Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: (A-D) Mice were orally gavaged with PBS or spiB and analyzed 7 dpi. (A) Left: Representative confocal IF images of the ileum myenteric plexus stained with anti-ANNA-1 (red) and anti-HA (green) from Snap25RiboTag mice treated with (top) PBS or infected with (bottom) spiB. Right: Quantification of the (top) number of HA+ neurons per mm2 or (bottom) percent HA/ANNA-1 overlap. (B) Left: Representative confocal IF image of the ileum myenteric plexus stained with anti-ANNA-1 (grey) from VGLUT2td-Tomato mice treated with (top) PBS or infected with (bottom) spiB. Right: Quantification of the number of VGLUT2+ neurons per mm2 and as a percentage of ANNA-1+ neurons. (C, D) Quantification of the number of (C) nNOS+ and (D) somatostatin (SST)+ neurons per mm2 and as a percentage of ANNA-1+ neurons. Data are representative of at least 3 mice per condition. Data were analyzed by unpaired Student’s t-test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. See also Figure S2 and Supplemental Information.

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Staining, Infection

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: Data and Software Availability

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Software, Staining, Recombinant, Saline, DNA Extraction, RNAscope, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Generated, RNA Sequencing, Gene Expression

Journal: Scientific reports

Article Title: Neuregulin 1-ErbB module in C-bouton synapses on somatic motor neurons: molecular compartmentation and response to peripheral nerve injury.

doi: 10.1038/srep40155

Figure Lengend Snippet: Figure 7. Formation of synaptic afferents in long-term cultures of spinal cord neurons. MNs are identified with SMI32 or ChAT immunostaining. (a) A representative highly branched SMI32 (green) positive MN. (b) A ChAT positive (red) MN showing multiple afferent synaptic boutons detected by synaptophysin (Syn, green) labelling. (c) A ChAT positive (red) MN displaying NRG1 clusters (green) which, in some cases, are in contact with GFAP positive (blue) astroglial profiles (arrows). (d–f) A ChAT positive (red) MN with multiple Syn positive (green) synaptic contacts in which many contain VGluT2 (blue). (g,h) A ChAT positive MN (red) showing VAChT positive (blue) cholinergic afferent boutons in close association with NRG1 (green) positive clusters, as detailed (encircled) in the enlarged region delimited in (h). (i,j) A ChAT positive MN (red) showing NRG1 (green) positive clusters which are not associated with VAChT (blue) positive puncta, as shown (encircled) in the enlarged region delimited in (j). Scale bars: in (a and b) = 20 μm; in (c) = 10 μm; in (f) = 20 μm (valid for (d,e)); in (j) = 20 μm (valid for (g,h,i)).

Article Snippet: Target Source Host species Used concentration Choline acetyltransferase (ChAT) Millipore (Tamecula, CA) (AB 143) Rabbit polyclonal 1:200 Glial fibrillary acidic protein (GFAP) Abcam (ab4674) Chicken polyclonal 1:1000 Her4/ErbB4 Cell Signalling (#4795) Rabbit monoclonal 1:50 Ionised calcium-binding adaptor molecule 1 (IBA1) Abcam (ab5076) Goat polyclonal 1:500 Kv 2.1 voltage-gated potassium channel (Kv2.1) NeuroMab (73–014) Mouse monoclonal 1:100 M2 muscarinic receptor Alomone Labs (AMR-002) Rabbit polyclonal 1:100 Neu (C-18) (ErbB2) Santa Cruz Biotechnology (Sc-284) Rabbit polyclonal 1:50 NRG1 1α /β 1/2 Santa Cruz (sc-348) Rabbit polyclonal 1:200 Phospho-Her4/ErbB4 tyr1248 Cell Signalling (#4757) Rabbit monoclonal 1:50 p-Neu tyr1248 (p-ErbB2) Santa Cruz (sc-293110-R) Rabbit polyclonal 1:100 Sigma-1 receptor (S1R) Santa Cruz (sc-137075) Mouse monoclonal 1:50 Serotonin Chemicon (MAB352) Rat monoclonal 1:100 SK3 calcium-activated potassium channel (SK3) Alomone Labs (APC-025) Rabbit polyclonal 1:100 SMI32 Covance Research Products Inc (SMI32) Mouse monoclonal 1:5000 Synaptophysin Synaptic Systems (101 004) Guinea pig polyclonal 1:500 Vesicular acetylcholine transporter (VAChT) Synaptic Systems (139 105) Guinea pig polyclonal 1:500 Vesicular GABA transporter (VGAT) Synaptic Systems (131 004) Guinea pig polyclonal 1:200 Vesicular glutamate transporter 1 (VGluT1) Synaptic Systems (135 304) Guinea pig polyclonal 1:500 Vesicular glutamate transporter 2 (VGLuT2) Synaptic Systems (135 404) Guinea pig polyclonal 1:500 Table 1.

Techniques: Immunostaining

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Details of probes designed for in situ hybridization

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: In Situ

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Primary and secondary antibodies used

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Control

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Analysis of variance (ANOVA) comparing differences in expression levels across age (P7 to adult) by brain region and gene for RNAseq (mean normalized read counts) and ISH (normalized grayscale intensity) assays

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Expressing

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: In situ hybridization and sample acquisition. a Single colorimetric ISH of VGluT1, VGluT2, VGAT, and GAPDH in adjacent sections from the same brain. b Triple FISH of a section from a different brain showing co-expression of VGluT1 (red), VGluT2 (white), and VGAT (green). c Photograph of a frozen brain during harvesting of samples from A1 and MGB for sequencing. The location of A1 within the AC is shown, along with a sketch of the 0.5 mm punch used to obtain samples. Note that the size and shape of the punch compresses tissue outside of the punched volume. The left MGB has been circumscribed prior to extraction. Scale bars 1 mm all panels. A1 primary auditory cortex area 1, AC auditory cortex, MGB medial geniculate body

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: In Situ Hybridization, Expressing, Sequencing, Extraction

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Summary statistics for RNAseq sample comparisons

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques:

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Triple FISH assay in coronal sections of adult mouse at the level of A1 and MGB. The low-magnification image montages obtained at 10× show combined (a) and single channel expression (b–f) for VGAT, VGluT1, and VGluT2 mRNA, counterstained by DAPI. SC superior colliculus, Hip hippocampus, MG medial geniculate body. Scale bars 500 μm in all panels

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Expressing

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Quadruple FISH assay in a coronal section of adult mouse showing A1 and surrounding areas of auditory cortex. The image montages obtained at 40× in a–f show combined or single channel expression for VGAT, GAPDH, VGluT1, and VGluT2 mRNA, counterstained by DAPI. Scale bars 500 μm in all panels. A1 primary auditory cortex area 1, AuD dorsal auditory cortex, AuV ventral auditory cortex, rf rhinal fissure, TeA temporal cortex area A

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Expressing

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Quadruple FISH assay in a coronal section of adult mouse centered on A1 (from Fig. 7). a The image montages obtained at 40× in a show combined expression for VGAT, GAPDH, VGluT1, and VGluT2 mRNA, counterstained by DAPI. Subpanels 1–8 show 100× image stacks taken at sites in different layers of A1, as indicated in the composite image (left). b–g Higher-resolution examples of transcript labeling from subpanel 4 shown separately for each gene. Scale bars a 250 μm, all other panels 20 μm

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Expressing, Labeling

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Quadruple FISH assay in a coronal section of adult mouse showing MGB and surrounding regions. The image montages obtained at 40× in a–f show combined or single channel expression for VGAT, GAPDH, VGluT1, and VGluT2 mRNA, counterstained by DAPI. Scale bars 500 μm in all panels. D dorsal division of MGB, Hip hippocampus, M medial division of MGB, PPN peripeduncular nucleus, V ventral division of MGB, SC superior colliculus, Sg suprageniculate

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Expressing

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Quadruple FISH assay in a coronal section of adult mouse MGB (from Fig. 9). a The image montages obtained at 40× show combined expression for VGAT, GAPDH, VGluT1, and VGluT2 mRNA, counterstained by DAPI. Subpanels (right) show 100× image stacks from MGB divisions, adjoining nuclei, and the central nucleus of the inferior colliculus (ICc). b–g Higher-resolution examples of transcript labeling from MGv shown separately for each gene. Scale bars a 250 μm, all other panels 20 μm. D and MGd dorsal division of MGB, Hip hippocampus, ICc central nucleus of inferior colliculus, M and MGm medial division of MGB, PPN peripeduncular nucleus, V ventral division of MGB, SC superior colliculus, Sg suprageniculate

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Expressing, Labeling

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Triple FISH assays in the mouse auditory cortex at P7, P14 and adult. Panels show combined or single channel expression for VGAT (green), VGluT2 (white), and VGluT1 (red). a Adult AC centered on A1. Row 1 low-magnification images (10×) of each gene shown separately and all three combined (Merge). Row 2 higher magnification (40×) of L1–3. Note low levels of VGluT2 in all layers. b, c Same as a, but at P14 and P7. Note elevated expression of VGluT2 in L2–3 at P7 and co-localization with VGluT1. Scale bars: top panels 10×, 200 μm; other panels 40×, 100 μm. A1 primary auditory cortex area 1, Hip hippocampus

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Expressing

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Triple FISH assays in the mouse MGB at P7, P14 and adult. Panels show combined or single channel expression for VGAT (green), VGluT2 (white), and VGluT1 (red). a Adult MGB. Row 1 low-magnification images (10×) of each gene shown separately and all three combined (Merge). Note absence of VGAT in MGB. Row 2 40× images in the MGv (v) to show co-localization of VGluT1 and VGluT2. b Same as a, but at P14. Note co-localization of VGluT1 and VGluT2 at this age. c Same as in b and c, but at P7. Note very low levels of VGluT1 expression in the MGd shown at 40× in the bottom panels (VGluT1 absent in MGv) at this age and co-localization with VGluT2. Scale bars: top panels 10×, 200 μm; other panels 40×, 100 μm. D dorsal division of MGB, Hip hippocampus, M medial division of MGB, PPN peripeduncular nucleus, V ventral division of MGB

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Expressing

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Graphical summaries of gene expression obtained by analyses of RNAseq and ISH measurements. Top Mean normalized read counts from RNAseq for VGluT1, VGluT2, and VGAT in A1 (blue lines) and MGB (red lines). Bottom Mean relative optical density of ISH for the same genes in A1 (blue), MGv (red), and MGd (green). In all plots, error bars denote standard deviation. For each data series, significant differences in expression levels between each age and all others (p ≤ 0.05) are listed in Tables 4 (RNAseq) and ​and55 (ISH). Note that RNAseq samples contained both MGv and MGd (i.e., MGB). A1 primary auditory cortex area 1, ICc inferior colliculus central nucleus, MGB medial geniculate body, MGd dorsal division of MGB, MGv ventral division of MGB

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Gene Expression, Standard Deviation, Expressing

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Summary statistics for ISH sample comparisons

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques:

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Single colorimetric ISH assay for VGluT2 ISH in AC centered on A1 (left column), MGB (middle column), and IC (right column) at P7, P11, P14, P21, and adult. Coronal sections. Roman numerals indicate layers (sp subplate). Scale bars 250 μm in all panels. d dorsal division of MGB, v ventral division of MGB, DC dorsal cortex, IC inferior colliculus, ICc central nucleus, LC lateral cortex, PAG periaqueductal gray

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: In Situ Hybridization

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Coronal section at the level of A1 and MGB showing immunoreactivity for VGluT2, VGluT1rb, and NeuN at P7. Top the merged RGB images show VGluT2 (green), VGluT1 (red), and NeuN (blue) reactivity in the same tissue section. The left column contains an image of the full section. Rectangular insets correspond to midpower images of MGB and A1 in the middle and right columns. Below the RGB composites in panels below the top row are separated into grayscale color channels, where each channel corresponds to one protein marker. Scale bars: left column 1 mm; middle and right column 500 μm. d dorsal division of MGB, v ventral division of MGB

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Marker

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Coronal section at the level of A1 and MGB showing immunoreactivity for VGluT2, VGluT1rb, and NeuN in adult. Top the merged RGB images show VGluT2 (green), VGluT1 (red), and NeuN (blue) reactivity in the same tissue section. The left column contains an image of the full section. Rectangular insets correspond to midpower images of MGB and A1 in the middle and right columns. Below the RGB composites in panels below the top row are separated into grayscale color channels, where each channel corresponds to one protein marker. Scale bars: left column 1 mm; middle and right column 500 μm. d dorsal division of MGB, v ventral division of MGB

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Marker

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Relative grayscale intensity measurements of VGluT1gp, VGluT2, and VGAT immunoreactivity in A1. Left laminar intensity profiles from L1a to L6 at each age. Right mean relative grayscale intensity measurements (and standard deviations) of immunoreactivity by layer or sublayer (layers 1a–6)

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques:

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Confocal images and puncta counts for VGluT2, VGluT1rb, and NeuN in A1 at P7 and adult. Top single confocal slices from each layer of A1, showing immunoreactivity for VGluT2 and VGluT1. Bottom average puncta density of each protein by layer and age group. Scale bar 20 μm (links to Zoomify™ images for all ages contained in Supp. Figs. S12–S16)

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques:

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Confocal images and puncta counts for VGAT, VGluT1gp, and NeuN in A1 at P7 and adult. Top single confocal slices from each layer of A1, showing immunoreactivity for VGluT2 and VGluT1. Bottom average puncta density of each protein by layer and age group. Scale bar 20 μm (links to Zoomify™ images for all ages contained in Supp. Figs. S19–S23)

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques:

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Confocal images and puncta counts for VGluT2, VGluT1rb, and NeuN in MGB at P7 and adult. Top single confocal slices from each layer of A1, showing immunoreactivity for VGluT2 and VGluT1. Bottom average puncta density of each protein by layer and age group. Scale bar 20 μm. MGv ventral division of MGB, MGd dorsal division of MGB (links to Zoomify™ images for all ages contained in Supp. Figs. S17–S18)

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques:

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Confocal images and puncta counts for VGAT, VGluT1gp, and NeuN in MGB at P7 and adult. Top single confocal slices from each layer of A1, showing immunoreactivity for VGluT2 and VGluT1. Bottom average puncta density of each protein by layer and age group. Scale bar 20 μm. MGv ventral division of MGB, MGd dorsal division of MGB (links to Zoomify™ images for all ages contained in Supp. Figs. S24–S25)

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques:

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: High-magnification confocal maximum intensity projection from five consecutive slices to show details of VGluT2 (green) and VGAT (red) puncta labeling in MGv and MGd at P7 and adult. Scale 20 μm. MGv ventral division of MGB, MGd dorsal division of MGB

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Labeling

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Graphical summaries of VGluT1, VGluT2, and VGAT expression in A1 and MGB obtained by analyses of RNAseq, ISH, and IHC assays. The data from Figs. 13, ​,19,19, ​,20,20, ​,2121 and ​and2222 were replotted to facilitate comparison between conditions and methods as a function of brain region and age. Top Primary auditory cortex (A1) at P7, P14, P21, and adult. Bottom medial geniculate body (MGB) at the same ages. Other conventions as in Fig. 13. Note the general correspondence between RNAseq and ISH data and differences for some IHC conditions (e.g., VGluT2 in MGB)

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Expressing, Comparison

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Summary of vesicular transporter gene and protein expression in A1, MGB, and IC at P7 and adult for VGluT1, VGluT2, and VGAT. Schematic drawings illustrate relative expression of each marker in cortical layers of A1, MGd (d), MGv (v), Rt, and IC (ICc and adjacent divisions). Gene expression levels of neuronal somata (triangles, circles, ovals) in each structure are indicated by grayscale shading (black highest expression). Protein expression levels are indicated by grayscale shading by cortical layer or subcortical region. For IC and Rt, relative immunoreactivity at P7 and adult were based on qualitative impressions (see Supplementary Figures 26 and 27). Major connections between structures are indicated by arrows. Solid arrows corticocortical (CC), thalamocortical (TC), and tectothalamic (tT) projections. Dashed arrows corticothalamic (CT), corticotectal (Ct), and reticulothalamic (RT) projections. Brackets from L1 to L6 indicate that TC projections are found in all layers. For VGluT2, grayscale shading density by layer is correlated with TC terminal density. Question marks (?) denote connections for which the vesicular transporter involved is not known or is speculative (i.e., VGluT1 TC; VGluT2 CC). Asterisk in the VGAT panel denotes that CC* projections of VGAT are primarily local (some long-range projections exist)

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Expressing, Marker, Gene Expression

Journal: Brain structure & function

Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing

doi: 10.1007/s00429-015-1062-3

Figure Lengend Snippet: Schematic diagrams depicting possible variations in the trafficking and expression of VGluT1 and VGluT2 transporters in TC (MGB to AC) and CC (AC to OTHER) projections. In all examples, VGluT1 and VGluT2 mRNA is co-expressed in somata, but relative levels differ by brain region. a Only VGluT2 is expressed on vesicles in TC axon terminals, and VGluT1 is expressed on vesicles in all CC terminals. b VGluT1 and VGluT2 are sorted to different terminals. c VGluT1 and VGluT2 are co-expressed in TC and CC axon terminals; d VGluT2 or VGluT1 is expressed alone in some terminals, but co-expressed in others. Note that many additional configurations are possible. Sorting may vary by cortical layer or target cell type and may be modified by sensory experience or other manipulations. Note also that variations in trafficking may apply to other molecules expressed in these neurons (for further discussion, see “Co-expression of VGluT1 and VGluT2”). MGB medial geniculate body, AC auditory cortex

Article Snippet: VGluT2 , CP , Synaptic Systems , 135-4P , 10× , –.

Techniques: Expressing, Modification

Journal: bioRxiv

Article Title: Optogenetic stimulation of medial septal glutamatergic neurons modulates theta-gamma coupling in the hippocampus

doi: 10.1101/2022.03.15.484394

Figure Lengend Snippet: A) Immunofluorescence images from brain slices show co-expression of ChR2-YFP (green) and VGLUT2 in the medial septal area of a transgenic mouse. B)Left-LFP traces and single responses to light stimulation in MSA, CA1 and CA3, note time delay between depolarization of MSA and hippocampus. Right – Min-Max boxplots showing time delay between CA3 and CA1 to first 50 light stimuli. C. Raw (black) and filtered (blue - slow gamma band, red – fast gamma) records of hippocampal LFP during optical stimulation of MSA at 5 and 8 Hz. D) Power spectral density (PSD) graphs of LFPs from CA1 before(black), during(red) and after (blue) optical stimulation of different frequencies. E) Min-Max boxplots showing integrated (PSD) depending on the frequency of stimulation for theta (top), slow gamma (middle) and fast gamma (bottom) bands.

Article Snippet: After incubation, the sections were washed with a buffer and antibodies to VGluT2 + Alexa Fluor 647 (Novus Biologicals) were added to them for 2 hours.

Techniques: Immunofluorescence, Expressing, Transgenic Assay