Journal: Cell systems

Article Title: A Map of Human Mitochondrial Protein Interactions Linked to Neurodegeneration Reveals Molecular Determinants of Redox Homeostasis and NF-κB Signaling

doi: 10.1016/j.cels.2017.10.010

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: pLD-puro-PRDX5WT-CcVA (in this study) , This study , Addgene #98688.

Techniques: Virus, Mutagenesis, Control, Recombinant, Gel Extraction, Purification, Isolation, cDNA Synthesis, SYBR Green Assay, Derivative Assay, Expressing, CRISPR, Software

Journal: Nature

Article Title: Actin cables and comet tails organize mitochondrial networks in mitosis

doi: 10.1038/s41586-021-03309-5

Figure Lengend Snippet: a. Mitochondrial actin wave area in cells treated with indicated inhibitors. b. Table indicating the drugs used a, as well as their major targets and concentrations/incubation times used. c. Mitochondrial actin wave area in cells treated with indicated siRNA for 48h. d. Knockdown efficiency of siRNAs used in c . Values indicate averages of at least 3 independents experiments. e. Representative western blots indicating knockdown efficiency of siRNAs in c . Full blots are shown in . Relative total protein levels are indicated below each blot. f. Representative single plane images of actin waves (Lifeact-EGFP) in metaphase HeLa cells treated with the indicated siRNAs. Dashed red line indicates wave boundaries. g. Airyscan single plane image of a HeLa cell expressing EGFP-VASP (white), Lifeact-mScarlet, (red), and Mito-TagBFP2 (blue). Yellow arrows indicate position of VASP puncta on the actin cloud. h. Airyscan image of VASP association with a mitochondrion (Mito-TagBFP2) within an actin cloud (Lifeact- mScarlet). (right) Normalized fluorescence intensity of Mito, VASP, and Lifeact along the 1px linescan indicated by the dashed line. i. Metaphase Hela cells expressing Lifeact-mScarlet, Filamin A-EGFP, and MitoTracker DeepRed. j. Fixed, anaphase HeLa cell stained for Filamin A (cyan) and F-actin (phalloidin, orange). k. Spinning disk confocal median time projection (over 30 seconds) indicating Cortactin-EGFP colocalization with Lifeact-mScarlet in a metaphase actin wave . l . Median intensity time projection of Lifeact-mScarlet/Cortactin-EGFP colocalization in an actin cloud in a metaphase HeLa cell. m. Spinning disk confocal images of fixed HeLa cells stained for mitochondria (anti-Tom20), cortactin (anti-cortactin), and F-actin (Phalloidin). White arrows indicate asymmetric, punctate localization of cortactin around actin positive mitochondria. (right) Normalized fluorescence intensity of f-actin (phalloidin), Tom20, and Cortactin along the 1px wide line scan. n. Colocalization of Alpha Actinin (Alpha Actinin-mNeonGreen) and F-actin (LifeAct-mScarlet) in a metaphase HeLa cell. (right) Kymograph of LifeAct and alpha-actinin generated from indicated line scan (dashed line). Scale bars: ( f, i , j - k , n ) 10 μm, ( g , l ) 5 μm, ( g inset, e , l inset, m ) 1 μm. Sample sizes: ( a , c) Number of cells per condition is indicated above each boxplot. Samples are drawn from at least 3 independent experiments. Statistical tests: ( a ) Kruskal-Wallis test with Dunn’s multiple comparisons test ***p<0.0001, DMSO vs. C3 Transferase p=0.7515, DMSO vs. Rhosin p<0.9999, ( b ) Kruskal-Wallis test with Dunn’s multiple comparisons test ***p<0.0001, NT vs. WASH1 p>0.9999, NT vs. WAVE1 p=0.6079, NT vs. WHAMM p=0.0766, NT vs. N-WASP p>0.9999, NT vs. Myo19 p>0.9999, NT vs. MyoVa p>0.9999. Center values/error bars: Box = Median ± IQR, whiskers indicate 10–90% values, plus-sign indicates mean. Uncropped/unprocessed scans of the blots are included in the Source Data file.

Article Snippet: ON-TARGETplus Non-targeting siRNA #1 (Dharmacon, D-001810-01-20), Myosin 19 (SantaCruz, sc93640), MyoVa (SantaCruz, sc-35995), INF2-CAAX (Dharmacon, ACAAAGAAACUGUGUGUGAUU), INF2 (Santa Cruz, sc-92159), N-WASP (Dharmacon: #1 AAGAAAAGAAGAAGGGAAAUU, #2 CAACUUAAAGACAGAGAAAUU), VASP (SantaCruz, sc- 29516), WASHC1 (Dharmacon, J-190043-(01-04)-0002), WAVE1 (SantaCruz, sc-29516), WHAMM (Dharmacon, L-022415-01), Arp3 (Santa Cruz, sc-29739), Cofilin 1 (CST, 6267S), ADF (SantaCruz, sc- 43200), Gelsolin (SantaCruz, sc-37330), Spire1C (Dharmacon, CCUAGGAUAACCAGUGUAUUU), MFN1 (Santa Cruz, sc-43927), MFN2 (Santa Cruz, sc-43928).

Techniques: Incubation, Knockdown, Western Blot, Expressing, Fluorescence, Staining, Generated

Journal: Molecular and Cellular Biology

Article Title: In vivo evidence of interaction between interferon-stimulated gene factors and the interferon-stimulated response element.

doi: 10.1128/mcb.9.8.3533

Figure Lengend Snippet: FIG. 2. Comparison of ISG15 constitutive and IFN-a-induced DNase-hypersensitive sites in WI38VA and Daudi cells at different times after IFN-a treatment. (A) WI38VA cells were treated with 500 U of IFN-a per ml for the time shown. Nuclei were isolated and treated with the indicated concentrations of DNase, and then DNA was extracted, digested with TaqI, electrophoresed, blotted, and probed with a radiolabeled ISG15 EcoRI-Taql fragment (+510 to +850). Fragment sizes (base pairs) were calculated with the equa- tion obtained from linear regression analysis of the marker mobili- ties (R2 > 0.99), and the centers of sites were then estimated on the basis of known location of the probe within the gene. Resolution in the size range of the promoter was very good, and the centers of the DNase-hypersensitive sites were reproducibly mapped to within +10 base pairs. The uppermost site is the full-length restriction fragment detected by the probe. The markers (M) used were 1-kilobase and 123-base-pair ladders (Bethesda Research Laborato- ries) labelled with 32P and mixed with 20 ,ug of sheared salmon sperm DNA prior to electrophoresis. (B) Daudi cells were treated with 250 U of IFN-a per ml for the time shown. The analysis was performed as described for panel A. (C) The results illustrated by panels A and B are depicted schematically. Restriction sites and DNase-hyper- sensitive sites I through IV are shown above the horizontal line. The induced hypersensitive site is marked by the heavy vertical line. The positions given for the hypersensitive sites represent the centers of the analogous pair of sites in the two cell lines. A site observed in only one cell line is shown with that cell line designated underneath. The ISRE (-) and the first exon (U) are shown. The subcloned fragment used as a probe (restriction sites and =) is indicated.

Article Snippet: WI38VA (ATCC CCL 75.1) or Daudi

Techniques: Comparison, Isolation, Marker, Electrophoresis