vglut2 Search Results


94
Alomone Labs rabbit anti vglut2
Rabbit Anti Vglut2, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vglut2/Anti-VGLUT2+Antibody/pmc12606360__41467_2025_64864_MOESM2_ESM-33-48-52
Average 94 stars, based on 1 article reviews
rabbit anti vglut2 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

86
Jackson Laboratory vglut2 cre jackson laboratory
(A-D) Mice were orally gavaged with PBS or spiB and analyzed 7 dpi. (A) Left: Representative confocal IF images of the ileum myenteric plexus stained with anti-ANNA-1 (red) and anti-HA (green) from Snap25RiboTag mice treated with (top) PBS or infected with (bottom) spiB. Right: Quantification of the (top) number of HA+ neurons per mm2 or (bottom) percent HA/ANNA-1 overlap. (B) Left: Representative confocal IF image of the ileum myenteric plexus stained with anti-ANNA-1 (grey) from VGLUT2td-Tomato mice treated with (top) PBS or infected with (bottom) spiB. Right: Quantification of the number of <t>VGLUT2+</t> neurons per mm2 and as a percentage of ANNA-1+ neurons. (C, D) Quantification of the number of (C) nNOS+ and (D) somatostatin (SST)+ neurons per mm2 and as a percentage of ANNA-1+ neurons. Data are representative of at least 3 mice per condition. Data were analyzed by unpaired Student’s t-test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. See also Figure S2 and Supplemental Information.
Vglut2 Cre Jackson Laboratory, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vglut2/cre+vglut2/pmc07271821-861-23-25
Average 86 stars, based on 1 article reviews
vglut2 cre jackson laboratory - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Jackson Laboratory vglut2 irescre
(A-D) Mice were orally gavaged with PBS or spiB and analyzed 7 dpi. (A) Left: Representative confocal IF images of the ileum myenteric plexus stained with anti-ANNA-1 (red) and anti-HA (green) from Snap25RiboTag mice treated with (top) PBS or infected with (bottom) spiB. Right: Quantification of the (top) number of HA+ neurons per mm2 or (bottom) percent HA/ANNA-1 overlap. (B) Left: Representative confocal IF image of the ileum myenteric plexus stained with anti-ANNA-1 (grey) from VGLUT2td-Tomato mice treated with (top) PBS or infected with (bottom) spiB. Right: Quantification of the number of <t>VGLUT2+</t> neurons per mm2 and as a percentage of ANNA-1+ neurons. (C, D) Quantification of the number of (C) nNOS+ and (D) somatostatin (SST)+ neurons per mm2 and as a percentage of ANNA-1+ neurons. Data are representative of at least 3 mice per condition. Data were analyzed by unpaired Student’s t-test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. See also Figure S2 and Supplemental Information.
Vglut2 Irescre, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vglut2/irescre+vglut2/pmc12462460-230-16-21
Average 86 stars, based on 1 article reviews
vglut2 irescre - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

93
NeuroMab vesicular glutamate transporter 2
(A-D) Mice were orally gavaged with PBS or spiB and analyzed 7 dpi. (A) Left: Representative confocal IF images of the ileum myenteric plexus stained with anti-ANNA-1 (red) and anti-HA (green) from Snap25RiboTag mice treated with (top) PBS or infected with (bottom) spiB. Right: Quantification of the (top) number of HA+ neurons per mm2 or (bottom) percent HA/ANNA-1 overlap. (B) Left: Representative confocal IF image of the ileum myenteric plexus stained with anti-ANNA-1 (grey) from VGLUT2td-Tomato mice treated with (top) PBS or infected with (bottom) spiB. Right: Quantification of the number of <t>VGLUT2+</t> neurons per mm2 and as a percentage of ANNA-1+ neurons. (C, D) Quantification of the number of (C) nNOS+ and (D) somatostatin (SST)+ neurons per mm2 and as a percentage of ANNA-1+ neurons. Data are representative of at least 3 mice per condition. Data were analyzed by unpaired Student’s t-test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. See also Figure S2 and Supplemental Information.
Vesicular Glutamate Transporter 2, supplied by NeuroMab, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vglut2/Anti-VGlut2+Antibody/pm30066827-82-16-25
Average 93 stars, based on 1 article reviews
vesicular glutamate transporter 2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc rabbit anti vglut2
(A-D) Mice were orally gavaged with PBS or spiB and analyzed 7 dpi. (A) Left: Representative confocal IF images of the ileum myenteric plexus stained with anti-ANNA-1 (red) and anti-HA (green) from Snap25RiboTag mice treated with (top) PBS or infected with (bottom) spiB. Right: Quantification of the (top) number of HA+ neurons per mm2 or (bottom) percent HA/ANNA-1 overlap. (B) Left: Representative confocal IF image of the ileum myenteric plexus stained with anti-ANNA-1 (grey) from VGLUT2td-Tomato mice treated with (top) PBS or infected with (bottom) spiB. Right: Quantification of the number of <t>VGLUT2+</t> neurons per mm2 and as a percentage of ANNA-1+ neurons. (C, D) Quantification of the number of (C) nNOS+ and (D) somatostatin (SST)+ neurons per mm2 and as a percentage of ANNA-1+ neurons. Data are representative of at least 3 mice per condition. Data were analyzed by unpaired Student’s t-test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. See also Figure S2 and Supplemental Information.
Rabbit Anti Vglut2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vglut2/VGLUT2+Rabbit+mAb/pm38766748-93-50-52
Average 94 stars, based on 1 article reviews
rabbit anti vglut2 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

91
Novus Biologicals vglut2 alexa fluor 647
A) Immunofluorescence images from brain slices show co-expression of ChR2-YFP (green) and <t>VGLUT2</t> in the medial septal area of a transgenic mouse. B)Left-LFP traces and single responses to light stimulation in MSA, CA1 and CA3, note time delay between depolarization of MSA and hippocampus. Right – Min-Max boxplots showing time delay between CA3 and CA1 to first 50 light stimuli. C. Raw (black) and filtered (blue - slow gamma band, red – fast gamma) records of hippocampal LFP during optical stimulation of MSA at 5 and 8 Hz. D) Power spectral density (PSD) graphs of LFPs from CA1 before(black), during(red) and after (blue) optical stimulation of different frequencies. E) Min-Max boxplots showing integrated (PSD) depending on the frequency of stimulation for theta (top), slow gamma (middle) and fast gamma (bottom) bands.
Vglut2 Alexa Fluor 647, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vglut2/VGLUT2+Antibody+(S29-29)+%5BAlexa+Fluor%C2%AE+647%5D/bio_rxiv__2022__03__15__484394-64-12-17
Average 91 stars, based on 1 article reviews
vglut2 alexa fluor 647 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

85
Santa Cruz Biotechnology lentiviral particles
A) Immunofluorescence images from brain slices show co-expression of ChR2-YFP (green) and <t>VGLUT2</t> in the medial septal area of a transgenic mouse. B)Left-LFP traces and single responses to light stimulation in MSA, CA1 and CA3, note time delay between depolarization of MSA and hippocampus. Right – Min-Max boxplots showing time delay between CA3 and CA1 to first 50 light stimuli. C. Raw (black) and filtered (blue - slow gamma band, red – fast gamma) records of hippocampal LFP during optical stimulation of MSA at 5 and 8 Hz. D) Power spectral density (PSD) graphs of LFPs from CA1 before(black), during(red) and after (blue) optical stimulation of different frequencies. E) Min-Max boxplots showing integrated (PSD) depending on the frequency of stimulation for theta (top), slow gamma (middle) and fast gamma (bottom) bands.
Lentiviral Particles, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vglut2/VGLUT2+shRNA+(m)+Lentiviral+Particles/pmc04804015-392-10-13
Average 85 stars, based on 1 article reviews
lentiviral particles - by Bioz Stars, 2026-09
85/100 stars
  Buy from Supplier

93
Novus Biologicals vglut2
Fig. 1 Cognitive dysfunction and synapse loss in the hippocampus of mice after neonatal sevoflurane exposures. A Scheme of neonatal mice receiving repeated sevoflurane and the MWM test. Neonatal mice were exposed to 3% sevoflurane on PNDs 6, 8, and 10, and then the memory and learning abilities were assessed using the MWM test on PNDs 31–36. B Tracking plots of mice. C Sevoflurane reduced the escape latency compared to the control group on PNDs 33–35, as well as the platform crossing times and times spent in the target quadrant. Swimming speed was similar between groups. n = 8. Unpaired t-test and two-way ANOVA. D Representative confocal microscopy images displaying the immunoreactivity of the presynaptic marker <t>Vglut2</t> (green) and postsynaptic marker PSD95 (red) in the hippocampus. Scale bar = 5 μm. E The sevoflurane group showed decreased density of Vglut2 and PSD95. n = 6. Unpaired t-test. F Colocalization analysis showed that the density of synapses was lower in sevoflurane-treated mice. n = 6. Unpaired t-test. G Representative Western blot bands of Vglut2 and PSD95 in the two groups. (H) Quantification of Western blot showed that the expression of Vglut2 and PSD95 was decreased in sevoflurane-treated mice. n = 4. Unpaired t-test. I Representative Golgi-Cox staining images of dendritic spines in the hippocampus. Scale bar = 5 μm. J Quantification of the density of dendritic spines showed that the sevoflurane group had a lower spine density. n = 6. Unpaired t-test. Data are mean ± SEM. *P < 0.05, ** P < 0.01, *** P < 0.001. MWM, Morris water maze; PND, postnatal day
Vglut2, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vglut2/VGLUT2+Antibody+(S29-29)/pm38556890-126-59-62
Average 93 stars, based on 1 article reviews
vglut2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Proteintech vglut2
Fig. 1 Cognitive dysfunction and synapse loss in the hippocampus of mice after neonatal sevoflurane exposures. A Scheme of neonatal mice receiving repeated sevoflurane and the MWM test. Neonatal mice were exposed to 3% sevoflurane on PNDs 6, 8, and 10, and then the memory and learning abilities were assessed using the MWM test on PNDs 31–36. B Tracking plots of mice. C Sevoflurane reduced the escape latency compared to the control group on PNDs 33–35, as well as the platform crossing times and times spent in the target quadrant. Swimming speed was similar between groups. n = 8. Unpaired t-test and two-way ANOVA. D Representative confocal microscopy images displaying the immunoreactivity of the presynaptic marker <t>Vglut2</t> (green) and postsynaptic marker PSD95 (red) in the hippocampus. Scale bar = 5 μm. E The sevoflurane group showed decreased density of Vglut2 and PSD95. n = 6. Unpaired t-test. F Colocalization analysis showed that the density of synapses was lower in sevoflurane-treated mice. n = 6. Unpaired t-test. G Representative Western blot bands of Vglut2 and PSD95 in the two groups. (H) Quantification of Western blot showed that the expression of Vglut2 and PSD95 was decreased in sevoflurane-treated mice. n = 4. Unpaired t-test. I Representative Golgi-Cox staining images of dendritic spines in the hippocampus. Scale bar = 5 μm. J Quantification of the density of dendritic spines showed that the sevoflurane group had a lower spine density. n = 6. Unpaired t-test. Data are mean ± SEM. *P < 0.05, ** P < 0.01, *** P < 0.001. MWM, Morris water maze; PND, postnatal day
Vglut2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vglut2/VGLUT2+Antibody/pm41276918-431-17-38
Average 93 stars, based on 1 article reviews
vglut2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

92
Cell Signaling Technology Inc vglut2
Figure 2. Enrichment of siRNA chemistries in different retinal cell types (A) Cross-section showing efficient distribution of monomer siRNA labeled with Cy3 across entire retinal cross-section. Image shown in grayscale to better visualize the Cy3 signal. (B) Western blot quantifications with cell type–specific antibodies from protein extracts of FACS cells that were Cy3+. The y axis shows relative enrichment in per- centage when compared to total protein extracts from an uninjected retina. Antibodies: rhodopsin (rod PR cells), CA (cone PR cells), GS (Mu¨ ller glia cells), Lim1 (mainly horizontal cells), PKCa (mainly rod bipolar cells), VGAT (amacrine cells, horizontal cells), and <t>VGLUT2</t> (ganglion cells). A multiple t test was performed to determine sig- nificance with uninjected total retinal extracts. N = 3 samples; error bars: SD. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.
Vglut2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vglut2/VGLUT2+Rabbit+mAb/pm38192611-185-72-77
Average 92 stars, based on 1 article reviews
vglut2 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

94
Novus Biologicals anti vglut2
Figure 2. Enrichment of siRNA chemistries in different retinal cell types (A) Cross-section showing efficient distribution of monomer siRNA labeled with Cy3 across entire retinal cross-section. Image shown in grayscale to better visualize the Cy3 signal. (B) Western blot quantifications with cell type–specific antibodies from protein extracts of FACS cells that were Cy3+. The y axis shows relative enrichment in per- centage when compared to total protein extracts from an uninjected retina. Antibodies: rhodopsin (rod PR cells), CA (cone PR cells), GS (Mu¨ ller glia cells), Lim1 (mainly horizontal cells), PKCa (mainly rod bipolar cells), VGAT (amacrine cells, horizontal cells), and <t>VGLUT2</t> (ganglion cells). A multiple t test was performed to determine sig- nificance with uninjected total retinal extracts. N = 3 samples; error bars: SD. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.
Anti Vglut2, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vglut2/VGLUT2+Antibody+(S29-29)/pmc08877757-86-70-71
Average 94 stars, based on 1 article reviews
anti vglut2 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

91
Alomone Labs slc17a6
(A) Experimental scheme and timeline of the NGN2-iN combinatorial patterning screen with single-cell transcriptomics readout. NGN2-iNs exposed to each of the 192 morphogen combinations were individually analyzed with snRNA-seq using split-pool combinatorial barcoding (Parse Biosciences). (B) UMAP embedding of 184,431 cells in the dataset, colored by cluster identity and the source of AP- or DV-morphogens. (C) Feature plots of representative marker genes. (D) Heatmap of cluster markers, transcription factors and ion channel expression in each patterned NGN2-iN cell cluster. (E) UMAP embeddings colored based on the annotations transferred from primary neuron reference atlases, including division, region, neuron type and corresponding mapping score. CNS, central nervous system; PNS, peripheral nervous system; SYM, sympathetic nervous system; ENS, enteric nervous system; TG, trigeminal ganglia; DRG, dorsal root ganglia; GLUT: glutamatergic neuron; CHO, cholinergic neuron; NOR, noradrenergic neuron; NBL, neuroblast-like cells. (F) Heatmap of representative cell type markers in each patterned NGN2-iN cluster with transferred annotations as side bars. (G) Immunofluorescent staining of week 6 patterned NGN2-iNs with MAP2 (top row) and <t>SLC17A6</t> (bottom row) (yellow). DAPI is shown in cyan. Scale bar: 20 μm. (H-I) Feature plots (H) and immunofluorescent staining (I) of neuron subtype-specific markers, including LHX9, SLC5A7, NTRK1 and TRPM8. Scale bar: 20 μm. (J) Example spike-triggered electrical footprints of NGN2-iNs recorded on high-density microelectrode arrays (HD-MEAs) for five patterning conditions. Colors indicate the latencies of action potentials propagating along the various neurites (from blue to red). Scale bar: 200 μm. (K) Clustering of iN patternings could be clustered based on the electrophysiological features obtained from HD-MEA recordings (each dot represents one neuronal network). (L) CNQX application significantly reduced the spontaneous electrical activity of iNs across all patterning conditions; coloring as in (K).
Slc17a6, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vglut2/Guinea+Pig+Anti-VGLUT2+Antibody/bio_rxiv__2023__12__12__571318-341-15-16
Average 91 stars, based on 1 article reviews
slc17a6 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

Image Search Results


(A-D) Mice were orally gavaged with PBS or spiB and analyzed 7 dpi. (A) Left: Representative confocal IF images of the ileum myenteric plexus stained with anti-ANNA-1 (red) and anti-HA (green) from Snap25RiboTag mice treated with (top) PBS or infected with (bottom) spiB. Right: Quantification of the (top) number of HA+ neurons per mm2 or (bottom) percent HA/ANNA-1 overlap. (B) Left: Representative confocal IF image of the ileum myenteric plexus stained with anti-ANNA-1 (grey) from VGLUT2td-Tomato mice treated with (top) PBS or infected with (bottom) spiB. Right: Quantification of the number of VGLUT2+ neurons per mm2 and as a percentage of ANNA-1+ neurons. (C, D) Quantification of the number of (C) nNOS+ and (D) somatostatin (SST)+ neurons per mm2 and as a percentage of ANNA-1+ neurons. Data are representative of at least 3 mice per condition. Data were analyzed by unpaired Student’s t-test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. See also Figure S2 and Supplemental Information.

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: (A-D) Mice were orally gavaged with PBS or spiB and analyzed 7 dpi. (A) Left: Representative confocal IF images of the ileum myenteric plexus stained with anti-ANNA-1 (red) and anti-HA (green) from Snap25RiboTag mice treated with (top) PBS or infected with (bottom) spiB. Right: Quantification of the (top) number of HA+ neurons per mm2 or (bottom) percent HA/ANNA-1 overlap. (B) Left: Representative confocal IF image of the ileum myenteric plexus stained with anti-ANNA-1 (grey) from VGLUT2td-Tomato mice treated with (top) PBS or infected with (bottom) spiB. Right: Quantification of the number of VGLUT2+ neurons per mm2 and as a percentage of ANNA-1+ neurons. (C, D) Quantification of the number of (C) nNOS+ and (D) somatostatin (SST)+ neurons per mm2 and as a percentage of ANNA-1+ neurons. Data are representative of at least 3 mice per condition. Data were analyzed by unpaired Student’s t-test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. See also Figure S2 and Supplemental Information.

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Staining, Infection

Data and Software Availability

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: Data and Software Availability

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Software, Staining, Recombinant, Saline, DNA Extraction, RNAscope, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Generated, RNA Sequencing, Gene Expression

A) Immunofluorescence images from brain slices show co-expression of ChR2-YFP (green) and VGLUT2 in the medial septal area of a transgenic mouse. B)Left-LFP traces and single responses to light stimulation in MSA, CA1 and CA3, note time delay between depolarization of MSA and hippocampus. Right – Min-Max boxplots showing time delay between CA3 and CA1 to first 50 light stimuli. C. Raw (black) and filtered (blue - slow gamma band, red – fast gamma) records of hippocampal LFP during optical stimulation of MSA at 5 and 8 Hz. D) Power spectral density (PSD) graphs of LFPs from CA1 before(black), during(red) and after (blue) optical stimulation of different frequencies. E) Min-Max boxplots showing integrated (PSD) depending on the frequency of stimulation for theta (top), slow gamma (middle) and fast gamma (bottom) bands.

Journal: bioRxiv

Article Title: Optogenetic stimulation of medial septal glutamatergic neurons modulates theta-gamma coupling in the hippocampus

doi: 10.1101/2022.03.15.484394

Figure Lengend Snippet: A) Immunofluorescence images from brain slices show co-expression of ChR2-YFP (green) and VGLUT2 in the medial septal area of a transgenic mouse. B)Left-LFP traces and single responses to light stimulation in MSA, CA1 and CA3, note time delay between depolarization of MSA and hippocampus. Right – Min-Max boxplots showing time delay between CA3 and CA1 to first 50 light stimuli. C. Raw (black) and filtered (blue - slow gamma band, red – fast gamma) records of hippocampal LFP during optical stimulation of MSA at 5 and 8 Hz. D) Power spectral density (PSD) graphs of LFPs from CA1 before(black), during(red) and after (blue) optical stimulation of different frequencies. E) Min-Max boxplots showing integrated (PSD) depending on the frequency of stimulation for theta (top), slow gamma (middle) and fast gamma (bottom) bands.

Article Snippet: After incubation, the sections were washed with a buffer and antibodies to VGluT2 + Alexa Fluor 647 (Novus Biologicals) were added to them for 2 hours.

Techniques: Immunofluorescence, Expressing, Transgenic Assay

Fig. 1 Cognitive dysfunction and synapse loss in the hippocampus of mice after neonatal sevoflurane exposures. A Scheme of neonatal mice receiving repeated sevoflurane and the MWM test. Neonatal mice were exposed to 3% sevoflurane on PNDs 6, 8, and 10, and then the memory and learning abilities were assessed using the MWM test on PNDs 31–36. B Tracking plots of mice. C Sevoflurane reduced the escape latency compared to the control group on PNDs 33–35, as well as the platform crossing times and times spent in the target quadrant. Swimming speed was similar between groups. n = 8. Unpaired t-test and two-way ANOVA. D Representative confocal microscopy images displaying the immunoreactivity of the presynaptic marker Vglut2 (green) and postsynaptic marker PSD95 (red) in the hippocampus. Scale bar = 5 μm. E The sevoflurane group showed decreased density of Vglut2 and PSD95. n = 6. Unpaired t-test. F Colocalization analysis showed that the density of synapses was lower in sevoflurane-treated mice. n = 6. Unpaired t-test. G Representative Western blot bands of Vglut2 and PSD95 in the two groups. (H) Quantification of Western blot showed that the expression of Vglut2 and PSD95 was decreased in sevoflurane-treated mice. n = 4. Unpaired t-test. I Representative Golgi-Cox staining images of dendritic spines in the hippocampus. Scale bar = 5 μm. J Quantification of the density of dendritic spines showed that the sevoflurane group had a lower spine density. n = 6. Unpaired t-test. Data are mean ± SEM. *P < 0.05, ** P < 0.01, *** P < 0.001. MWM, Morris water maze; PND, postnatal day

Journal: Cell & bioscience

Article Title: Complement C1q-mediated microglial synaptic elimination by enhancing desialylation underlies sevoflurane-induced developmental neurotoxicity.

doi: 10.1186/s13578-024-01223-7

Figure Lengend Snippet: Fig. 1 Cognitive dysfunction and synapse loss in the hippocampus of mice after neonatal sevoflurane exposures. A Scheme of neonatal mice receiving repeated sevoflurane and the MWM test. Neonatal mice were exposed to 3% sevoflurane on PNDs 6, 8, and 10, and then the memory and learning abilities were assessed using the MWM test on PNDs 31–36. B Tracking plots of mice. C Sevoflurane reduced the escape latency compared to the control group on PNDs 33–35, as well as the platform crossing times and times spent in the target quadrant. Swimming speed was similar between groups. n = 8. Unpaired t-test and two-way ANOVA. D Representative confocal microscopy images displaying the immunoreactivity of the presynaptic marker Vglut2 (green) and postsynaptic marker PSD95 (red) in the hippocampus. Scale bar = 5 μm. E The sevoflurane group showed decreased density of Vglut2 and PSD95. n = 6. Unpaired t-test. F Colocalization analysis showed that the density of synapses was lower in sevoflurane-treated mice. n = 6. Unpaired t-test. G Representative Western blot bands of Vglut2 and PSD95 in the two groups. (H) Quantification of Western blot showed that the expression of Vglut2 and PSD95 was decreased in sevoflurane-treated mice. n = 4. Unpaired t-test. I Representative Golgi-Cox staining images of dendritic spines in the hippocampus. Scale bar = 5 μm. J Quantification of the density of dendritic spines showed that the sevoflurane group had a lower spine density. n = 6. Unpaired t-test. Data are mean ± SEM. *P < 0.05, ** P < 0.01, *** P < 0.001. MWM, Morris water maze; PND, postnatal day

Article Snippet: The brain sections were washed in PBS for 3 × 10 min and then incubated in a blocking solution (5% bull serum albumin and 0.1% Triton X-100 in PBS) at room temperature for 2 h. Subsequently, the sections were incubated with primary antibodies at 4 °C overnight, including PSD95 (1/200, 381001, ZEN BIO, China), PSD95 (1/200, ab12093, Abcam, UK), Vglut2 (1/200, NBP2-59330, NOVUS, USA), C1q (1/200, DF7839, Affinity, China), C1q (1/200, 67063–1, Proteintech, USA), IBA1 (1/400, ab283342, Abcam, UK), GFAP (1/200, AF1177, Beyotime), CD68 (1/200, 29176, CST, USA), CD11b (1/200, R380675, ZEN BIO, China), MAP2 (1/200, 67015–1, Proteintech, USA), polysialic acid neural cell adhesion molecule (PSA-NCAM) (1/200, 14–9118-82, Invitrogen, USA), and peanut agglutinin (PNA)-FITC (1/1000, L7381, Sigma, USA).

Techniques: Control, Confocal Microscopy, Marker, Western Blot, Expressing, Staining

Figure 2. Enrichment of siRNA chemistries in different retinal cell types (A) Cross-section showing efficient distribution of monomer siRNA labeled with Cy3 across entire retinal cross-section. Image shown in grayscale to better visualize the Cy3 signal. (B) Western blot quantifications with cell type–specific antibodies from protein extracts of FACS cells that were Cy3+. The y axis shows relative enrichment in per- centage when compared to total protein extracts from an uninjected retina. Antibodies: rhodopsin (rod PR cells), CA (cone PR cells), GS (Mu¨ ller glia cells), Lim1 (mainly horizontal cells), PKCa (mainly rod bipolar cells), VGAT (amacrine cells, horizontal cells), and VGLUT2 (ganglion cells). A multiple t test was performed to determine sig- nificance with uninjected total retinal extracts. N = 3 samples; error bars: SD. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.

Journal: Molecular therapy. Nucleic acids

Article Title: Single intravitreal administration of a tetravalent siRNA exhibits robust and efficient gene silencing in mouse and pig photoreceptors.

doi: 10.1016/j.omtn.2023.102088

Figure Lengend Snippet: Figure 2. Enrichment of siRNA chemistries in different retinal cell types (A) Cross-section showing efficient distribution of monomer siRNA labeled with Cy3 across entire retinal cross-section. Image shown in grayscale to better visualize the Cy3 signal. (B) Western blot quantifications with cell type–specific antibodies from protein extracts of FACS cells that were Cy3+. The y axis shows relative enrichment in per- centage when compared to total protein extracts from an uninjected retina. Antibodies: rhodopsin (rod PR cells), CA (cone PR cells), GS (Mu¨ ller glia cells), Lim1 (mainly horizontal cells), PKCa (mainly rod bipolar cells), VGAT (amacrine cells, horizontal cells), and VGLUT2 (ganglion cells). A multiple t test was performed to determine sig- nificance with uninjected total retinal extracts. N = 3 samples; error bars: SD. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.

Article Snippet: The antibodies used for protein detection were mouse anti-b-actin (1:1,000; catalog no. 3700, Cell Signaling Technology), rabbit anti-HTT (1:1,000; catalog no. 5656, Cell Signaling Technology), rabbit anti-PKCa (1:1,000; catalog no. 59754, Cell Signaling Technology), mouse anti-rhodopsin (1:1,000; catalog no. MA1-722, Invitrogen, Carlsbad, CA), rabbit anti-CA (1:1,000; catalog no. AB15282, Millipore), mouse anti-GS (1:1,000; catalog no. MAB302, Millipore), rabbit anti-Lim1 (1:1,000; catalog no. PA5-116485, Invitrogen), rabbit anti-VGAT (1:1,000; catalog no. PA5-27569, Invitrogen), and VGLUT2 (1:1,000; catalog no. 71555, Cell Signaling Technology).

Techniques: Labeling, Western Blot

(A) Experimental scheme and timeline of the NGN2-iN combinatorial patterning screen with single-cell transcriptomics readout. NGN2-iNs exposed to each of the 192 morphogen combinations were individually analyzed with snRNA-seq using split-pool combinatorial barcoding (Parse Biosciences). (B) UMAP embedding of 184,431 cells in the dataset, colored by cluster identity and the source of AP- or DV-morphogens. (C) Feature plots of representative marker genes. (D) Heatmap of cluster markers, transcription factors and ion channel expression in each patterned NGN2-iN cell cluster. (E) UMAP embeddings colored based on the annotations transferred from primary neuron reference atlases, including division, region, neuron type and corresponding mapping score. CNS, central nervous system; PNS, peripheral nervous system; SYM, sympathetic nervous system; ENS, enteric nervous system; TG, trigeminal ganglia; DRG, dorsal root ganglia; GLUT: glutamatergic neuron; CHO, cholinergic neuron; NOR, noradrenergic neuron; NBL, neuroblast-like cells. (F) Heatmap of representative cell type markers in each patterned NGN2-iN cluster with transferred annotations as side bars. (G) Immunofluorescent staining of week 6 patterned NGN2-iNs with MAP2 (top row) and SLC17A6 (bottom row) (yellow). DAPI is shown in cyan. Scale bar: 20 μm. (H-I) Feature plots (H) and immunofluorescent staining (I) of neuron subtype-specific markers, including LHX9, SLC5A7, NTRK1 and TRPM8. Scale bar: 20 μm. (J) Example spike-triggered electrical footprints of NGN2-iNs recorded on high-density microelectrode arrays (HD-MEAs) for five patterning conditions. Colors indicate the latencies of action potentials propagating along the various neurites (from blue to red). Scale bar: 200 μm. (K) Clustering of iN patternings could be clustered based on the electrophysiological features obtained from HD-MEA recordings (each dot represents one neuronal network). (L) CNQX application significantly reduced the spontaneous electrical activity of iNs across all patterning conditions; coloring as in (K).

Journal: bioRxiv

Article Title: Human neuron subtype programming through combinatorial patterning with scSeq readouts

doi: 10.1101/2023.12.12.571318

Figure Lengend Snippet: (A) Experimental scheme and timeline of the NGN2-iN combinatorial patterning screen with single-cell transcriptomics readout. NGN2-iNs exposed to each of the 192 morphogen combinations were individually analyzed with snRNA-seq using split-pool combinatorial barcoding (Parse Biosciences). (B) UMAP embedding of 184,431 cells in the dataset, colored by cluster identity and the source of AP- or DV-morphogens. (C) Feature plots of representative marker genes. (D) Heatmap of cluster markers, transcription factors and ion channel expression in each patterned NGN2-iN cell cluster. (E) UMAP embeddings colored based on the annotations transferred from primary neuron reference atlases, including division, region, neuron type and corresponding mapping score. CNS, central nervous system; PNS, peripheral nervous system; SYM, sympathetic nervous system; ENS, enteric nervous system; TG, trigeminal ganglia; DRG, dorsal root ganglia; GLUT: glutamatergic neuron; CHO, cholinergic neuron; NOR, noradrenergic neuron; NBL, neuroblast-like cells. (F) Heatmap of representative cell type markers in each patterned NGN2-iN cluster with transferred annotations as side bars. (G) Immunofluorescent staining of week 6 patterned NGN2-iNs with MAP2 (top row) and SLC17A6 (bottom row) (yellow). DAPI is shown in cyan. Scale bar: 20 μm. (H-I) Feature plots (H) and immunofluorescent staining (I) of neuron subtype-specific markers, including LHX9, SLC5A7, NTRK1 and TRPM8. Scale bar: 20 μm. (J) Example spike-triggered electrical footprints of NGN2-iNs recorded on high-density microelectrode arrays (HD-MEAs) for five patterning conditions. Colors indicate the latencies of action potentials propagating along the various neurites (from blue to red). Scale bar: 200 μm. (K) Clustering of iN patternings could be clustered based on the electrophysiological features obtained from HD-MEA recordings (each dot represents one neuronal network). (L) CNQX application significantly reduced the spontaneous electrical activity of iNs across all patterning conditions; coloring as in (K).

Article Snippet: Antibodies against the following proteins were purchased from the indicated vendors: MAP2 (EMD Millipore AB5622); SLC17A6 (Alomone Labs AGC-036-GP); SLC5A7 (Invitrogen PA5-117124); LHX9 (Sigma-Aldrich HPA009695); TRPM8 (Alomone Labs ACC-049), NTRK1 (FabGennix International TRKA-101Y).

Techniques: Single-cell Transcriptomics, Marker, Expressing, Staining, Activity Assay

(A) Experimental scheme and timeline for the pre- and post-patterning screen coupled with ASCL1/DLX2 induction. (B) UMAP embedding of pre-and post-patterned cells after ASCL1/DLX2 induction. ASCL1/DLX2-iNs are mostly neuronal (MAP2+) and GABAergic (GAD1+), with no or low expression of excitatory markers (SLC17A6-). (C) UMAP embedding of integrated atlas of all neuronal cells (n=430,936 cells) showing sample distribution and concentration gradients. (D) Scatterplots showing mean distance to control cells (normalized to 1) in relation to morphogen concentrations. Error bars represent SEM. (E) Diversity of clusters generated in all datasets, shown by dendrogram based on transcriptomic distance (cosine, TF marker genes). Annotation heatmap shows concentrations for the condition which has the highest relative composition of the cluster. Purity shown in percentage as barplots. GO heatmap shows enrichment of disease genes in marker genes of clusters. Expression heatmap shows row-normalized expression of key neurotransmitter genes, highlighting the diversity. (F) Comparison of regulons inferred from post-patterned NGN2-iNs and ASCL1/DLX2-iNs and their correlation with BMP4 and RA. Regulons inferred separately from NGN2- and ASCL1/DLX2 datasets represented by different shapes were scored for activity correlation to indicated morphogen gradients in both datasets. Regulons are colored with the regional identity where maximal activity is registered, while the size of the regulons was represented as the size of the dots. (G) Heatmap showing importances of morphogens for a Random Forest regressor to predict expression of neurotransmitter and neuropeptide genes. Importances were multiplied with the sign of the Pearson correlation to indicate directionality. (H) Boxplots showing examples of neurotransmitter/neuropeptides correlated with morphogen concentrations. The box plots show the median (center line), upper and lower quartiles (box limits) and 1.5×interquartile range (whiskers). Outliers shown.

Journal: bioRxiv

Article Title: Human neuron subtype programming through combinatorial patterning with scSeq readouts

doi: 10.1101/2023.12.12.571318

Figure Lengend Snippet: (A) Experimental scheme and timeline for the pre- and post-patterning screen coupled with ASCL1/DLX2 induction. (B) UMAP embedding of pre-and post-patterned cells after ASCL1/DLX2 induction. ASCL1/DLX2-iNs are mostly neuronal (MAP2+) and GABAergic (GAD1+), with no or low expression of excitatory markers (SLC17A6-). (C) UMAP embedding of integrated atlas of all neuronal cells (n=430,936 cells) showing sample distribution and concentration gradients. (D) Scatterplots showing mean distance to control cells (normalized to 1) in relation to morphogen concentrations. Error bars represent SEM. (E) Diversity of clusters generated in all datasets, shown by dendrogram based on transcriptomic distance (cosine, TF marker genes). Annotation heatmap shows concentrations for the condition which has the highest relative composition of the cluster. Purity shown in percentage as barplots. GO heatmap shows enrichment of disease genes in marker genes of clusters. Expression heatmap shows row-normalized expression of key neurotransmitter genes, highlighting the diversity. (F) Comparison of regulons inferred from post-patterned NGN2-iNs and ASCL1/DLX2-iNs and their correlation with BMP4 and RA. Regulons inferred separately from NGN2- and ASCL1/DLX2 datasets represented by different shapes were scored for activity correlation to indicated morphogen gradients in both datasets. Regulons are colored with the regional identity where maximal activity is registered, while the size of the regulons was represented as the size of the dots. (G) Heatmap showing importances of morphogens for a Random Forest regressor to predict expression of neurotransmitter and neuropeptide genes. Importances were multiplied with the sign of the Pearson correlation to indicate directionality. (H) Boxplots showing examples of neurotransmitter/neuropeptides correlated with morphogen concentrations. The box plots show the median (center line), upper and lower quartiles (box limits) and 1.5×interquartile range (whiskers). Outliers shown.

Article Snippet: Antibodies against the following proteins were purchased from the indicated vendors: MAP2 (EMD Millipore AB5622); SLC17A6 (Alomone Labs AGC-036-GP); SLC5A7 (Invitrogen PA5-117124); LHX9 (Sigma-Aldrich HPA009695); TRPM8 (Alomone Labs ACC-049), NTRK1 (FabGennix International TRKA-101Y).

Techniques: Expressing, Concentration Assay, Control, Generated, Marker, Comparison, Activity Assay