|
Sino Biological
usp30 ![]() Usp30, supplied by Sino Biological, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/usp30/Ubiquitin+specific+peptidase+30+%2F+USP30+Antibody%2C+Rabbit+PAb/pmc08891576-98-5-6 Average 90 stars, based on 1 article reviews
usp30 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp usp30 hs00261902 m1 ![]() Gene Exp Usp30 Hs00261902 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/usp30/Gene+Exp%2E+USP30%2C+Hs00261902_m1/pmc02438355-99-16--1 Average 85 stars, based on 1 article reviews
gene exp usp30 hs00261902 m1 - by Bioz Stars,
2026-09
85/100 stars
|
Buy from Supplier |
|
Addgene inc
mito gfp ![]() Mito Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/usp30/Flag-HA-USP30+(Plasmid+%2322578)/pmc07950302-121-4-5 Average 93 stars, based on 1 article reviews
mito gfp - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
anti usp30 ![]() Anti Usp30, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/usp30/USP30+Antibody/pm38772138-54-2-15 Average 93 stars, based on 1 article reviews
anti usp30 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
OriGene
nm 010849 mouse tagged orf ![]() Nm 010849 Mouse Tagged Orf, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/usp30/Usp30+(NM_001033202)+Mouse+Tagged+ORF+Clone/pmc07724356-207-28-36 Average 90 stars, based on 1 article reviews
nm 010849 mouse tagged orf - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Atlas Antibodies
ma5 15738 usp30 atlas antibodies ![]() Ma5 15738 Usp30 Atlas Antibodies, supplied by Atlas Antibodies, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/usp30/Anti-USP30/pm40328249-226-10-12 Average 93 stars, based on 1 article reviews
ma5 15738 usp30 atlas antibodies - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Addgene inc
human usp30 catalytic domain ![]() Human Usp30 Catalytic Domain, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/usp30/Human+USP30+(64-502%2C+construct+13%2C+MG-26-82)+(Plasmid+%23110746)/bio_rxiv__2024__09__22__613429-169-6-10 Average 93 stars, based on 1 article reviews
human usp30 catalytic domain - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
usp30 sirna ![]() Usp30 Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/usp30/USP30+siRNA/pmc08357812-258-3-13 Average 92 stars, based on 1 article reviews
usp30 sirna - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
|
R&D Systems
e 582 050 ![]() E 582 050, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/usp30/Recombinant+Human+His6-USP30+Protein%2C+CF/pm36608804-130-32-30 Average 94 stars, based on 1 article reviews
e 582 050 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Novus Biologicals
anti usp30 ![]() Anti Usp30, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/usp30/USP30+Antibody+-+Azide+and+BSA+Free/pm38163556-125-35-37 Average 91 stars, based on 1 article reviews
anti usp30 - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
|
OriGene
50 accuuugaauagaguguuaucu ggg 30 ![]() 50 Accuuugaauagaguguuaucu Ggg 30, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/usp30/USP30+Human+siRNA+Oligo+Duplex/pm24849047-227-24-23 Average 90 stars, based on 1 article reviews
50 accuuugaauagaguguuaucu ggg 30 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
R&D Systems
usp30 ![]() Usp30, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/usp30/Recombinant+Human+His6-USP30+Protein%2C+CF/pmc11825904-293-14-15 Average 93 stars, based on 1 article reviews
usp30 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Frontiers in Pharmacology
Article Title: The Mitochondrial Deubiquitinase USP30 Regulates AKT/mTOR Signaling
doi: 10.3389/fphar.2022.816551
Figure Lengend Snippet: PINK1/Parkin-dependent mitophagy induces apoptosis during mitochondrial stress (A) . Western blot analysis of mitophagy proteins and the pro-apoptosis signal in Hela (no Parkin) cells and Hela Parkin cells after the AO (Antimycin A+ oligomycin) treatment. Cells were treated with AO at 5 ug/ml for 0, 3, 6, and 9 h. Beta Actin served as the loading control. These are representative figures from three independent experiments (B) . Cell viability assay of Hela (no Parkin) cells and Hela Parkin cells after AO treatment. Cells were treated with AO at 5 ug/ml for 24 h and then incubated with resazurin for 2 h. Fluorescence was read using 544 nm excitation and 590 nm emission wavelength. It is a representative figure from three independent experiments (C) . Western blot analysis of mitophagy proteins and the pro-apoptosis signal in Hela Parkin cells and Hela Parkin with PINK1 KO cells after the AO treatment. Cells were treated with AO at 5 ug/ml for 0, 3, 6, and 9 h. Beta Actin served as the loading control (D) . Cell viability assay of Hela Parkin cells and Hela Parkin with USP30 overexpression cells after AO treatment with or without ST-539. Cells were treated with AO at 5 ug/ml w/o 10 ug/ml ST-539 for 24 h and then incubated with resazurin for 2 h. Fluorescence was read using544 nm excitation and 590 nm emission wavelength (E) . Western blot analysis of mitophagy proteins and the pro-apoptosis signal in Hela Parkin cells and Hela Parkin with USP30 overexpression cells after the AO treatment w/o ST-539. Cells were treated with AO at 5 ug/ml w/o 10 ug/ml ST-539 for 0, 3, and 6 h. Beta Actin served as the loading control (F) . Cell viability assay of Hela ATG5 knockout cells, Hela ATG5 knockout Parkin cells, and Hela ATG5 knockout Parkin USP30 cells after AO treatment. Cells were treated with AO at 5 ug/ml for 24 h and then incubated with resazurin for 2 h. Fluorescence was read using544 nm excitation and 590 nm emission wavelength.
Article Snippet: Primary antibodies used as described:
Techniques: Western Blot, Control, Viability Assay, Incubation, Fluorescence, Over Expression, Knock-Out
Journal: Frontiers in Pharmacology
Article Title: The Mitochondrial Deubiquitinase USP30 Regulates AKT/mTOR Signaling
doi: 10.3389/fphar.2022.816551
Figure Lengend Snippet: USP30 upregulates AKT/mTOR signal (A) . Western blot analysis of AKT/mTOR pathway proteins in Hela Parkin cells and Hela Parkin with USP30 overexpression cells after the AO treatment. Cells were treated with AO at 5 ug/ml for 0, 3, 6, and 9 h. Beta Actin served as the loading control. 2 (B) . Western blot analysis of AKT signal in Hela Parkin cells and Hela Parkin with USP30 overexpression cells after the AO treatment w/o ST-539. Cells were treated with AO at 5 ug/ml w/o ST-539 for 0, 3, and 6 h. Beta Actin served as the loading control. 2 (C) . Western blot analysis of AKT and cleaved PARP in Hela Parkin and Hela Parkin USP30 cells after the AO treatment w/o chloroquine. Cells were treated with AO at 5 ug/ml for 0, 3, and 6 h with DMSO or 10 uM chloroquine to inhibit autophagy/mitophagy. Beta Actin served as the loading control. 2 (D) . Western blot analysis of AKT and cleaved PARP in Hela ATG5 knockout Parkin and Hela ATG5 knockout Parkin USP30 cells after the AO treatment. Cells were treated with AO at 5 ug/ml for 0, 3, and 6 h. Beta Actin served as the loading control.
Article Snippet: Primary antibodies used as described:
Techniques: Western Blot, Over Expression, Control, Knock-Out
Journal: Frontiers in Pharmacology
Article Title: The Mitochondrial Deubiquitinase USP30 Regulates AKT/mTOR Signaling
doi: 10.3389/fphar.2022.816551
Figure Lengend Snippet: USP30 in cancer treatment. 3 (A) . Cell viability assay of Hela Parkin USP30 cells after AKT/mTOR inhibitors treatment w/o ST. Cells were treated with 10 uM MK2206 or 10uM Rapamycin or 1uM Torin1 for 48 h with DMSO or 10 ug/ml ST-539 and then incubated with resazurin for 2 h. Fluorescence was read using 544 nm excitation and 590 nm emission wavelength. 3 (B) . Cell viability assay on Jurkat T cells after 72 h MK2206 treatment with ST. Cells were treated with MK2206 and ST in the concentration gradient manner for 72 h. After the treatment, cells were incubated with resazurin for 2 h. Fluorescence was read using544 nm excitation and 590 nm emission wavelength. Each dot is the mean value of three biologically independent experiments. Trend lines are non-linear regression fitting curves. 3 (C) . Western blot analysis of AKT, mitophagy, and pro-apoptosis signal in Jurkat T cells treated with DMSO, MK2206, or ST. Cells were treated with DMSO, MK2206, ST, or MK220 + ST for 24 h. Beta Actin served as the loading control.
Article Snippet: Primary antibodies used as described:
Techniques: Viability Assay, Incubation, Fluorescence, Concentration Assay, Western Blot, Control
Journal: Cell chemical biology
Article Title: Integrative proximal-ubiquitomics profiling for deubiquitinase substrate discovery applied to USP30.
doi: 10.1016/j.chembiol.2025.04.004
Figure Lengend Snippet: Figure 2. Optimization workflow for the proximal-ubiquitomics methodology (A) Scheme of experimental optimization strategy. (B) Densitometric intensity of HEK293 endogenous USP30 and APEX2-USP30 (n = 3 quantification of separate bands from 1 sample, error bars = SD). (C) Percentage of endogenous and APEX2-conjugated USP30 labeled by HA-Ub-PA (n = 1). (D) Immunofluorescence of TOMM20, biotin-phenol (BP), and DAPI staining after USP30-APEX2 biotinylation in HEK293 cells. Scale bars: 50 μm. (E) Biotin-phenol concentration dependence of USP30-APEX2 biotinylation in HEK293 cells. (F) Streptavidin pull-down optimization after USP30-APEX2 biotinylation with 5 mM biotin-phenol. (G) Number of Gly-Gly peptides identified from the proximal-ubiquitomics methodology with different amounts of input material.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GAPDH (GAR1) Invitrogen CAT#
Techniques: Labeling, Immunofluorescence, Staining, Concentration Assay, Ubiquitin Proteomics
Journal: Cell chemical biology
Article Title: Integrative proximal-ubiquitomics profiling for deubiquitinase substrate discovery applied to USP30.
doi: 10.1016/j.chembiol.2025.04.004
Figure Lengend Snippet: Figure 3. USP30 proximal ubiquitome enriched for outer mitochondrial membrane proteins (A) Experimental design to compare the proximal ubiquitome of USP30 +/− compound 39, with its corresponding proximitome, proteome, and ubiquitome. A control proteome and ubiquitome without APEX2 biotin labeling were also included for comparison.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GAPDH (GAR1) Invitrogen CAT#
Techniques: Membrane, Control, Labeling, Comparison
Journal: Cell chemical biology
Article Title: Integrative proximal-ubiquitomics profiling for deubiquitinase substrate discovery applied to USP30.
doi: 10.1016/j.chembiol.2025.04.004
Figure Lengend Snippet: Figure 4. Discovery of USP30 substrate candidates by integrated proximal-ubiquitomics (A) Labeled proteome volcano plot showing the effect of compound 39 treatment on protein levels in CCCP-treated HEK293 USP30-APEX2 cells with APEX2 biotin labeling. (B) Proximitome volcano plot showing the effect of compound 39 treatment on protein levels captured from streptavidin pull-down after USP30-APEX2 bio- tinylation in CCCP-treated HEK293 USP30-APEX2 cells. (C) Labeled ubiquitome volcano plot showing the effect of compound 39 treatment on peptides with K-ε-GG sites after K-ε-GG peptide enrichment in CCCP- treated HEK293 USP30-APEX2 cells with USP30-APEX2 biotin labeling. (D) Proximal-ubiquitome volcano plot showing the effect of compound 39 treatment on peptides with K-ε-GG sites after streptavidin pull-down of USP30-APEX2 biotinylated proteins followed by K-ε-GG peptide enrichment in CCCP-treated HEK293 USP30-APEX2 cells. Volcano plot hits in orange = significant hits identified after permutation-based false discovery rate (FDR) correction at 5%. (E and F) Cytoscape string analysis of K-ε-GG peptides that are significantly increased upon compound 39 treatment in CCCP-treated HEK293 USP30-APEX2 cells in the labeled ubiquitome (E) and proximal ubiquitome (F). Circle size is proportional to the log2 difference in K-ε-GG peptide intensity +/− compound 39 treatment, with the largest difference used if multiple peptides originate from the same protein. Red circles denote OMM, and blue circles denote other
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GAPDH (GAR1) Invitrogen CAT#
Techniques: Labeling
Journal: Cell chemical biology
Article Title: Integrative proximal-ubiquitomics profiling for deubiquitinase substrate discovery applied to USP30.
doi: 10.1016/j.chembiol.2025.04.004
Figure Lengend Snippet: Figure 5. LETM1 as USP30 interactor (A and B) Proximity ligation assay (PLA) in HEK293 cells. HEK293 cells transiently transfected with FLAG-USP30, with PLA reaction between anti-FLAG antibody and anti-LETM1 antibody (A) or an anti-TOMM20 antibody (B). Yellow punctate signals represent the reported interactions, and blue signals indicate nuclei. A single antibody control (none) was included. Scale bar: 50 μm. (C) Confocal images of HEK293 cells +/− CCCP transiently expressing FLAG-USP30 and endogenous LETM1 protein. Anti-FLAG antibody (red), anti-LETM1 antibody (green), and DAPI (blue) for nuclei visualization. Scale bars: 10 μm. (D and E) HEK293T cells transiently expressing FLAG-USP30 (D) USP30 was pulled down using an anti-FLAG antibody. (E) LETM1 was pulled down using an anti- LETM1 antibody. (F) SH-SY5Y cell LETM1 pull-down using anti-LETM1 antibody.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GAPDH (GAR1) Invitrogen CAT#
Techniques: Proximity Ligation Assay, Transfection, Control, Expressing
Journal: Cell chemical biology
Article Title: Integrative proximal-ubiquitomics profiling for deubiquitinase substrate discovery applied to USP30.
doi: 10.1016/j.chembiol.2025.04.004
Figure Lengend Snippet: Figure 6. LETM1 and FKBP8 deubiquitination are USP30 dependent (A) HA-ubiquitin pull-down using anti-HA antibody. HEK293T cells transiently expressing HA-Ub treated with 10 μM CCCP +/− compound 39. (B) HA-ubiquitin pull-down using anti-HA antibody. HEK293T cells transiently transfected with scrambled or USP30 siRNA and treated with 10 μM CCCP. (C and D) Tandem ubiquitin binding entity (TUBE) pull-down in HEK293T cells treated with 10 μM CCCP +/− compound 39.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GAPDH (GAR1) Invitrogen CAT#
Techniques: Ubiquitin Proteomics, Expressing, Transfection, Binding Assay
Journal: bioRxiv
Article Title: Chimeric deubiquitinase engineering reveals structural basis for specific inhibition of USP30 and a framework for DUB ligandability
doi: 10.1101/2024.09.22.613429
Figure Lengend Snippet: a , USP30 antagonizes Pink1/Parkin-mediated mitophagy. b , Chemical structures of a covalent and a non-covalent USP30 inhibitor. Inhibition of USP30 to enhance mitochondrial quality control is explored clinically as therapeutic strategy for Parkinson’s and kidney diseases. c , Crystal structure of human USP30 obtained with a previously engineered construct as Ub-PA complex (PDB: 5OHK). USP subdomains are shown in different colors. d , Architecture of full-length human USP30, previously used construct c1 (named c13 in ) and here described USP30 chimera ch3. See Supplementary Fig. 2 for other chimeras. e , AlphaFold-predicted model of USP30 c1 , crystal structures of the catalytic domains of USP14 (PDB: 2AYN) and USP35 (PDB: 5TXK), and AlphaFold-predicted model of USP30 chimera ch3. Regions used for grafting are shown in corresponding colors. f , Catalytic efficiencies of indicated USP30 constructs, determined from Ubiquitin-RhoG (Ub-RhoG) cleavage assays. See Supplementary Fig. 3 for raw data. Mean ± s.e.m. g , Stability assessment of USP30 constructs in their apo states derived from thermal shift assays. Tm , protein melting temperature. h , Changes in protein stability upon binding to the Ubiquitin probe Ub-PA. Mean ± s.d. (N=3). i , Gel-based Ub-PA binding assay. j , Crystal structure of USP30 ch3 ∼Ub-PA. See for statistics. k , Structure of NK036, a solubility-enhanced derivative of Compound 39. l , Inhibitory potencies of NK036 for indicated USP30 constructs. IC50 values are given as mean ± s.e.m. m , Protein stability of indicated USP30 constructs in the presence of NK036.
Article Snippet: The following sequences were used: Codon-optimized
Techniques: Inhibition, Control, Construct, Ubiquitin Proteomics, Derivative Assay, Binding Assay, Solubility
Journal: bioRxiv
Article Title: Chimeric deubiquitinase engineering reveals structural basis for specific inhibition of USP30 and a framework for DUB ligandability
doi: 10.1101/2024.09.22.613429
Figure Lengend Snippet: a , Cartoon representation of the crystal structure of USP30 ch3 bound to NK036. The compound is shown under an orange surface. b , Composite omit electron density map of NK036 in chain A (2mFO-DFC, contoured at 1σ, covering all atoms of the compound). c , Structure as in A with surface representation of USP30. d , Compound binding site highlighting typical USP regions involved in binding to NK036. e , Close-up view of the compound binding site highlighting key residues involved in H-bonding. f , Close-up view of the USP30 hydrophobic patch engaging the fluorobenzoyl moiety of the compound. g , Close-up view of hydrophobic interactions of the phenylalanine group of the compound. h , Close-up view of the benzenesulfonamide moiety of the compound engaged by USP30 residues.
Article Snippet: The following sequences were used: Codon-optimized
Techniques: Binding Assay
Journal: bioRxiv
Article Title: Chimeric deubiquitinase engineering reveals structural basis for specific inhibition of USP30 and a framework for DUB ligandability
doi: 10.1101/2024.09.22.613429
Figure Lengend Snippet: a , Cartoon representation of the crystal structure of USP30 bound to NK036. The compound is shown under an orange surface. b , Structure of USP30∼Ub-PA complex (PDB: 5OHK). Ubiquitin is shown under a yellow surface. c , Superposition of panels a and b. d , Close-up view of the compound binding site. Catalytic triad residues of USP30 and Leu73 of Ubiquitin are labeled. The conformational change of the USP30 switching loop is indicated. e , Close-up view on the engagement of the Ubiquitin Leu73 side chain by USP30, with residues forming the hydrophobic pocket highlighted. f , Superposition of the structures, focused on the Leu73 binding pocket showing its occupation by the fluorobenzoyl group of NK036. g-h , Close-up views of the conformational changes of the switching loop, focusing on entry of the cryptic pocket within the thumb subdomain (g) and the anchoring of the switching loop on the α5 helix (h). Putative movements of residues are indicated with arrows. See also Supplementary Movie 1 , in which the equivalent transition is shown based on the Lys6-diubiquitin-bound structure of USP30 (PDB: 5OHP).
Article Snippet: The following sequences were used: Codon-optimized
Techniques: Ubiquitin Proteomics, Binding Assay, Labeling
Journal: bioRxiv
Article Title: Chimeric deubiquitinase engineering reveals structural basis for specific inhibition of USP30 and a framework for DUB ligandability
doi: 10.1101/2024.09.22.613429
Figure Lengend Snippet: a , Sequence alignment of indicated human USP DUBs. Arrows indicate the unique Leu328 and Phe453 residues in USP30. b , Close-up view of the compound binding site. c , Superposition with indicated USP DUB structures in complex with inhibitors (PDB: 5N9R, 6IIN, 6GH9), highlighting how equivalent Phe and Tyr residues in other human USP DUBs interfere with compound binding. d , Catalytic activities of indicated wild-type (WT) and mutant USP30 proteins, assessed by Ub-RhoG cleavage. Mean ± s.e.m. e , Inhibitory potencies of NK036, pre-incubated with indicated USP30 proteins for 1.5 h, determined from Ub-RhoG cleavage assays. IC50 values are given as mean ± s.e.m. f , Protein stability of indicated USP30 proteins in the presence of 20 µM NK036. Δ Tm was calculated as Tm of the compound-bound sample subtracted from Tm of the respective apo protein. Mean ± s.d. (N=3). g , Inhibitory potencies of Compound 39, determined as in e. h , Protein stability assessment in the presence of Compound 39, determined as in f. i , Probe competition assay. USP30 and inhibitors were preincubated, followed by addition of Ub-PA, and analysis of samples by SDS-PAGE and Coomassie staining. j , Cellular probe competition assay. HEK293 cells were treated with indicated compounds. Lysates were then incubated with ubiquitin probe where indicated and analyzed by western blot. The asterisk denotes an unspecific band. k , Cellular assessment of USP30 inhibition mechanism. C-terminally Flag-tagged USP30 (WT or compound-resistant mutation F453Y) was overexpressed in HEK293 cells. Cells were analyzed as described in panel j.
Article Snippet: The following sequences were used: Codon-optimized
Techniques: Sequencing, Binding Assay, Mutagenesis, Incubation, Competitive Binding Assay, SDS Page, Staining, Ubiquitin Proteomics, Western Blot, Inhibition
Journal: bioRxiv
Article Title: Chimeric deubiquitinase engineering reveals structural basis for specific inhibition of USP30 and a framework for DUB ligandability
doi: 10.1101/2024.09.22.613429
Figure Lengend Snippet: a-g , Cartoon representations of human USP-family deubiquitinase catalytic domains in complex with indicated small molecule inhibitors. Compounds are shown as both sticks and transparent surfaces. Structural elements of DUBs are labeled and PDB codes of structures are given. 44,45,48,52-54 The Leu73 Ubiquitin binding site is shown with an arrow when engaged by compounds. h , Comparison of USP30 inhibition by NK036 to other DUB inhibitors. Superposition of the structure of USP30+NK036 on other structures shown in panels a-f. Compounds are shown as surfaces and are labeled. All USP cartoons except USP30 are semitransparent.
Article Snippet: The following sequences were used: Codon-optimized
Techniques: Labeling, Ubiquitin Proteomics, Binding Assay, Comparison, Inhibition
Journal: bioRxiv
Article Title: Chimeric deubiquitinase engineering reveals structural basis for specific inhibition of USP30 and a framework for DUB ligandability
doi: 10.1101/2024.09.22.613429
Figure Lengend Snippet: a , Schematic of a Ubiquitin-bound USP DUB. Structural elements are labeled. b , Schematic of USP30 in complex with an inhibitor of the benzenesulfonamide scaffold, occupying the Ubiquitin Leu73 pocket (sand), the cryptic pocket (green) and the cleft towards the S1 Ubiquitin binding site (blue) with shown chemical moieties. c , Schematic of DUB inhibition with compounds being composed of a hotspot anchor element (occupying the Ubiquitin Leu73 pocket) and one or two specificity extensions (occupying the shown other USP DUB structural elements). Compounds featuring the respective extensions are named together with their cognate DUBs. 44,46,48,53- 56 See Supplementary Fig. 8 for structural superpositions focused on the Leu73 binding pocket. d , Chemical structures of specific DUB inhibitors. Chemical motifs occupying the distinct binding sites are colored according to panel c. The hotspot anchor motifs shared by all are highlighted.
Article Snippet: The following sequences were used: Codon-optimized
Techniques: Ubiquitin Proteomics, Labeling, Binding Assay, Inhibition
Journal: Cell Death Discovery
Article Title: Regulation of Bax-dependent apoptosis by mitochondrial deubiquitinase USP30
doi: 10.1038/s41420-021-00599-6
Figure Lengend Snippet: A Chemical structure of aumdubin and auranofin. B Aumdubin did not induce the production of ROS. H1299 cells were exposed to aumdubin (1 µM) or positive control ROSup (PC) in the absence or presence of antioxidant vitamin C (Vit C, 100 µM) for 1 h, ROS was detected with DCF-DA staining by flow cytometry. C: control. Mean ± s.d. (n = 3). * P < 0.05. C Cytotoxic effects of aumdubin may be not dependent on ROS production. A549 and H1299 cells were exposed to aumdubin (1 µM) in the absence or presence of antioxidant vitamin C (Vit C, 100 µM) for 24 h, and then were subjected to MTS assay. Mean ± s.d. ( n = 3). D , E Accumulation of ubiquitinated proteins by aumdubin. A549 ( D ) and H1299 ( E ) cells were treated with various concentrations of aumdubin (Aum) and auranofin (Aur) for 6 h, and then total ubiquitinated proteins were detected with western blotting assay. Bortezomib (BTZ, 100 nM) and b-AP15 (0.5 μM) were used as positive controls. GAPDH were used as a loading control. F Accumulation of K48- and K63-linked ubiquitinated proteins by aumdubin. H1299 cells were treated with various concentrations of aumdubin (Aum) for 6 h, and then K48- and K63-linked ubiquitination were detected with western blotting assay. GAPDH were used as a loading control. G Aumdubin inhibits DUBs. A549 cells were treated with the indicated concentrations of aumdubin and auranofin for 3 h, and then whole-cell lysates were labeled with HA-ub-vs and immunoblots with the indicated antibodies. H Aumdubin inhibits USP30. The purified recombinant USP30 was treated with the indicated concentration of aumdubin for 6 h, followed by detecting DUB activity with Ub-AMC reagent. I , J Aumdubin induces ubiquitination of mitochondrial proteins. A549 ( I ) and H1299 ( J ) cells were treated with the indicated concentrations of aumdubin and auranofin for 6 h, and then mitochondrial proteins were isolated using mitochondrial protein extraction kit. Ubiquitinated proteins were detected with western blotting assay. COX4 were used as a loading control.
Article Snippet: Control siRNA (sc-37007),
Techniques: Positive Control, Staining, Flow Cytometry, Control, MTS Assay, Western Blot, Ubiquitin Proteomics, Labeling, Purification, Recombinant, Concentration Assay, Activity Assay, Isolation, Protein Extraction
Journal: Cell Death Discovery
Article Title: Regulation of Bax-dependent apoptosis by mitochondrial deubiquitinase USP30
doi: 10.1038/s41420-021-00599-6
Figure Lengend Snippet: A H1299 cells were transfected with Control siRNA or the indicated DUBs siRNA for 48 h, then mRNA expression of the indicated DUBs was measured by RT-qPCR and its expression level relative to the control was calculated. Mean ± SD ( n = 3), * P < 0.05, versus control. B Knockdown of USP30 enhances aumdubin-induced cell death. H1299 cells were transfected with Control siRNA or the indicated DUBs siRNA for 24 h, followed by treatment with or without 1 μM aumdubin (Aum) for 24 h. The cell viability was measured by using MTS assay. Mean ± SD ( n = 3), * P < 0.05, versus aumdubin alone. C , D Knockdown of USP30 enhances aumdubin-induced apoptosis. A549 ( C ) or H1299 ( D ) cells were transfected with Control siRNA or USP30 siRNA for 24 h, followed by treatment with or without 1 μM aumdubin (Aum) for 24 h. E , F Overexpression of USP30 attenuates aumdubin-induced apoptosis. A549 ( E ) or H1299 ( F ) cells were transfected with vector or usp30 cDNA plasmids for 24 h, followed by treatment with or without 1 μM aumdubin for 24 h. PARP and USP30 were analyzed with western blotting. The relative quantification of cleavage PARP/total PRAP were shown. GAPDH was used as a loading control.
Article Snippet: Control siRNA (sc-37007),
Techniques: Transfection, Control, Expressing, Quantitative RT-PCR, Knockdown, MTS Assay, Over Expression, Plasmid Preparation, Western Blot, Quantitative Proteomics
Journal: Cell Death Discovery
Article Title: Regulation of Bax-dependent apoptosis by mitochondrial deubiquitinase USP30
doi: 10.1038/s41420-021-00599-6
Figure Lengend Snippet: A , B USP30 interacts with Bax. Endogenous Bax were immunoprecipitated from A549 ( A ) and H1299 ( B ) cells using an anti-Bax antibody, co-immunoprecipitated proteins were detected using western blotting. C USP30 specifically binds Bax. Endogenous Bax were immunoprecipitated from USP30 knockdown or control and H1299 cells using an anti-Bax antibody, co-immunoprecipitated proteins were detected using western blotting. D , E Aumdubin induces ubiquitination of Bax. A549 ( D ) and H1299 ( E ) cells were treated with1 μM aumdubin (Aum) for 6 h, and then endogenous Bax were immunoprecipitated, followed by immunoblotting using anti-ubiquitin antibody. F , G Aumdubin does not induce degradation of Bax and bcl-2. A549 ( F ) and H1299 ( G ) cells were treated with various concentrations of aumdubin for 12 h, Bax and bcl-2 were detected with western blotting assay. H Aumdubin increases the mitochondrial Bax and ubiquitination of mitochondrial Bax. H1299 cells treated with or without 1 μM aumdubin for 6 h, then endogenous Bax were immunoprecipitated from the mitochondrial fractions, followed by immunoblotting using anti-ubiquitin antibody. I Knockdown of Bax alleviates aumdubin-induced apoptosis. A549 cells were transfected with Control siRNA or Bax siRNA for 24 h, followed by treatment with or without 1 μM aumdubin for 24 h, PARP and Bax were detected by western blotting. J , K Knockout of Bax blocks alleviates aumdubin-induced apoptosis in MEFs. Wild-type and Bax/Bak double-knockout MEFs were treated with or without 1 μM aumdubin for 24 h. PARP and caspase-3 cleavage were detected by western blotting.
Article Snippet: Control siRNA (sc-37007),
Techniques: Immunoprecipitation, Western Blot, Knockdown, Control, Ubiquitin Proteomics, Transfection, Knock-Out, Double Knockout
Journal: Nature Communications
Article Title: Design of quinoline SARS-CoV-2 papain-like protease inhibitors as oral antiviral drug candidates
doi: 10.1038/s41467-025-56902-x
Figure Lengend Snippet: a Differential scanning fluorimetry assay of Jun13296 in stabilizing SARS-CoV-2 PL pro . Jun12682 was included as a positive control for comparison. Data from Jun12682 is the mean of two repeats, and data from Jun13296 is the mean ± standard deviation of three technical repeats. b K i plot of Jun13296 in inhibiting SARS-CoV-2 PL pro hydrolysis of ISG15-AMC. c K i plot of Jun13296 in inhibiting SARS-CoV-2 PL pro hydrolysis of Ub-AMC. d Counter screening of Jun 13296 against host proteases USP2, USP7, USP8, USP14, USP15, USP30, UCH-L1, cathepsin B, cathepsin K, calpain-1, trypsin, and caspase 3. Data in ( d ) are presented as mean ± standard deviation of two technical repeats. Source data are provided as a file.
Article Snippet: E-520-025), 500 nM USP14 (ProSci, 91-171), 1 nM USP15 (R&D systems, E594), 20 nM
Techniques: Fluorimetry Assay, Positive Control, Comparison, Standard Deviation