruz Biotechnology Cat#FL-335; RRID: AB_10167668 Mouse monoclonal anti-GFP Abcam Cat#ab1218; RRID: AB_298911 Mouse monoclonal anti-Nup153 Abcam Cat#ab24700; RRID: AB_2154467 Mouse monoclonal anti-PABPC1 Abcam Cat#ab6125; RRID: AB_2156878 Chemicals, Peptides, and Recombinant Proteins Recombinant human IMP1 Nielsen et al., 1999 N/A Recombinant human YBX1 Origene Cat#TP309835 Critical Commercial Assays Click-iT Plus OPP Alexa Fluor 488 Protein Synthesis Assay Kit Invitrogen Cat#C10456 Experimental Models: Cell Lines HeLa cell line ATCC CCL-2 Oligonucleotides siRNA against YBX1 30UTR 50 - GAACAGGCCUGGUGGGAAAUU - 30 (sense) 50 - UUUCCCACCAGGCCUGUUCUU 30 (antisense) Eurofins Genomics N/A Stellaris FISH Probes, Human ACTB with Quasar 570 Dye LGC Biosearch Cat#VSMF-2002-5 Stellaris FISH Probes, Human ACTB with Quasar 670 Dye LGC Biosearch Cat#VSMF-2003-5 Stellaris FISH Probes, Human GAPDH with Quasar 570 Dye LGC Biosearch Cat#SMF-2026-1 Recombinant DNA pEGFP-C1 Clontech N/A pEGFP-IMP1 This manuscript N/A pEGFP-IMP1_KH1-4mut This manuscript N/A pcDNA3.1+N-EGFP-YBX1 Genscript N/A pmCherry-YBX1 This manuscript N/A pmEos3.2-IMP1 This manuscript N/A PABPC1-GFP This manuscript N/A DCP1a-GFP This manuscript N/A pHcRed1-G3BP This manuscript N/A Software and Algorithms ZEN 2012 Carl Zeiss Microscopy N/A RStudio R Foundation N/A

Techniques: Staining, Immunostaining, Labeling, Immunoprecipitation, Transfection, Control, Immunodetection

Figure 3. IMP1 and YBX1 mRNP Formation at the Nuclear Pore HeLa cells were stained with anti-IMP1, anti-YBX1, and anti-NUP153 primary antibodies followed by Alexa Fluor 488 (green), Alexa 555 (cyan), and Alexa Fluor 647 (red) secondary antibodies, respectively. Moreover, the nucleus was stained with DAPI (deep blue). (A) Overview of a triple-stained cell and the area that is shown in the blow-up below. Scale bar, 2 mm. (B–E) Individual IMP1 (B), YBX1 (C), NUP153 (D), and DAPI (E) stainings. (F) Composite picture demonstrating the colocalization of NUP153 and the IMP1_YBX1 mRNP. Scale bar, 200 nm. Arrows indicate nuclear pores.

Journal: Cell reports

Article Title: Single mRNP Analysis Reveals that Small Cytoplasmic mRNP Granules Represent mRNA Singletons.

doi: 10.1016/j.celrep.2019.09.018

Figure Lengend Snippet: Figure 3. IMP1 and YBX1 mRNP Formation at the Nuclear Pore HeLa cells were stained with anti-IMP1, anti-YBX1, and anti-NUP153 primary antibodies followed by Alexa Fluor 488 (green), Alexa 555 (cyan), and Alexa Fluor 647 (red) secondary antibodies, respectively. Moreover, the nucleus was stained with DAPI (deep blue). (A) Overview of a triple-stained cell and the area that is shown in the blow-up below. Scale bar, 2 mm. (B–E) Individual IMP1 (B), YBX1 (C), NUP153 (D), and DAPI (E) stainings. (F) Composite picture demonstrating the colocalization of NUP153 and the IMP1_YBX1 mRNP. Scale bar, 200 nm. Arrows indicate nuclear pores.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-IMP1 (raised against C-terminal peptide) Nielsen et al., 1999 N/A Goat polyclonal anti-IMP1 Santa Cruz Biotechnology Cat#E-20; RRID: AB_649425 Rabbit polyclonal anti-YBX1 Abcam Cat#ab12148; RRID: AB_2219278 Rabbit polyclonal anti-GAPDH Santa Cruz Biotechnology Cat#FL-335; RRID: AB_10167668 Mouse monoclonal anti-GFP Abcam Cat#ab1218; RRID: AB_298911 Mouse monoclonal anti-Nup153 Abcam Cat#ab24700; RRID: AB_2154467 Mouse monoclonal anti-PABPC1 Abcam Cat#ab6125; RRID: AB_2156878 Chemicals, Peptides, and Recombinant Proteins Recombinant human IMP1 Nielsen et al., 1999 N/A Recombinant human YBX1 Origene Cat#TP309835 Critical Commercial Assays Click-iT Plus OPP Alexa Fluor 488 Protein Synthesis Assay Kit Invitrogen Cat#C10456 Experimental Models: Cell Lines HeLa cell line ATCC CCL-2 Oligonucleotides siRNA against YBX1 30UTR 50 - GAACAGGCCUGGUGGGAAAUU - 30 (sense) 50 - UUUCCCACCAGGCCUGUUCUU 30 (antisense) Eurofins Genomics N/A Stellaris FISH Probes, Human ACTB with Quasar 570 Dye LGC Biosearch Cat#VSMF-2002-5 Stellaris FISH Probes, Human ACTB with Quasar 670 Dye LGC Biosearch Cat#VSMF-2003-5 Stellaris FISH Probes, Human GAPDH with Quasar 570 Dye LGC Biosearch Cat#SMF-2026-1 Recombinant DNA pEGFP-C1 Clontech N/A pEGFP-IMP1 This manuscript N/A pEGFP-IMP1_KH1-4mut This manuscript N/A pcDNA3.1+N-EGFP-YBX1 Genscript N/A pmCherry-YBX1 This manuscript N/A pmEos3.2-IMP1 This manuscript N/A PABPC1-GFP This manuscript N/A DCP1a-GFP This manuscript N/A pHcRed1-G3BP This manuscript N/A Software and Algorithms ZEN 2012 Carl Zeiss Microscopy N/A RStudio R Foundation N/A

Techniques: Staining

Figure 7. Molecular Composition of IMP1_YBX1 mRNP The number of IMP1, YBX1, and ACTB mRNA molecules in the mRNP were derived from localization microscopy (LM) or from FCS and compared with the average number of binding sites in the transcriptome from eCLIP and RNA immunoprecipitation sequencing analysis. For localization microscopy, cells were stained for IMP1, YBX1, and ACTB mRNA, and following bleaching, mRNP emitted photons were counted as described. (A) Examples of the localization microscopy images of YBX1 (red), IMP1 (green), and ACTB mRNA (cyan), respectively. Scale bar, 100 nm. (B) Counts per particle derived from FCS of cells transfected with GFP, GFP-IMP1_KH1-4mut, GFP-IMP1, GFP-YBX1, and with co-transfection of YBX1 30 UTR- directed siRNA and GFP-YBX1. Laser power was 0.02% in all measurements. (C) Summary of the data from localization microscopy, FCS, and binding sites predicted from either eCLIP (IMP1) or RNA immunoprecipitation sequencing (YBX1) experiments. (D) Immunofluorescence staining of PABPC1 (cyan, Alexa Fluor 488), IMP1 (green, Alexa Fluor 568), and YBX1 (red, Alexa Fluor 647). An overview of a whole HeLa cell is shown in the panel above (scale bar, 5 mm), and a blow-up image of the triple PABPC1, IMP1, and YBX1 staining of the area squared in the panel above is shown below (scale bar, 0.2 mm). Positioning of PABPC1 (cyan) in individual mRNPs depicted by YBX1 (red) staining is shown in the panel below (scale bar, 0.1 mm).

Journal: Cell reports

Article Title: Single mRNP Analysis Reveals that Small Cytoplasmic mRNP Granules Represent mRNA Singletons.

doi: 10.1016/j.celrep.2019.09.018

Figure Lengend Snippet: Figure 7. Molecular Composition of IMP1_YBX1 mRNP The number of IMP1, YBX1, and ACTB mRNA molecules in the mRNP were derived from localization microscopy (LM) or from FCS and compared with the average number of binding sites in the transcriptome from eCLIP and RNA immunoprecipitation sequencing analysis. For localization microscopy, cells were stained for IMP1, YBX1, and ACTB mRNA, and following bleaching, mRNP emitted photons were counted as described. (A) Examples of the localization microscopy images of YBX1 (red), IMP1 (green), and ACTB mRNA (cyan), respectively. Scale bar, 100 nm. (B) Counts per particle derived from FCS of cells transfected with GFP, GFP-IMP1_KH1-4mut, GFP-IMP1, GFP-YBX1, and with co-transfection of YBX1 30 UTR- directed siRNA and GFP-YBX1. Laser power was 0.02% in all measurements. (C) Summary of the data from localization microscopy, FCS, and binding sites predicted from either eCLIP (IMP1) or RNA immunoprecipitation sequencing (YBX1) experiments. (D) Immunofluorescence staining of PABPC1 (cyan, Alexa Fluor 488), IMP1 (green, Alexa Fluor 568), and YBX1 (red, Alexa Fluor 647). An overview of a whole HeLa cell is shown in the panel above (scale bar, 5 mm), and a blow-up image of the triple PABPC1, IMP1, and YBX1 staining of the area squared in the panel above is shown below (scale bar, 0.2 mm). Positioning of PABPC1 (cyan) in individual mRNPs depicted by YBX1 (red) staining is shown in the panel below (scale bar, 0.1 mm).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-IMP1 (raised against C-terminal peptide) Nielsen et al., 1999 N/A Goat polyclonal anti-IMP1 Santa Cruz Biotechnology Cat#E-20; RRID: AB_649425 Rabbit polyclonal anti-YBX1 Abcam Cat#ab12148; RRID: AB_2219278 Rabbit polyclonal anti-GAPDH Santa Cruz Biotechnology Cat#FL-335; RRID: AB_10167668 Mouse monoclonal anti-GFP Abcam Cat#ab1218; RRID: AB_298911 Mouse monoclonal anti-Nup153 Abcam Cat#ab24700; RRID: AB_2154467 Mouse monoclonal anti-PABPC1 Abcam Cat#ab6125; RRID: AB_2156878 Chemicals, Peptides, and Recombinant Proteins Recombinant human IMP1 Nielsen et al., 1999 N/A Recombinant human YBX1 Origene Cat#TP309835 Critical Commercial Assays Click-iT Plus OPP Alexa Fluor 488 Protein Synthesis Assay Kit Invitrogen Cat#C10456 Experimental Models: Cell Lines HeLa cell line ATCC CCL-2 Oligonucleotides siRNA against YBX1 30UTR 50 - GAACAGGCCUGGUGGGAAAUU - 30 (sense) 50 - UUUCCCACCAGGCCUGUUCUU 30 (antisense) Eurofins Genomics N/A Stellaris FISH Probes, Human ACTB with Quasar 570 Dye LGC Biosearch Cat#VSMF-2002-5 Stellaris FISH Probes, Human ACTB with Quasar 670 Dye LGC Biosearch Cat#VSMF-2003-5 Stellaris FISH Probes, Human GAPDH with Quasar 570 Dye LGC Biosearch Cat#SMF-2026-1 Recombinant DNA pEGFP-C1 Clontech N/A pEGFP-IMP1 This manuscript N/A pEGFP-IMP1_KH1-4mut This manuscript N/A pcDNA3.1+N-EGFP-YBX1 Genscript N/A pmCherry-YBX1 This manuscript N/A pmEos3.2-IMP1 This manuscript N/A PABPC1-GFP This manuscript N/A DCP1a-GFP This manuscript N/A pHcRed1-G3BP This manuscript N/A Software and Algorithms ZEN 2012 Carl Zeiss Microscopy N/A RStudio R Foundation N/A

Techniques: Derivative Assay, Microscopy, Binding Assay, RNA Immunoprecipitation, Sequencing, Staining, Transfection, Cotransfection

Figure 1: Immunohistochemical analyses of CDC25a and YBX1 proteins in different subtypes of lung adenocarcinoma. The expression of CDC25a and YBX1 in MIA was detected by IHC assay. MIA, minimally invasive adenocarcinoma; Lep, lepidic predominant adenocarcinoma; Aci, acinar predominant adenocarcinoma; Pap, papillary predominant adenocarcinoma; Mp, micropapillary predominant adenocarcinoma; Sci, solid predominant adenocarcinoma; Mu, mucinous predominant adenocarcinoma.100X magnification of the micrographs as insert in the figure.

Journal: Oncotarget

Article Title: YBX1 regulates tumor growth via CDC25a pathway in human lung adenocarcinoma.

doi: 10.18632/oncotarget.10080

Figure Lengend Snippet: Figure 1: Immunohistochemical analyses of CDC25a and YBX1 proteins in different subtypes of lung adenocarcinoma. The expression of CDC25a and YBX1 in MIA was detected by IHC assay. MIA, minimally invasive adenocarcinoma; Lep, lepidic predominant adenocarcinoma; Aci, acinar predominant adenocarcinoma; Pap, papillary predominant adenocarcinoma; Mp, micropapillary predominant adenocarcinoma; Sci, solid predominant adenocarcinoma; Mu, mucinous predominant adenocarcinoma.100X magnification of the micrographs as insert in the figure.

Article Snippet: The overexpression vector of YBX1 (pcDNA3.1-YBX1) and control vector (pcDNA3.1-vector) plasmids were designed and synthesized by Cyagen (Cyagen Biosciences Inc., China).

Techniques: Immunohistochemical staining, Expressing

Figure 2: CDC25a and YBX1 were highly expressed in lung adenocarcinoma cell lines. A. Co-localization of CDC25a and YBX1 in HLF, A549, H322 and Hcc827 cells by IF assay. Red: YBX1; Green: CDC25a. B,C,D. The expression of CDC25a and YBX1 proteins in total (W), nuclear (N) and cytoplasm (C) protein in lung adenocarcinoma cell lines and HLF cells detected by Western Blot. Expression of CDC25a and YBX1 were calculated relative to the Beta-actin or Histone H3 expression. The quantification of YBX1 and CDC25a was originated from all bands shown in the photograph. The date was repeated three times and presented as the mean±SD (*p<0.05, **p=<0.001 and # p>0.005).

Journal: Oncotarget

Article Title: YBX1 regulates tumor growth via CDC25a pathway in human lung adenocarcinoma.

doi: 10.18632/oncotarget.10080

Figure Lengend Snippet: Figure 2: CDC25a and YBX1 were highly expressed in lung adenocarcinoma cell lines. A. Co-localization of CDC25a and YBX1 in HLF, A549, H322 and Hcc827 cells by IF assay. Red: YBX1; Green: CDC25a. B,C,D. The expression of CDC25a and YBX1 proteins in total (W), nuclear (N) and cytoplasm (C) protein in lung adenocarcinoma cell lines and HLF cells detected by Western Blot. Expression of CDC25a and YBX1 were calculated relative to the Beta-actin or Histone H3 expression. The quantification of YBX1 and CDC25a was originated from all bands shown in the photograph. The date was repeated three times and presented as the mean±SD (*p<0.05, **p=<0.001 and # p>0.005).

Article Snippet: The overexpression vector of YBX1 (pcDNA3.1-YBX1) and control vector (pcDNA3.1-vector) plasmids were designed and synthesized by Cyagen (Cyagen Biosciences Inc., China).

Techniques: Expressing, Western Blot

Figure 3: The scattered/correlation blot between CDC25a and YBX1 expression and survival curves of CDC25a/YBX1 expression, IASLC/ATS/ERS classification and TNM stages in 116 patients with lung adenocarcinoma. A. A scattered/ correlation blot between CDC25a and YBX1 expression in 116 patients. Each number represents a patient. B. The overall 5-year survival rates in the patients with low CDC25a expression and high CDC25a expression were 79.7% and 45.5%, respectively (p=0.004). C. Survival curves of low and high expression of YBX1 was 74.9% and 40.5%, respectively (p=0.044). D. The 5-year survival rates of low, middle and high risk classification risk group was 75.0%, 61.3% and 42.1%, respectively (p=0.037). E. The 5-year survival rates of low TNM stage (I/ II) and high TNM stage (III/IV) was 65.0 and 23.7%, respectively (p<0.001).

Journal: Oncotarget

Article Title: YBX1 regulates tumor growth via CDC25a pathway in human lung adenocarcinoma.

doi: 10.18632/oncotarget.10080

Figure Lengend Snippet: Figure 3: The scattered/correlation blot between CDC25a and YBX1 expression and survival curves of CDC25a/YBX1 expression, IASLC/ATS/ERS classification and TNM stages in 116 patients with lung adenocarcinoma. A. A scattered/ correlation blot between CDC25a and YBX1 expression in 116 patients. Each number represents a patient. B. The overall 5-year survival rates in the patients with low CDC25a expression and high CDC25a expression were 79.7% and 45.5%, respectively (p=0.004). C. Survival curves of low and high expression of YBX1 was 74.9% and 40.5%, respectively (p=0.044). D. The 5-year survival rates of low, middle and high risk classification risk group was 75.0%, 61.3% and 42.1%, respectively (p=0.037). E. The 5-year survival rates of low TNM stage (I/ II) and high TNM stage (III/IV) was 65.0 and 23.7%, respectively (p<0.001).

Article Snippet: The overexpression vector of YBX1 (pcDNA3.1-YBX1) and control vector (pcDNA3.1-vector) plasmids were designed and synthesized by Cyagen (Cyagen Biosciences Inc., China).

Techniques: Expressing

Figure 4: YBX1 bound to CDC25a promoter region and positively regulated its transcriptional activation in lung adenocarcinoma cells. A. Three YBX1-binding possibility regions (indicated by the arrows) were checked in CDC25a promoter (GENE BANK: AJ242714.1). B. A 5’-flanking DNA fragment from position -841 to +336 (-841/+336, -235/+336, -183/+336, -72/+336) of human CDC25a gene was constructed into a promoter less luciferase expression vector pGL3. C. A549 cells were cotransfected with YBX1 and CDC25a promoter-driven luciferase plasmids for 48 hrs. The proteins were extracted, and luciferase activity was detected by luciferase reporter assay kit. pCDNA3.1-vector were negative control. Luciferase activity was detected.

Journal: Oncotarget

Article Title: YBX1 regulates tumor growth via CDC25a pathway in human lung adenocarcinoma.

doi: 10.18632/oncotarget.10080

Figure Lengend Snippet: Figure 4: YBX1 bound to CDC25a promoter region and positively regulated its transcriptional activation in lung adenocarcinoma cells. A. Three YBX1-binding possibility regions (indicated by the arrows) were checked in CDC25a promoter (GENE BANK: AJ242714.1). B. A 5’-flanking DNA fragment from position -841 to +336 (-841/+336, -235/+336, -183/+336, -72/+336) of human CDC25a gene was constructed into a promoter less luciferase expression vector pGL3. C. A549 cells were cotransfected with YBX1 and CDC25a promoter-driven luciferase plasmids for 48 hrs. The proteins were extracted, and luciferase activity was detected by luciferase reporter assay kit. pCDNA3.1-vector were negative control. Luciferase activity was detected.

Article Snippet: The overexpression vector of YBX1 (pcDNA3.1-YBX1) and control vector (pcDNA3.1-vector) plasmids were designed and synthesized by Cyagen (Cyagen Biosciences Inc., China).

Techniques: Activation Assay, Binding Assay, Construct, Luciferase, Expressing, Plasmid Preparation, Activity Assay, Reporter Assay, Negative Control

Figure 5: YBX1 knockdown inhibited the expression of CDC25a and changed its downstream in G1/S checkpoint pathway. A. In accordance with luciferase activity, the ChIP assays were performed in HLF, A549 and H322 cells to confirm the endogenous of YBX1 binding to the CDC25a promoter (-352 to -153 bp) using an anti-YB-1 antibodyor normal rabbit IgG. B. YBX1 knockdown reduced endogenous YBX1 binding to the CDC25a promoter using ChIP assays in A549 and H322 cells. C. RT-PCR assay revealed si-YBX1 inhibited the mRNA expression of YBX1 and CDC25a in A549 and H322 cells. D. G1/S checkpoint pathway was detected by Western blot assay in A549 cells transfected with si-YBX1. E. Thesi-YBX1-transfected A549 and H322 cells stagnated in G0/ G1 phase by cell cycle analysis.

Journal: Oncotarget

Article Title: YBX1 regulates tumor growth via CDC25a pathway in human lung adenocarcinoma.

doi: 10.18632/oncotarget.10080

Figure Lengend Snippet: Figure 5: YBX1 knockdown inhibited the expression of CDC25a and changed its downstream in G1/S checkpoint pathway. A. In accordance with luciferase activity, the ChIP assays were performed in HLF, A549 and H322 cells to confirm the endogenous of YBX1 binding to the CDC25a promoter (-352 to -153 bp) using an anti-YB-1 antibodyor normal rabbit IgG. B. YBX1 knockdown reduced endogenous YBX1 binding to the CDC25a promoter using ChIP assays in A549 and H322 cells. C. RT-PCR assay revealed si-YBX1 inhibited the mRNA expression of YBX1 and CDC25a in A549 and H322 cells. D. G1/S checkpoint pathway was detected by Western blot assay in A549 cells transfected with si-YBX1. E. Thesi-YBX1-transfected A549 and H322 cells stagnated in G0/ G1 phase by cell cycle analysis.

Article Snippet: The overexpression vector of YBX1 (pcDNA3.1-YBX1) and control vector (pcDNA3.1-vector) plasmids were designed and synthesized by Cyagen (Cyagen Biosciences Inc., China).

Techniques: Knockdown, Expressing, Luciferase, Activity Assay, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Western Blot, Transfection, Cell Cycle Assay

Figure 6: YBX1 knockdown inhibited the growth and migration of lung adenocarcinoma cells and induced apoptosis. A. Cell viability was analyzed by MTT in A549 and H322 cells transfected with si-YBX1 at 24 and 48h. The effect on cell viability was assessed as the percent cell viability compared with control-PBS group, which were arbitrarily assigned 100% viability. B. Colony formation assay of A549 and H322 cells transfected with si-YBX1 and its quantification. C. A549 and H322 cells were treated with si- YBX1 and the apoptosis was determined by a FACS analysis. D. Cleaved caspase-3/9 proteins in A549 and H322 cells were respectively analyzed by Western blot. E. Cell migration was analyzed by a wound-healing assay. A549 and H322 cells were seeded in 6-well plates and grown to full confluence. Migration rate was calculated as MR=[initial gap(0h)- terminal gap(48h)/ initial gap(0h)]100%. The date was repeated three times and presented as the mean±SD (*p<0.05,**p=<0.001 and# p>0.005).

Journal: Oncotarget

Article Title: YBX1 regulates tumor growth via CDC25a pathway in human lung adenocarcinoma.

doi: 10.18632/oncotarget.10080

Figure Lengend Snippet: Figure 6: YBX1 knockdown inhibited the growth and migration of lung adenocarcinoma cells and induced apoptosis. A. Cell viability was analyzed by MTT in A549 and H322 cells transfected with si-YBX1 at 24 and 48h. The effect on cell viability was assessed as the percent cell viability compared with control-PBS group, which were arbitrarily assigned 100% viability. B. Colony formation assay of A549 and H322 cells transfected with si-YBX1 and its quantification. C. A549 and H322 cells were treated with si- YBX1 and the apoptosis was determined by a FACS analysis. D. Cleaved caspase-3/9 proteins in A549 and H322 cells were respectively analyzed by Western blot. E. Cell migration was analyzed by a wound-healing assay. A549 and H322 cells were seeded in 6-well plates and grown to full confluence. Migration rate was calculated as MR=[initial gap(0h)- terminal gap(48h)/ initial gap(0h)]100%. The date was repeated three times and presented as the mean±SD (*p<0.05,**p=<0.001 and# p>0.005).

Article Snippet: The overexpression vector of YBX1 (pcDNA3.1-YBX1) and control vector (pcDNA3.1-vector) plasmids were designed and synthesized by Cyagen (Cyagen Biosciences Inc., China).

Techniques: Knockdown, Migration, Transfection, Control, Colony Assay, Western Blot, Wound Healing Assay

Figure 7: YBX1 knockdown inhibited tumor growth by down-regulating CDC25a expression. A. A photo of tumor grafts in nude mice injected with non-specific control siRNA (n=6) or si-YBX1 (n=6) 21 days latter and tumor volume of each group of nude mice was measured by V=(width2×length)/2; **P<0.01. B. The morphology of tumor xenografts in each nude mice after anatomy at 21 days of treatment was shown and tumor weight was analyzed by electronic scales; **P<0.01. C. H&E staining and D. Immunohistochemical analysis of YBX1, CDC25a, Ki 67 and cleaved caspase 3 protein expression in tumor samples.

Journal: Oncotarget

Article Title: YBX1 regulates tumor growth via CDC25a pathway in human lung adenocarcinoma.

doi: 10.18632/oncotarget.10080

Figure Lengend Snippet: Figure 7: YBX1 knockdown inhibited tumor growth by down-regulating CDC25a expression. A. A photo of tumor grafts in nude mice injected with non-specific control siRNA (n=6) or si-YBX1 (n=6) 21 days latter and tumor volume of each group of nude mice was measured by V=(width2×length)/2; **P<0.01. B. The morphology of tumor xenografts in each nude mice after anatomy at 21 days of treatment was shown and tumor weight was analyzed by electronic scales; **P<0.01. C. H&E staining and D. Immunohistochemical analysis of YBX1, CDC25a, Ki 67 and cleaved caspase 3 protein expression in tumor samples.

Article Snippet: The overexpression vector of YBX1 (pcDNA3.1-YBX1) and control vector (pcDNA3.1-vector) plasmids were designed and synthesized by Cyagen (Cyagen Biosciences Inc., China).

Techniques: Knockdown, Expressing, Injection, Control, Staining, Immunohistochemical staining

IP-MS indicates that YBX1 as a direct target of NEK6. (A) The heatmap of identified interacting proteins. (B) IP-western blot analysis validated the interaction of NEK6 and YBX1. (C) The YBX1 mRNA expression in endometrial cancer and normal breast tissues was analyzed based on TCGA databases. (D) the overall survival curve analysis of YBX1 between high and low YBX1 expression group in TCGA EC cohort. (E) The co-localization of NEK6 and YBX1 was assessed by immunofluorescence. Scale bar: 5 μm. (F) Representative immunohistochemical staining of NEK6 and YBX1 in the EC specimens on a TMA (n = 88). Linear regression analysis of the expression of NEK6 and YBX1. (G) YBX1 mRNA was determined by qRT-PCR after NEK6 overexpression knockdown in EC cells. (H) Altered nuclear translocation of YBX1 in response to NEK6 overexpression or knockdown in Ishikawa and HEC-1A cells analyzed by Western blotting. (I) The expression of YBX1 in nucleus and cytoplasm of NEK6-overexpressing HEC-1A cells were shown by Western blot. (J) immunofluorescence assay was performed to observe the localization of YBX1 in HEC-1A cells.

Journal: Frontiers in Pharmacology

Article Title: Genome-wide CRISPR screen identified NEK6 as a determinant of sensitivity to CDK4/6 inhibitor in endometrial cancer

doi: 10.3389/fphar.2025.1725886

Figure Lengend Snippet: IP-MS indicates that YBX1 as a direct target of NEK6. (A) The heatmap of identified interacting proteins. (B) IP-western blot analysis validated the interaction of NEK6 and YBX1. (C) The YBX1 mRNA expression in endometrial cancer and normal breast tissues was analyzed based on TCGA databases. (D) the overall survival curve analysis of YBX1 between high and low YBX1 expression group in TCGA EC cohort. (E) The co-localization of NEK6 and YBX1 was assessed by immunofluorescence. Scale bar: 5 μm. (F) Representative immunohistochemical staining of NEK6 and YBX1 in the EC specimens on a TMA (n = 88). Linear regression analysis of the expression of NEK6 and YBX1. (G) YBX1 mRNA was determined by qRT-PCR after NEK6 overexpression knockdown in EC cells. (H) Altered nuclear translocation of YBX1 in response to NEK6 overexpression or knockdown in Ishikawa and HEC-1A cells analyzed by Western blotting. (I) The expression of YBX1 in nucleus and cytoplasm of NEK6-overexpressing HEC-1A cells were shown by Western blot. (J) immunofluorescence assay was performed to observe the localization of YBX1 in HEC-1A cells.

Article Snippet: pRSET YBX1 plasmid was purchased from addgene (#13035, Cambridge, MA, United States).

Techniques: Protein-Protein interactions, Western Blot, Expressing, Immunofluorescence, Immunohistochemical staining, Staining, Quantitative RT-PCR, Over Expression, Knockdown, Translocation Assay

YBX1 regulates the transcription of CDK2 and bcl2. (A) The chart describes region types of YBX1 binding sites in genome. (B) KEGG analyses of the significant genes identified via ChIP-seq. (C) The top 10 target genes most likely regulated by YBX1. (D) Genome browser representation of YBX1 peaks at the promoters of CDK2 and bcl2. (E,F) ChIP-qPCR analysis showed that YBX1 specifically bound to the promoter region of CDK2 and bcl2, and NEK6 knockdown could decreased the binding of YBX1 to the promoter region of CDK2 and bcl2. (G) Luciferase reporter assay in 293T cells when YBX1 was overexpressed. (H) Luciferase reporter assay in 293T cells when YBX1 was knocked down. (I) the CDK2 and bcl2 mRNA level was determined by qRT-PCR after YBX1 knockdown in HEC-1A cells. (J) The inhibition of YBX1 sensitizes HEC-1A cells to palbociclib. (K) The inhibition of YBX1 sensitizes Ishikawa cells to palbociclib. *, P < 0.05; **, P < 0.01; ***P < 0.001; ns, not significant.

Journal: Frontiers in Pharmacology

Article Title: Genome-wide CRISPR screen identified NEK6 as a determinant of sensitivity to CDK4/6 inhibitor in endometrial cancer

doi: 10.3389/fphar.2025.1725886

Figure Lengend Snippet: YBX1 regulates the transcription of CDK2 and bcl2. (A) The chart describes region types of YBX1 binding sites in genome. (B) KEGG analyses of the significant genes identified via ChIP-seq. (C) The top 10 target genes most likely regulated by YBX1. (D) Genome browser representation of YBX1 peaks at the promoters of CDK2 and bcl2. (E,F) ChIP-qPCR analysis showed that YBX1 specifically bound to the promoter region of CDK2 and bcl2, and NEK6 knockdown could decreased the binding of YBX1 to the promoter region of CDK2 and bcl2. (G) Luciferase reporter assay in 293T cells when YBX1 was overexpressed. (H) Luciferase reporter assay in 293T cells when YBX1 was knocked down. (I) the CDK2 and bcl2 mRNA level was determined by qRT-PCR after YBX1 knockdown in HEC-1A cells. (J) The inhibition of YBX1 sensitizes HEC-1A cells to palbociclib. (K) The inhibition of YBX1 sensitizes Ishikawa cells to palbociclib. *, P < 0.05; **, P < 0.01; ***P < 0.001; ns, not significant.

Article Snippet: pRSET YBX1 plasmid was purchased from addgene (#13035, Cambridge, MA, United States).

Techniques: Binding Assay, ChIP-sequencing, ChIP-qPCR, Knockdown, Luciferase, Reporter Assay, Quantitative RT-PCR, Inhibition

Primer sequences in this paper

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: BRD7 suppresses invasion and metastasis in breast cancer by negatively regulating YB1-induced epithelial-mesenchymal transition

doi: 10.1186/s13046-019-1493-4

Figure Lengend Snippet: Primer sequences in this paper

Article Snippet: Antibodies against anti-BRD7 (51009–2-AP, proteintech, 1:1000 dilution), anti-YB1 (CY5462, Abways Technology, 1:1000 dilution), anti-Phospho-YB1 (Ser102) Antibody (CSB-PA204680, Cusabio, 1:1000 dilution), anti-HA (561–7, MBL, 1:1000 dilution), anti-Flag (F3040, Sigma-Aldrich, 1:1000 dilution), anti-Vimentin (ARG66302, arigo, 1:1000 dilution, 1:200 dilution for IF), anti-Snail (C15D3, CST, 1:1000 dilution), anti-E-cadherin (24E10, CST, 1:1000 dilution), anti-Claudin1 (D5H1D, CST, 1:1000 dilution, 1:50 dilution for IF) and anti-GAPDH (10494–1-AP, proteintech, 1:20000 dilution).

Techniques:

BRD7 interacts with YB1. a Coomassie blue staining of co-immunoprecipitation using anti-IgG or anti-flag antibodies in BRD7 overexpression HEK293T cells. b Quantification of YB1 expression in TCGA BRCA database ( n = 823) of different clinical types (Luminal, her2 positive and triple negative types). c Km-plot analysis of YB1 expression and survival of breast cancer patients consist of 1976 patients in YB1 low expression group and 1975 patients in YB1 high expression group. d Co-immunoprecipitation (top) using anti-flag antibodies in flag-BRD7 overexpressed of HEK293T, MDA231 and MCF7 cells and western blotting analysis of flag and YB1. Co-immunoprecipitation (down) using anti-HA antibodies in HEK293T, MDA231 and MCF7 cells of flag-BRD7 and HA-YB1 overexpression and western blotting analysis of HA and flag. e IF using anti-flag or anti-YB1 antibodies in MDA231 cells of flag-BRD7 overexpression. f Schematic illustration of different extents of brd7 mutants. g Co-immunoprecipitation using anti-flag antibodies in HEK293T cells co-transfected with HA-BRD7 deletion mutants and flag-YB1 and western blotting analysis of HA and flag. h Schematic illustration of different extents of YB1 mutants. i Co-immunoprecipitation using anti-flag antibodies in HEK293T cells co-transfected with flag-YB1 deletion mutants and HA-BRD7. Western blotting analysis of flag and HA

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: BRD7 suppresses invasion and metastasis in breast cancer by negatively regulating YB1-induced epithelial-mesenchymal transition

doi: 10.1186/s13046-019-1493-4

Figure Lengend Snippet: BRD7 interacts with YB1. a Coomassie blue staining of co-immunoprecipitation using anti-IgG or anti-flag antibodies in BRD7 overexpression HEK293T cells. b Quantification of YB1 expression in TCGA BRCA database ( n = 823) of different clinical types (Luminal, her2 positive and triple negative types). c Km-plot analysis of YB1 expression and survival of breast cancer patients consist of 1976 patients in YB1 low expression group and 1975 patients in YB1 high expression group. d Co-immunoprecipitation (top) using anti-flag antibodies in flag-BRD7 overexpressed of HEK293T, MDA231 and MCF7 cells and western blotting analysis of flag and YB1. Co-immunoprecipitation (down) using anti-HA antibodies in HEK293T, MDA231 and MCF7 cells of flag-BRD7 and HA-YB1 overexpression and western blotting analysis of HA and flag. e IF using anti-flag or anti-YB1 antibodies in MDA231 cells of flag-BRD7 overexpression. f Schematic illustration of different extents of brd7 mutants. g Co-immunoprecipitation using anti-flag antibodies in HEK293T cells co-transfected with HA-BRD7 deletion mutants and flag-YB1 and western blotting analysis of HA and flag. h Schematic illustration of different extents of YB1 mutants. i Co-immunoprecipitation using anti-flag antibodies in HEK293T cells co-transfected with flag-YB1 deletion mutants and HA-BRD7. Western blotting analysis of flag and HA

Article Snippet: Antibodies against anti-BRD7 (51009–2-AP, proteintech, 1:1000 dilution), anti-YB1 (CY5462, Abways Technology, 1:1000 dilution), anti-Phospho-YB1 (Ser102) Antibody (CSB-PA204680, Cusabio, 1:1000 dilution), anti-HA (561–7, MBL, 1:1000 dilution), anti-Flag (F3040, Sigma-Aldrich, 1:1000 dilution), anti-Vimentin (ARG66302, arigo, 1:1000 dilution, 1:200 dilution for IF), anti-Snail (C15D3, CST, 1:1000 dilution), anti-E-cadherin (24E10, CST, 1:1000 dilution), anti-Claudin1 (D5H1D, CST, 1:1000 dilution, 1:50 dilution for IF) and anti-GAPDH (10494–1-AP, proteintech, 1:20000 dilution).

Techniques: Staining, Immunoprecipitation, Over Expression, Expressing, Western Blot, Transfection

BRD7 induces ubiquitination degradation of YB1 depended on YB1 Ser102 phosphorylation. a Western blotting analysis of BRD7 and YB1 in MDA231 and MCF7 cells with BRD7 overexpression. b qPCR analysis of YB1 in BRD7 overexpression of MDA231 and MCF7 cells. c Western blotting analysis of Flag-BRD7 and YB1 in BRD7 overexpressed MDA231 cells treated with or without MG132 (20 μM) for 4 h. d Co-immunoprecipitation using anti-YB1 antibodies in MDA231 cells co-transfected Ub with flag-BRD7 or control and treated with or without MG132(20 μM) for 4 h. Western blotting analysis of Ub and YB1. e Western blotting analysis of BRD7 and p-YB1ser 102 in MDA231 and MCF7 cells transfected with BRD7. f Co-immunoprecipitation using anti-flag antibodies in HEK293T cells co-transfected by BRD7 along with either YB1 wild-type or YB1 mutant plus HA-ubiquitin for 48 h, treated with MG132(20 μM) for 4 h. Western blotting analysis of Ub, flag, HA, p-YB1 and GAPDH

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: BRD7 suppresses invasion and metastasis in breast cancer by negatively regulating YB1-induced epithelial-mesenchymal transition

doi: 10.1186/s13046-019-1493-4

Figure Lengend Snippet: BRD7 induces ubiquitination degradation of YB1 depended on YB1 Ser102 phosphorylation. a Western blotting analysis of BRD7 and YB1 in MDA231 and MCF7 cells with BRD7 overexpression. b qPCR analysis of YB1 in BRD7 overexpression of MDA231 and MCF7 cells. c Western blotting analysis of Flag-BRD7 and YB1 in BRD7 overexpressed MDA231 cells treated with or without MG132 (20 μM) for 4 h. d Co-immunoprecipitation using anti-YB1 antibodies in MDA231 cells co-transfected Ub with flag-BRD7 or control and treated with or without MG132(20 μM) for 4 h. Western blotting analysis of Ub and YB1. e Western blotting analysis of BRD7 and p-YB1ser 102 in MDA231 and MCF7 cells transfected with BRD7. f Co-immunoprecipitation using anti-flag antibodies in HEK293T cells co-transfected by BRD7 along with either YB1 wild-type or YB1 mutant plus HA-ubiquitin for 48 h, treated with MG132(20 μM) for 4 h. Western blotting analysis of Ub, flag, HA, p-YB1 and GAPDH

Article Snippet: Antibodies against anti-BRD7 (51009–2-AP, proteintech, 1:1000 dilution), anti-YB1 (CY5462, Abways Technology, 1:1000 dilution), anti-Phospho-YB1 (Ser102) Antibody (CSB-PA204680, Cusabio, 1:1000 dilution), anti-HA (561–7, MBL, 1:1000 dilution), anti-Flag (F3040, Sigma-Aldrich, 1:1000 dilution), anti-Vimentin (ARG66302, arigo, 1:1000 dilution, 1:200 dilution for IF), anti-Snail (C15D3, CST, 1:1000 dilution), anti-E-cadherin (24E10, CST, 1:1000 dilution), anti-Claudin1 (D5H1D, CST, 1:1000 dilution, 1:50 dilution for IF) and anti-GAPDH (10494–1-AP, proteintech, 1:20000 dilution).

Techniques: Ubiquitin Proteomics, Phospho-proteomics, Western Blot, Over Expression, Immunoprecipitation, Transfection, Control, Mutagenesis

BRD7 inhibits the process of EMT. a GSEA analysis of microarray data from BRD7 overexpressed (left), YB1 knockdown (middle) or YB1 overexpressed cells (right) and control. b qPCR analysis of E-cadherin, Claudin1, vimentin and Snail in MDA231 cells with BRD7 overexpression. Data represent means ± SEMs. ns, p > 0.05; *, p < 0.05; **, p < 0.01; ***, p < 0.001. c qPCR analysis of E-cadherin, Claudin1, vimentin and Snail in MDA231 cells with BRD7 inhibition. Data represent means ± SEMs. ns, p > 0.05; *, p < 0.05; **, p < 0.01; ***, p < 0.001. d Immunoblots of BRD7, E-cadherin, Claudin1, vimentin and Snail in MDA231 and MCF7 cells with BRD7 overexpression or in MDA231 cells with BRD7 knock-down

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: BRD7 suppresses invasion and metastasis in breast cancer by negatively regulating YB1-induced epithelial-mesenchymal transition

doi: 10.1186/s13046-019-1493-4

Figure Lengend Snippet: BRD7 inhibits the process of EMT. a GSEA analysis of microarray data from BRD7 overexpressed (left), YB1 knockdown (middle) or YB1 overexpressed cells (right) and control. b qPCR analysis of E-cadherin, Claudin1, vimentin and Snail in MDA231 cells with BRD7 overexpression. Data represent means ± SEMs. ns, p > 0.05; *, p < 0.05; **, p < 0.01; ***, p < 0.001. c qPCR analysis of E-cadherin, Claudin1, vimentin and Snail in MDA231 cells with BRD7 inhibition. Data represent means ± SEMs. ns, p > 0.05; *, p < 0.05; **, p < 0.01; ***, p < 0.001. d Immunoblots of BRD7, E-cadherin, Claudin1, vimentin and Snail in MDA231 and MCF7 cells with BRD7 overexpression or in MDA231 cells with BRD7 knock-down

Article Snippet: Antibodies against anti-BRD7 (51009–2-AP, proteintech, 1:1000 dilution), anti-YB1 (CY5462, Abways Technology, 1:1000 dilution), anti-Phospho-YB1 (Ser102) Antibody (CSB-PA204680, Cusabio, 1:1000 dilution), anti-HA (561–7, MBL, 1:1000 dilution), anti-Flag (F3040, Sigma-Aldrich, 1:1000 dilution), anti-Vimentin (ARG66302, arigo, 1:1000 dilution, 1:200 dilution for IF), anti-Snail (C15D3, CST, 1:1000 dilution), anti-E-cadherin (24E10, CST, 1:1000 dilution), anti-Claudin1 (D5H1D, CST, 1:1000 dilution, 1:50 dilution for IF) and anti-GAPDH (10494–1-AP, proteintech, 1:20000 dilution).

Techniques: Microarray, Knockdown, Control, Over Expression, Inhibition, Western Blot

YB1 antagonizes the inhibitory effect of BRD7 on cell proliferation, migration and invasion. a and b CCK8 analysis of cell proliferation in MDA231 and MCF7 cells stably with BRD7 overexpression, BRD7 and YB1 simultaneous overexpression or control group. Data represent means ± SDs. *, p < 0.01. c Scratch wound healing analysis of cell migration in MDA231 cells with BRD7 overexpression, BRD7 and YB1 simultaneous overexpression or control. Quantification of wound recovery rate of the three groups (right). Data represent means ± SEMs. **, p < 0.01; ***, p < 0.001. d Matrigel invasion analysis of cell invasive capabilities in MDA231 and MCF7 cells with BRD7 overexpression, BRD7 and YB1 simultaneous overexpression or control. Data represent means ± SDs. **, p < 0.01. e Western blotting analysis of the expression of BRD7, YB1, E-cadherin, Claudin1, vimentin, Snail and p21 in BRD7 overexpression and YB1 restoration cells

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: BRD7 suppresses invasion and metastasis in breast cancer by negatively regulating YB1-induced epithelial-mesenchymal transition

doi: 10.1186/s13046-019-1493-4

Figure Lengend Snippet: YB1 antagonizes the inhibitory effect of BRD7 on cell proliferation, migration and invasion. a and b CCK8 analysis of cell proliferation in MDA231 and MCF7 cells stably with BRD7 overexpression, BRD7 and YB1 simultaneous overexpression or control group. Data represent means ± SDs. *, p < 0.01. c Scratch wound healing analysis of cell migration in MDA231 cells with BRD7 overexpression, BRD7 and YB1 simultaneous overexpression or control. Quantification of wound recovery rate of the three groups (right). Data represent means ± SEMs. **, p < 0.01; ***, p < 0.001. d Matrigel invasion analysis of cell invasive capabilities in MDA231 and MCF7 cells with BRD7 overexpression, BRD7 and YB1 simultaneous overexpression or control. Data represent means ± SDs. **, p < 0.01. e Western blotting analysis of the expression of BRD7, YB1, E-cadherin, Claudin1, vimentin, Snail and p21 in BRD7 overexpression and YB1 restoration cells

Article Snippet: Antibodies against anti-BRD7 (51009–2-AP, proteintech, 1:1000 dilution), anti-YB1 (CY5462, Abways Technology, 1:1000 dilution), anti-Phospho-YB1 (Ser102) Antibody (CSB-PA204680, Cusabio, 1:1000 dilution), anti-HA (561–7, MBL, 1:1000 dilution), anti-Flag (F3040, Sigma-Aldrich, 1:1000 dilution), anti-Vimentin (ARG66302, arigo, 1:1000 dilution, 1:200 dilution for IF), anti-Snail (C15D3, CST, 1:1000 dilution), anti-E-cadherin (24E10, CST, 1:1000 dilution), anti-Claudin1 (D5H1D, CST, 1:1000 dilution, 1:50 dilution for IF) and anti-GAPDH (10494–1-AP, proteintech, 1:20000 dilution).

Techniques: Migration, Stable Transfection, Over Expression, Control, Western Blot, Expressing

BRD7 suppresses tumor growth and reduces lung metastasis through YB1 in vivo. a , b and c Tumor volume, image and tumor weight of nude mice with MDA231 cells in xenograft model, n = 5 mice per group. Data represent means ± SDs. **, p < 0.01. d Representative image of macroscopic mouse lung tissue in the metastatic tumor model, n = 11 mice per group. e Representative image of lung metastasis samples by H&E staining is shown in control, BRD7 overexpression and YB1 restoration group. Red arrows indicate metastatic tumors, scale bar, 200 μm. The number of metastatic lung nodules of every mouse per group were counted in microscopy. Data represent means ± SDs. **, p < 0.01; ***, p < 0.001. f Primary tumor samples for IHC analysis of the expression of BRD7, YB1, Ki67 in control, BRD7 overexpression and YB1 restoration group, scale bar, 20 μm. h Primary tumor samples for IHC analysis of the expression of EMT markers E-cadherin and vimentin, scale bar, 20 μm

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: BRD7 suppresses invasion and metastasis in breast cancer by negatively regulating YB1-induced epithelial-mesenchymal transition

doi: 10.1186/s13046-019-1493-4

Figure Lengend Snippet: BRD7 suppresses tumor growth and reduces lung metastasis through YB1 in vivo. a , b and c Tumor volume, image and tumor weight of nude mice with MDA231 cells in xenograft model, n = 5 mice per group. Data represent means ± SDs. **, p < 0.01. d Representative image of macroscopic mouse lung tissue in the metastatic tumor model, n = 11 mice per group. e Representative image of lung metastasis samples by H&E staining is shown in control, BRD7 overexpression and YB1 restoration group. Red arrows indicate metastatic tumors, scale bar, 200 μm. The number of metastatic lung nodules of every mouse per group were counted in microscopy. Data represent means ± SDs. **, p < 0.01; ***, p < 0.001. f Primary tumor samples for IHC analysis of the expression of BRD7, YB1, Ki67 in control, BRD7 overexpression and YB1 restoration group, scale bar, 20 μm. h Primary tumor samples for IHC analysis of the expression of EMT markers E-cadherin and vimentin, scale bar, 20 μm

Article Snippet: Antibodies against anti-BRD7 (51009–2-AP, proteintech, 1:1000 dilution), anti-YB1 (CY5462, Abways Technology, 1:1000 dilution), anti-Phospho-YB1 (Ser102) Antibody (CSB-PA204680, Cusabio, 1:1000 dilution), anti-HA (561–7, MBL, 1:1000 dilution), anti-Flag (F3040, Sigma-Aldrich, 1:1000 dilution), anti-Vimentin (ARG66302, arigo, 1:1000 dilution, 1:200 dilution for IF), anti-Snail (C15D3, CST, 1:1000 dilution), anti-E-cadherin (24E10, CST, 1:1000 dilution), anti-Claudin1 (D5H1D, CST, 1:1000 dilution, 1:50 dilution for IF) and anti-GAPDH (10494–1-AP, proteintech, 1:20000 dilution).

Techniques: In Vivo, Staining, Control, Over Expression, Microscopy, Expressing

BRD7 is negatively correlated with YB1 in breast cancer. a YB1 expression was determined in normal ( n = 43) and tumor samples ( n = 220) by IHC. b YB1 expression in different T stages of breast cancer. c and d Kaplan-Meier curves showed the overall survival of breast cancer patients. High or low expression of YB1, and low BRD7 plus high YB1 level and high BRD7 plus low YB1 level. e The correlation between BRD7 and YB1 was performed based on chi-square test. f Schematic representation of molecular mechanism of BRD7 in suppressing tumor growth and metastasis

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: BRD7 suppresses invasion and metastasis in breast cancer by negatively regulating YB1-induced epithelial-mesenchymal transition

doi: 10.1186/s13046-019-1493-4

Figure Lengend Snippet: BRD7 is negatively correlated with YB1 in breast cancer. a YB1 expression was determined in normal ( n = 43) and tumor samples ( n = 220) by IHC. b YB1 expression in different T stages of breast cancer. c and d Kaplan-Meier curves showed the overall survival of breast cancer patients. High or low expression of YB1, and low BRD7 plus high YB1 level and high BRD7 plus low YB1 level. e The correlation between BRD7 and YB1 was performed based on chi-square test. f Schematic representation of molecular mechanism of BRD7 in suppressing tumor growth and metastasis

Article Snippet: Antibodies against anti-BRD7 (51009–2-AP, proteintech, 1:1000 dilution), anti-YB1 (CY5462, Abways Technology, 1:1000 dilution), anti-Phospho-YB1 (Ser102) Antibody (CSB-PA204680, Cusabio, 1:1000 dilution), anti-HA (561–7, MBL, 1:1000 dilution), anti-Flag (F3040, Sigma-Aldrich, 1:1000 dilution), anti-Vimentin (ARG66302, arigo, 1:1000 dilution, 1:200 dilution for IF), anti-Snail (C15D3, CST, 1:1000 dilution), anti-E-cadherin (24E10, CST, 1:1000 dilution), anti-Claudin1 (D5H1D, CST, 1:1000 dilution, 1:50 dilution for IF) and anti-GAPDH (10494–1-AP, proteintech, 1:20000 dilution).

Techniques: Expressing

The association between BRD7,  YB1  expression and clinicopathologic features of breast cancer

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: BRD7 suppresses invasion and metastasis in breast cancer by negatively regulating YB1-induced epithelial-mesenchymal transition

doi: 10.1186/s13046-019-1493-4

Figure Lengend Snippet: The association between BRD7, YB1 expression and clinicopathologic features of breast cancer

Article Snippet: Antibodies against anti-BRD7 (51009–2-AP, proteintech, 1:1000 dilution), anti-YB1 (CY5462, Abways Technology, 1:1000 dilution), anti-Phospho-YB1 (Ser102) Antibody (CSB-PA204680, Cusabio, 1:1000 dilution), anti-HA (561–7, MBL, 1:1000 dilution), anti-Flag (F3040, Sigma-Aldrich, 1:1000 dilution), anti-Vimentin (ARG66302, arigo, 1:1000 dilution, 1:200 dilution for IF), anti-Snail (C15D3, CST, 1:1000 dilution), anti-E-cadherin (24E10, CST, 1:1000 dilution), anti-Claudin1 (D5H1D, CST, 1:1000 dilution, 1:50 dilution for IF) and anti-GAPDH (10494–1-AP, proteintech, 1:20000 dilution).

Techniques: Expressing

A Quantitative RT‒PCR analysis confirmed the effect of YBX1 on TAGLN2-mediated ISG upregulation. B The endogenous interaction between TAGLN2 and the YBX1 promoter was evaluated by ChIP‒qPCR in BGC-823 cells. C The dual-luciferase reporter assay results showed that overexpression of TAGLN2 activated the transcriptional activity of YBX1 by binding to the promoter region (−334 to −1 bp). D The transcriptional regulation effect of YBX1 and 11 candidate transcription factors (ETV4, E2F1, GATA4, ELK1, ZNF263, TFAP2A, TEAD4, c-Myc, SOX9, SP1 and Twist) was evaluated by luciferase reporter assays in both BGC-823 and MGC-803 cells. YBX1-8 promoter region was abbreviated as Y8 for short. E Co-IP assays demonstrated that SOX9 and c-Myc, but not SP1, interacted with TAGLN2. * P < 0.05, ** P < 0.01, *** P < 0.001.

Journal: Cell Death & Disease

Article Title: TAGLN2 induces resistance signature ISGs by activating AKT-YBX1 signal with dual pathways and mediates the IFN-related DNA damage resistance in gastric cancer

doi: 10.1038/s41419-024-07000-1

Figure Lengend Snippet: A Quantitative RT‒PCR analysis confirmed the effect of YBX1 on TAGLN2-mediated ISG upregulation. B The endogenous interaction between TAGLN2 and the YBX1 promoter was evaluated by ChIP‒qPCR in BGC-823 cells. C The dual-luciferase reporter assay results showed that overexpression of TAGLN2 activated the transcriptional activity of YBX1 by binding to the promoter region (−334 to −1 bp). D The transcriptional regulation effect of YBX1 and 11 candidate transcription factors (ETV4, E2F1, GATA4, ELK1, ZNF263, TFAP2A, TEAD4, c-Myc, SOX9, SP1 and Twist) was evaluated by luciferase reporter assays in both BGC-823 and MGC-803 cells. YBX1-8 promoter region was abbreviated as Y8 for short. E Co-IP assays demonstrated that SOX9 and c-Myc, but not SP1, interacted with TAGLN2. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: After deparaffinization in xylene, rehydration through graded alcohols, and heat treatment for antigen retrieval, slides were then blocked and stained with one of the following antibodies to process immunofluorescence staining for 1 h: TAGLN2 (1:500), YBX1 (1:4000, Novus Biologicals), and CK (1:2, Abcarta Medtech Co., Ltd, China).

Techniques: Luciferase, Reporter Assay, Over Expression, Activity Assay, Binding Assay, Co-Immunoprecipitation Assay

A , B The endogenous interaction between SOX9 or c-Myc and the YBX1 promoter was identified by ChIP-qPCR and agarose gel electrophoresis. C The critical role of TAGLN2 in upregulating the expression of YBX1 at the transcriptional level was identified by luciferase reporter assay in MGC-803 cells. D Quantitative RT-PCR analysis showed that overexpression or downregulation of either c-Myc or SOX9 resulted in a substantial increase or decrease in the expression levels of YBX1 and five representative ISGs in both BGC-823 and MGC-803 cells, respectively. E Modulation of the expression of c-Myc , TAGLN2 , SOX9 or YBX1 influenced the expression of pISRE-TA-Luc, as determined by luciferase reporter assay. F Luciferase reporter assay was used to analyze the expression of pISRE-TA-Luc by modulating the proteins involved in the cGAS-STING pathway, including cGAS , STING , IRF3 and IFNAR . G Expression of PDL1 was detected in BGC-823 cells with YBX1 or TAGLN2 overexpression, or TAGLN2 overexpression meanwhile si cGAS , si STING , si IRF3 or si IFNAR treatment. * P < 0.05, ** P < 0.01, *** P < 0.001.

Journal: Cell Death & Disease

Article Title: TAGLN2 induces resistance signature ISGs by activating AKT-YBX1 signal with dual pathways and mediates the IFN-related DNA damage resistance in gastric cancer

doi: 10.1038/s41419-024-07000-1

Figure Lengend Snippet: A , B The endogenous interaction between SOX9 or c-Myc and the YBX1 promoter was identified by ChIP-qPCR and agarose gel electrophoresis. C The critical role of TAGLN2 in upregulating the expression of YBX1 at the transcriptional level was identified by luciferase reporter assay in MGC-803 cells. D Quantitative RT-PCR analysis showed that overexpression or downregulation of either c-Myc or SOX9 resulted in a substantial increase or decrease in the expression levels of YBX1 and five representative ISGs in both BGC-823 and MGC-803 cells, respectively. E Modulation of the expression of c-Myc , TAGLN2 , SOX9 or YBX1 influenced the expression of pISRE-TA-Luc, as determined by luciferase reporter assay. F Luciferase reporter assay was used to analyze the expression of pISRE-TA-Luc by modulating the proteins involved in the cGAS-STING pathway, including cGAS , STING , IRF3 and IFNAR . G Expression of PDL1 was detected in BGC-823 cells with YBX1 or TAGLN2 overexpression, or TAGLN2 overexpression meanwhile si cGAS , si STING , si IRF3 or si IFNAR treatment. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: After deparaffinization in xylene, rehydration through graded alcohols, and heat treatment for antigen retrieval, slides were then blocked and stained with one of the following antibodies to process immunofluorescence staining for 1 h: TAGLN2 (1:500), YBX1 (1:4000, Novus Biologicals), and CK (1:2, Abcarta Medtech Co., Ltd, China).

Techniques: ChIP-qPCR, Agarose Gel Electrophoresis, Expressing, Luciferase, Reporter Assay, Quantitative RT-PCR, Over Expression

A The interaction between TAGLN2 and YBX1 was tested in both endogenous and exogenous Co-IP assays. B Various fragments of TAGLN2 and YBX1 were constructed to identify the molecular mechanism underlying the interaction of TAGLN2, YBX1 and AKT by Co-IP assay. C Purified HA-YBX1, Flag-TAGLN2 and GST-AKT proteins were prepared for the in vitro pull-down assay. An enhanced interaction between YBX1 and AKT was observed when the TAGLN2 protein input was increased from 100 μg to 200 μg. D Fisetin (2 nM or 4 nM) was used to suppress the interaction between AKT and YBX1. E TAGLN2 regulated the level of YBX1 phosphorylation and enhanced its cytoplasmic to nuclear translocation, followed by type I IFN activation. F Western blot analysis of total YBX1 and p -YBX1 for cytoplasmic and nuclear protein separation from BGC-823 cells transfected either with long-length TAGLN2, the fragment containing the complete CH domain (aa 47~153) or part of the CH domain (aa 107~219).

Journal: Cell Death & Disease

Article Title: TAGLN2 induces resistance signature ISGs by activating AKT-YBX1 signal with dual pathways and mediates the IFN-related DNA damage resistance in gastric cancer

doi: 10.1038/s41419-024-07000-1

Figure Lengend Snippet: A The interaction between TAGLN2 and YBX1 was tested in both endogenous and exogenous Co-IP assays. B Various fragments of TAGLN2 and YBX1 were constructed to identify the molecular mechanism underlying the interaction of TAGLN2, YBX1 and AKT by Co-IP assay. C Purified HA-YBX1, Flag-TAGLN2 and GST-AKT proteins were prepared for the in vitro pull-down assay. An enhanced interaction between YBX1 and AKT was observed when the TAGLN2 protein input was increased from 100 μg to 200 μg. D Fisetin (2 nM or 4 nM) was used to suppress the interaction between AKT and YBX1. E TAGLN2 regulated the level of YBX1 phosphorylation and enhanced its cytoplasmic to nuclear translocation, followed by type I IFN activation. F Western blot analysis of total YBX1 and p -YBX1 for cytoplasmic and nuclear protein separation from BGC-823 cells transfected either with long-length TAGLN2, the fragment containing the complete CH domain (aa 47~153) or part of the CH domain (aa 107~219).

Article Snippet: After deparaffinization in xylene, rehydration through graded alcohols, and heat treatment for antigen retrieval, slides were then blocked and stained with one of the following antibodies to process immunofluorescence staining for 1 h: TAGLN2 (1:500), YBX1 (1:4000, Novus Biologicals), and CK (1:2, Abcarta Medtech Co., Ltd, China).

Techniques: Co-Immunoprecipitation Assay, Construct, Purification, In Vitro, Pull Down Assay, Phospho-proteomics, Translocation Assay, Activation Assay, Western Blot, Transfection

A ~ C Multiplex immunofluorescence of TMA was performed using the Opal 7-color Manual IHC Kit and VECTASHIELD ® HardSet Antifade Mounting Medium. The multiplex antibody panel was optimized as follows: TAGLN2, Opal 520 (yellow); CK, Opal 570 (green); YBX1, Opal 620 (red). The TMA was counterstained with DAPI (blue) and incubated with an antifluorescence quencher. Expression and spatial distribution of TAGLN2 or YBX1 in tissues and the correlation with patient clinical data. The DAPI channel was used to identify individual cells. A tissue segmentation algorithm combined with CK staining was applied to define tumoral and stromal areas. The scale bar is 200 μm. D Fisetin or MK2206 inhibited the accumulation of cytosolic ssDNA induced by overexpression of TAGLN2 by BrdU-γH2AX double labeling. HGC-27 cells stably transfected with TAGLN2 were prelabeled with BrdU and subsequently treated with 1 μg/ml Cisplatin with or without 10 μM Fisetin or 200 nM MK2206 in the medium. Cells were stained for DNA (DAPI, blue), the primary BrdU antibody (red) and phospho-histone H2AX (green). E Relative mRNA levels of the panel of IFN-related genes with or without 10 μM Fisetin or 200 nM MK2206 in the medium after 6 Gy X-ray treatment were evaluated by quantitative RT‒PCR analysis. The cytotoxicity induced by MK2206 from 16.25 nM to 13 μM ( F ) or MK2206 (200 nM) and Cisplatin (0.4 μg/ml) combination on tumor cells was detected ( G ). * P < 0.05, ** P < 0.01, *** P < 0.001.

Journal: Cell Death & Disease

Article Title: TAGLN2 induces resistance signature ISGs by activating AKT-YBX1 signal with dual pathways and mediates the IFN-related DNA damage resistance in gastric cancer

doi: 10.1038/s41419-024-07000-1

Figure Lengend Snippet: A ~ C Multiplex immunofluorescence of TMA was performed using the Opal 7-color Manual IHC Kit and VECTASHIELD ® HardSet Antifade Mounting Medium. The multiplex antibody panel was optimized as follows: TAGLN2, Opal 520 (yellow); CK, Opal 570 (green); YBX1, Opal 620 (red). The TMA was counterstained with DAPI (blue) and incubated with an antifluorescence quencher. Expression and spatial distribution of TAGLN2 or YBX1 in tissues and the correlation with patient clinical data. The DAPI channel was used to identify individual cells. A tissue segmentation algorithm combined with CK staining was applied to define tumoral and stromal areas. The scale bar is 200 μm. D Fisetin or MK2206 inhibited the accumulation of cytosolic ssDNA induced by overexpression of TAGLN2 by BrdU-γH2AX double labeling. HGC-27 cells stably transfected with TAGLN2 were prelabeled with BrdU and subsequently treated with 1 μg/ml Cisplatin with or without 10 μM Fisetin or 200 nM MK2206 in the medium. Cells were stained for DNA (DAPI, blue), the primary BrdU antibody (red) and phospho-histone H2AX (green). E Relative mRNA levels of the panel of IFN-related genes with or without 10 μM Fisetin or 200 nM MK2206 in the medium after 6 Gy X-ray treatment were evaluated by quantitative RT‒PCR analysis. The cytotoxicity induced by MK2206 from 16.25 nM to 13 μM ( F ) or MK2206 (200 nM) and Cisplatin (0.4 μg/ml) combination on tumor cells was detected ( G ). * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: After deparaffinization in xylene, rehydration through graded alcohols, and heat treatment for antigen retrieval, slides were then blocked and stained with one of the following antibodies to process immunofluorescence staining for 1 h: TAGLN2 (1:500), YBX1 (1:4000, Novus Biologicals), and CK (1:2, Abcarta Medtech Co., Ltd, China).

Techniques: Multiplex Assay, Immunofluorescence, Incubation, Expressing, Staining, Over Expression, Labeling, Stable Transfection, Transfection

A – C A subcutaneous mouse model was established to confirm the effects of TAGLN2 and associated axis on tumor growth in vivo. The mice were injected subcutaneously with 2 × 10 6 BGC-823 cells with (NC group) or without TAGLN2 overexpression (TAGLN2 group) in 0.2 ml of PBS. Intraperitoneal administration of Cisplatin (3 mg/kg, every 4 days), MK2206 by intragastric gavage (120 mg/kg, every 4 days), or a combination of both (MK2206 was administrated 2 days before Cisplatin administration), or PBS was given in control group. Tumor volume, body weight and tumor weight were measured. (D&E) Representative protein set (TAGLN2, YBX1, IFIT1, IFIT2, IFIT3, OAS3 and ISG15) staining in tumors derived from NC or TAGLN2 group with Cisplatin, MK2206, or a combination of both treatment. The results were obtained by multiplying the PP by the IS (score = PP × IS). * P < 0.05, ** P < 0.01, *** P < 0.001. The scale bar is 10 μm.

Journal: Cell Death & Disease

Article Title: TAGLN2 induces resistance signature ISGs by activating AKT-YBX1 signal with dual pathways and mediates the IFN-related DNA damage resistance in gastric cancer

doi: 10.1038/s41419-024-07000-1

Figure Lengend Snippet: A – C A subcutaneous mouse model was established to confirm the effects of TAGLN2 and associated axis on tumor growth in vivo. The mice were injected subcutaneously with 2 × 10 6 BGC-823 cells with (NC group) or without TAGLN2 overexpression (TAGLN2 group) in 0.2 ml of PBS. Intraperitoneal administration of Cisplatin (3 mg/kg, every 4 days), MK2206 by intragastric gavage (120 mg/kg, every 4 days), or a combination of both (MK2206 was administrated 2 days before Cisplatin administration), or PBS was given in control group. Tumor volume, body weight and tumor weight were measured. (D&E) Representative protein set (TAGLN2, YBX1, IFIT1, IFIT2, IFIT3, OAS3 and ISG15) staining in tumors derived from NC or TAGLN2 group with Cisplatin, MK2206, or a combination of both treatment. The results were obtained by multiplying the PP by the IS (score = PP × IS). * P < 0.05, ** P < 0.01, *** P < 0.001. The scale bar is 10 μm.

Article Snippet: After deparaffinization in xylene, rehydration through graded alcohols, and heat treatment for antigen retrieval, slides were then blocked and stained with one of the following antibodies to process immunofluorescence staining for 1 h: TAGLN2 (1:500), YBX1 (1:4000, Novus Biologicals), and CK (1:2, Abcarta Medtech Co., Ltd, China).

Techniques: In Vivo, Injection, Over Expression, Control, Staining, Derivative Assay

A Clinical analysis of the experimentally derived nine-gene pair ( IFIT1, IFIT2, IFIT3, ISG15, IFI16, OAS3, WARS, YBX1, TAGLN2 ). The survival curves were plotted by the Kaplan‒Meier method and tested by log-rank analysis. The clinical characteristics of patients with different protein expression levels were compared by using a two-tailed chi-square test with SPSS 20 software. B Expression of IRDS genes also positively correlated with the expression of PDL1 or IDO1 , respectively. C The RandomForest algorithm based on Python sklearn was used to construct the model, and receiver operating characteristic (ROC) curve analysis was used to evaluate the predictive accuracy and sensitivity of the therapy prediction model. Outcomes were divided into therapy sensitivity (including CR complete remission, PR partial remission/response, SD stable disease) and therapy resistance (PD progressive disease) based on the data of “primary_therapy_outcome_success”. D Immune cell proportion analysis. Formatted data were uploaded to the CIBERSORT web portal to analyze immune cell proportions ( https://cibersort.standord.edu ./). * P < 0.05, ** P < 0.01, *** P < 0.001. E Schematic diagram of the role of TAGLN2-mediated AKT-YBX1 pathway activation in IFN-related DNA damage resistance.

Journal: Cell Death & Disease

Article Title: TAGLN2 induces resistance signature ISGs by activating AKT-YBX1 signal with dual pathways and mediates the IFN-related DNA damage resistance in gastric cancer

doi: 10.1038/s41419-024-07000-1

Figure Lengend Snippet: A Clinical analysis of the experimentally derived nine-gene pair ( IFIT1, IFIT2, IFIT3, ISG15, IFI16, OAS3, WARS, YBX1, TAGLN2 ). The survival curves were plotted by the Kaplan‒Meier method and tested by log-rank analysis. The clinical characteristics of patients with different protein expression levels were compared by using a two-tailed chi-square test with SPSS 20 software. B Expression of IRDS genes also positively correlated with the expression of PDL1 or IDO1 , respectively. C The RandomForest algorithm based on Python sklearn was used to construct the model, and receiver operating characteristic (ROC) curve analysis was used to evaluate the predictive accuracy and sensitivity of the therapy prediction model. Outcomes were divided into therapy sensitivity (including CR complete remission, PR partial remission/response, SD stable disease) and therapy resistance (PD progressive disease) based on the data of “primary_therapy_outcome_success”. D Immune cell proportion analysis. Formatted data were uploaded to the CIBERSORT web portal to analyze immune cell proportions ( https://cibersort.standord.edu ./). * P < 0.05, ** P < 0.01, *** P < 0.001. E Schematic diagram of the role of TAGLN2-mediated AKT-YBX1 pathway activation in IFN-related DNA damage resistance.

Article Snippet: After deparaffinization in xylene, rehydration through graded alcohols, and heat treatment for antigen retrieval, slides were then blocked and stained with one of the following antibodies to process immunofluorescence staining for 1 h: TAGLN2 (1:500), YBX1 (1:4000, Novus Biologicals), and CK (1:2, Abcarta Medtech Co., Ltd, China).

Techniques: Derivative Assay, Expressing, Two Tailed Test, Software, Construct, Activation Assay