Journal: Journal of Dental Sciences

Article Title: Ubiquitin-like with phd and ring finger domains 1 as a potential therapeutic target in smoking-associated oral squamous cell carcinoma

doi: 10.1016/j.jds.2025.04.011

Figure Lengend Snippet: UHRF1 is overexpressed in oral squamous cell carcinoma (OSCC) tissues. (A–D) Gene expression analysis of UHRF1 in OSCC tissues compared to normal tissues using data from the GEO database (datasets: GSE30784 , GSE23558 , GSE74530 , and GSE37991 ). (E, F) The relative expression levels of UHRF1 in multiple OSCC cell lines were evaluated by qPCR and Western blot analysis. GAPDH was used as an internal control. All data are presented as mean ± standard deviation (SD). Statistical significance: ∗ P < 0.05; ∗∗ P < 0.01; ∗∗∗ P < 0.001. OSCC: oral squamous cell carcinoma, UHRF1: ubiquitin-like with phd and ring finger domains 1, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

Article Snippet: For overexpression studies, cells were transfected with a Human UHRF1 ORF cDNA expression plasmid (Cat. No. HG17896-UT, Sino Biological, Beijing, China) according to the manufacturer's protocol.

Techniques: Gene Expression, Expressing, Western Blot, Control, Standard Deviation, Ubiquitin Proteomics

Journal: Journal of Dental Sciences

Article Title: Ubiquitin-like with phd and ring finger domains 1 as a potential therapeutic target in smoking-associated oral squamous cell carcinoma

doi: 10.1016/j.jds.2025.04.011

Figure Lengend Snippet: Effects of UHRF1 knockdown on OSCC cells. (A, B) The efficiency of UHRF1 knockdown in YD38 and OEC-M1 cells was assessed by qPCR and Western blot analysis. GAPDH was used as an internal control. (C, D) The impact of UHRF1 knockdown on cell proliferation in OEC-M1 cells was evaluated using the colony formation assay. Colony numbers per well were averaged from three independent experiments. (E, F) The effects of UHRF1 knockdown on cell invasion in YD38 and OEC-M1 cells were assessed using the Transwell invasion assay. (G, H) The influence of UHRF1 knockdown on cell migration in OEC-M1 cells was analyzed using the wound healing assay. All data are presented as mean ± standard deviation (SD). Statistical significance: ∗ P < 0.05; ∗∗ P < 0.01; ∗∗∗ P < 0.001. UHRF1: ubiquitin-like with phd and ring finger domains 1, Ctrl: untreated control; sc: scramble control; siUHRF1: UHRF1 knockdown. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, 0 h: 0 h, 22 h: 22 h.

Article Snippet: For overexpression studies, cells were transfected with a Human UHRF1 ORF cDNA expression plasmid (Cat. No. HG17896-UT, Sino Biological, Beijing, China) according to the manufacturer's protocol.

Techniques: Knockdown, Western Blot, Control, Colony Assay, Transwell Invasion Assay, Migration, Wound Healing Assay, Standard Deviation, Ubiquitin Proteomics

Journal: Journal of Dental Sciences

Article Title: Ubiquitin-like with phd and ring finger domains 1 as a potential therapeutic target in smoking-associated oral squamous cell carcinoma

doi: 10.1016/j.jds.2025.04.011

Figure Lengend Snippet: Effects of UHRF1 overexpression on OSCC cells. (A, B) The efficiency of UHRF1 overexpression in YD10B and SCC25 cells was assessed by qPCR and Western blot analysis. GAPDH served as the internal control. (C, D) The impact of UHRF1 overexpression on cell proliferation in YD10B cells was evaluated using the colony formation assay. Colony numbers per well were averaged from three independent experiments. (E, F) The effect of UHRF1 overexpression on cell invasion in YD10B and SCC25 cells was determined by the transwell invasion assay. (G, H) Wound healing assays were performed to assess the influence of UHRF1 overexpression on cell migration. All data are presented as mean ± standard deviation (SD). Statistical significance: ∗ P < 0.05; ∗∗ P < 0.01; ∗∗∗ P < 0.001. UHRF1: ubiquitin-like with phd and ring finger domains 1, Ctrl: control; pcmv3: empty pcmv3 vector; pcmv3-UHRF1: UHRF1 overexpression plasmid. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, 0 h: 0 h, 24 h: 24 h.

Article Snippet: For overexpression studies, cells were transfected with a Human UHRF1 ORF cDNA expression plasmid (Cat. No. HG17896-UT, Sino Biological, Beijing, China) according to the manufacturer's protocol.

Techniques: Over Expression, Western Blot, Control, Colony Assay, Transwell Invasion Assay, Migration, Standard Deviation, Ubiquitin Proteomics, Plasmid Preparation

Journal: Journal of Dental Sciences

Article Title: Ubiquitin-like with phd and ring finger domains 1 as a potential therapeutic target in smoking-associated oral squamous cell carcinoma

doi: 10.1016/j.jds.2025.04.011

Figure Lengend Snippet: Cigarette smoke condensate increased the expression level of UHRF1 in vitro and in vivo. (A) Relative expression levels of UHRF1 in current smokers and never smokers were analyzed using the GEO database ( GSE8987 ). (B, C) qPCR and Western blot analyses showing UHRF1 expression in YD10B and SCC25 cells following treatment with 125 μM of cigarette smoke condensate for 24, 48, and 72 h. GAPDH was used as an internal control. (D) Effects of CSC treatment on body weight in nude mice. (E) Representative image of xenograft tumors illustrating tumor volume in mice treated with PBS or CSC. (F) Representative H&E staining of SCC25 xenograft tumors from both groups. Immunohistochemical (IHC) detection of UHRF1 expression in tumor tissues from the two treatment groups. Scale bars: 10 × , 100 μm; 20 × , 50 μm. All data are presented as mean ± standard deviation (SD). Statistical significance: ∗ P < 0.05; ∗∗ P < 0.01; ∗∗∗ P < 0.001. UHRF1: ubiquitin-like with phd and ring finger domains 1, DMSO: Dimethyl sulfoxide, 24 h: 24 h, 48 h: 48 h, 72 h: 72 h, Ctrl: control, CSC: cigarette smoke condensate. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, PBS: Phosphate buffered saline, H&E: hematoxylin and eosin.

Article Snippet: For overexpression studies, cells were transfected with a Human UHRF1 ORF cDNA expression plasmid (Cat. No. HG17896-UT, Sino Biological, Beijing, China) according to the manufacturer's protocol.

Techniques: Expressing, In Vitro, In Vivo, Western Blot, Control, Staining, Immunohistochemical staining, Standard Deviation, Ubiquitin Proteomics, Saline

Journal: Oncotarget

Article Title: The microRNA signature of patients with sunitinib failure: regulation of UHRF1 pathways by microRNA-101 in renal cell carcinoma

doi: 10.18632/oncotarget.10887

Figure Lengend Snippet: Putative target genes of miR-101 and upregulated genes in RCC clinical specimens

Article Snippet: TaqMan probes and primers for UHRF1 (P/N: Hs01086727_m1), EZH2 (P/N: Hs01016789_m1), and GAPDH (P/N: Hs02758991_g1) as an internal control were obtained from Applied Biosystems (Assay-On-Demand Gene Expression Products).

Techniques: Ubiquitin Proteomics, Sequencing, Virus, Clinical Proteomics, Membrane

Journal: Oncotarget

Article Title: The microRNA signature of patients with sunitinib failure: regulation of UHRF1 pathways by microRNA-101 in renal cell carcinoma

doi: 10.18632/oncotarget.10887

Figure Lengend Snippet: ( A ) UHRF1 mRNA expression 72 h after transfection with miR-101 . GUSB was used as an internal control. ( B ) UHRF1 protein expression 72 h after transfection with miR-101 . GAPDH was used as a loading control. ( C ) miR-101 binding sites in UHRF1 mRNA. Luciferase reporter assays were carried out using a vector encoding the putative miR-101 target site in the UHRF1 3′-UTR (position 1030–1036) for wild-type and deletion constructs. * P < 0.002, ** P < 0.0001. The bars indicate SDs.

Article Snippet: TaqMan probes and primers for UHRF1 (P/N: Hs01086727_m1), EZH2 (P/N: Hs01016789_m1), and GAPDH (P/N: Hs02758991_g1) as an internal control were obtained from Applied Biosystems (Assay-On-Demand Gene Expression Products).

Techniques: Expressing, Transfection, Control, Binding Assay, Luciferase, Plasmid Preparation, Construct

Journal: Oncotarget

Article Title: The microRNA signature of patients with sunitinib failure: regulation of UHRF1 pathways by microRNA-101 in renal cell carcinoma

doi: 10.18632/oncotarget.10887

Figure Lengend Snippet: ( A ) UHRF1 mRNA expression was determined at 72 h after transfection with si-UHRF1 . GUSB was used as an internal control. ( B ) UHRF1 protein expression was evaluated by western blotting at 72 h after transfection with si-UHRF1 . GAPDH was used as a loading control. * P < 0.0001. The bars indicate SDs. ( C ) Cell proliferation was assessed 72 h after transfection with si-UHRF1 using XTT assays. ( D ) Cell migration was assessed 48 h after transfection with si-UHRF1 using uncoated Transwell polycarbonate membrane filters. ( E ) Cell invasion was assessed 48 h after transfection with si-UHRF1 using Matrigel invasion assays. * P < 0.0001. The bars indicate SDs.

Article Snippet: TaqMan probes and primers for UHRF1 (P/N: Hs01086727_m1), EZH2 (P/N: Hs01016789_m1), and GAPDH (P/N: Hs02758991_g1) as an internal control were obtained from Applied Biosystems (Assay-On-Demand Gene Expression Products).

Techniques: Expressing, Transfection, Control, Western Blot, Migration, Membrane

Journal: Oncotarget

Article Title: The microRNA signature of patients with sunitinib failure: regulation of UHRF1 pathways by microRNA-101 in renal cell carcinoma

doi: 10.18632/oncotarget.10887

Figure Lengend Snippet: Significantly downregulated pathways by knockdown of UHRF1 in 786-O cells

Article Snippet: TaqMan probes and primers for UHRF1 (P/N: Hs01086727_m1), EZH2 (P/N: Hs01016789_m1), and GAPDH (P/N: Hs02758991_g1) as an internal control were obtained from Applied Biosystems (Assay-On-Demand Gene Expression Products).

Techniques: Knockdown, Infection, Ubiquitin Proteomics

Journal: Oncotarget

Article Title: The microRNA signature of patients with sunitinib failure: regulation of UHRF1 pathways by microRNA-101 in renal cell carcinoma

doi: 10.18632/oncotarget.10887

Figure Lengend Snippet: ( A ) UHRF1 was highly expressed in sunitinib-treated RCC compared with that in sunitinib-naïve RCC ( P = 0.0049). ( B ) The overall survival rate of patients with high UHRF1 expression was significantly lower than that of patients with low UHRF1 expression ( P < 0.0001). ( C ) Multivariate Cox proportional hazards model for prediction of overall survival showed high UHRF1 expression, advanced disease stage, and age at diagnosis were significant prognostic factors ( P < 0.0001, P < 0.0001, P = 0.0005, respectively). ( D ) High expression of UHRF1 was observed in sunitinib-treated RCC specimens.

Article Snippet: TaqMan probes and primers for UHRF1 (P/N: Hs01086727_m1), EZH2 (P/N: Hs01016789_m1), and GAPDH (P/N: Hs02758991_g1) as an internal control were obtained from Applied Biosystems (Assay-On-Demand Gene Expression Products).

Techniques: Expressing, Biomarker Discovery

Journal: iScience

Article Title: Gene repression through epigenetic modulation by PPARA enhances hepatocellular proliferation

doi: 10.1016/j.isci.2022.104196

Figure Lengend Snippet:

Article Snippet: Rabbit monoclonal anti-UHRF1 , Cell Signaling Technology , Cat# 12387; RRID: AB_2715501.

Techniques: Virus, Recombinant, Chromatin Immunoprecipitation, AST Assay, Immunoprecipitation, shRNA, Luciferase, Software

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A) Illustration of the developmental stages and specification timing of the 7 major retinal cell types: retinal ganglion cells, amacrine, horizontal, bipolar, Müller, cone, and rod photoreceptors. (B) Time course of Uhrf1 mRNA expression in the developing retina in wild-type mice. Levels of Uhrf1 mRNA were measured by RT-qPCR and normalized to the levels at E15.5 taken as 1 (n=3). Mean ± SD. (C) Representative Western blot analysis of UHRF1 protein levels with high and low exposure. Tubulin was used as loading control. (D) Quantification of the relative UHRF1 protein levels on Western blots, were E15.5 was taken as 1 (n=3). Mean ± SD.

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: Expressing, Quantitative RT-PCR, Western Blot, Control

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A) Schematic diagram of conditional excision of the floxed Uhrf1 allele. (B) Western blot analysis of Uhrf1 expression in Uhrf1 cKO (Chx10- Cre Uhrf1 lox/lox ) and littermate control ( Uhrf1 lox/lox ) shows effective reduction of Uhrf1 protein upon Cre recombination of floxed Uhrf1 alleles. Actin was used as loading control. (C) RT-qPCR analysis of retinal cell marker genes. A significant increase in the mRNA level of Chx10 (bipolar), Prkca (bipolar) , Prox1 (amacrine/horizontal) and a significant decrease in rhodopsin (rods) transcription were observed in Uhrf1 cKO EGFP+ cells compared to the control littermates. All data are normalized to control littermates (n=4). *p<0.05 by unpaired two-tailed t test. (D-E) Representative images of P21 retina cross-sections (D) and dissociated cells (E) from Uhrf1 cKO Z/EG mice immunostained with recoverin (photoreceptors), cone-arrestin (cone photoreceptors), calbindin (horizontal and a subset of amacrine cells), chx10 (bipolar), and pkc-alpha (bipolar) antibodies (red). Retinae were double immunostained with anti-GFP to capture areas of Chx10-Cre -mediated GFP expression. Nuclei were counterstained with DAPI (blue). ONL, outer nuclear layer; INL, inner nuclear layer; GCL ganglion cell layer; ipl, inner plexiform layer; opl, outer plexiform layer. (F) Quantification of the proportion of immunoreactive cells for each cellular marker antibody shown in E and supplemental figure 3 was determined for EGFP+ and EGFP-cells from Uhrf1 cKO Z/EG mice from independent litters (n=3). Each bar represents the mean ± SD of 500 cells scored from each retina. (G-H) ERGs were recorded from 5-week-old Uhrf1 cKO (red line) and littermate control (black line). a-wave amplitude (G) and b-wave amplitude (H) were recorded at various light intensities. All measurements are mean ± SD (n=4).

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: Western Blot, Expressing, Control, Quantitative RT-PCR, Marker, Two Tailed Test

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A-B) Uhrf1 protein level in P21 retinae and retinoblastoma tumor samples were compared to littermate controls (wt). Tubulin was used as loading control. (C) Chromatin immunoprecipitation (ChIP) assay in P0 mouse retinae and Weri retinoblastoma human cell line reveals enrichment of E2f1 within the Uhrf1 promoter. (D-E) Western blot analysis of Uhrf1 protein level in different retinae development stages in Rb1 cKO mice and Rb1/Rbl1 cDKO. Tubulin was used as loading control. (F) Quantification of Uhrf1 protein expression in Rb/Rbl1 cDKO. (G) RT-qPCR analysis of Uhrf1 mRNA level in Rb1/Rbl1 cDKO. Uhrf1 mRNA level in E17.5 wt mouse was set as 1. (H) Representative sequencing tracks for the Uhrf1 locus show increased peaks at the promoter in P21 Rb1/Rbl1 DKO mouse retinal cells (EGFP+) compared to control retinal cells (EGFP-). The ATAC-Seq data have been normalized to take sequencing depth into account. All measurements are mean ± SD (n=3).

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: Control, Chromatin Immunoprecipitation, Western Blot, Expressing, Quantitative RT-PCR, Sequencing

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A) Kaplan-Meier curves showing the percentage of mice free of visible retinoblastoma tumors in Rb1/Rbl1 DKO (n=52) and Rb1/Rbl1/Uhrf1 (n=41) mice. (B) Volcano plot of differentially expressed genes (DEGs) in Rb1/Rbl1/Uhrf1 TKO compared to Rb1/Rbl1 DKO P21 mouse retinae. (C-D) p-value ranking bar graph representing the ten most significant gene ontology (GO) biological processes for (C) upregulated genes and (D) downregulated genes in Rb1/Rbl1/Uhrf1 TKO compared with Rb1/Rbl1 DKO P21 retinae. (E) Genome-wide heatmap plot of chromatin accessibility peaks (ATAC-seq) from flow sorted EGFP-negative ( Cre -negative) Rb1/Rbl1/Uhrf1 and EGFP-positive Rb1/Rbl1 DKO and Rb1/Rbl1/Uhrf1 TKO P21 retina grouped by mean reads and by distance from the transcription starting site (TSS). Each row represents a gene ordered in descending accessibility mean reads. (F) Heat map of differentially methylated genes in Cre -positive Rb1/Rbl1/Uhrf1 , Rb1/Rbl1 DKO and Cre -negative Rb1/Rbl1/Uhrf1 TKO P21 retina. (G-H) Representative images of (G) P12 retina and (H) P21 retina cross-sections from Rb1/Rbl1 DKO and Rb1/Rbl1/Uhrf1 TKO mice labeled with EdU (proliferating cells; red). Nuclei were counterstained with DAPI (blue). (I-J) Quantification of the proportion of EdU positive cells in (I) P12 and (J) P21 Rb/Rbl1 cDKO and dissociated retina Each bar represents the mean ± SD of 500 cells scored from each retina. (n=3). *p<0.05, **p<0.01 by unpaired two-tailed t test.

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: Genome Wide, Methylation, Labeling, Two Tailed Test

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A) p-value ranking bar graph representing the ten most significant cell types for downregulated genes in Rb1/Rbl1/Uhrf1 TKO compared with Rb1/Rbl1 DKO P21 retinae. (B) Gene Set Enrichment Analysis (GSEA) enrichment plot of the fetal eye microglia gene cluster from the RNA-seq data comparing Rb1/Rbl1/Uhrf1 TKO to Rb1/Rbl1 DKO P21 retinae. (C) Western blot analysis of Uhrf1 protein level in VC or Uhrf1 KO UCI-Rb-1. Actin was used as loading control. (D) Representative bioluminescent images from mice orthotopically implanted with VC or Uhrf1 KO UCI-Rb-1 cells at 2-weeks post sub-retinal injection. (E) Quantification of the percentage of mice presenting tumors at 2-weeks post implantation with either 150000 (150K) or 100000 (100K) cells in immune-competent mice. (F) Quantification of the final tumor weight at 2 weeks post implantation. (G) Schematic workflow of the immune flow analysis of retinoblastoma tumors derived from VC and Uhrf1 KO UCI-Rb-1 cells after 2 weeks post-implantation. (H-O) Quantification of the percentage of (H) live cells, (I) leukocytes, (J) microglia, (K) myeloid cells, (L) dendritic cells, (M) T-cell, (N) helper T cells, and (O) cytotoxic T cells. Lines represent median ± SD. VC shown in black dots (n=12) and Uhrf1 KO shown in red dots (n=8). For all graphs: ns=not significant, *p<0.05 by unpaired two-tailed t test.

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: RNA Sequencing, Western Blot, Control, Injection, Derivative Assay, Two Tailed Test

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A) Gene Set Enrichment Analysis (GSEA) enrichment plot of gene ontology for biological process for positive regulation of chemokine production from the RNA-seq data comparing Rb1/Rbl1/Uhrf1 TKO to Rb1/Rbl1 DKO P21 retinae. (B) Chemokine immunoassay analysis from conditioned media from VC and Uhrf1 KO UCI-Rb-1 cells. (C) Quantification of the chemokines identified in B. (n=2 independent batches). mean ± SD *p<0.05 by unpaired two-tailed t test. (D) GSEA enrichment plot for the hallmark for TNF alpha signaling via NF-kB from the RNA-seq data comparing Rb1/Rbl1/Uhrf1 TKO to Rb1/Rbl1 DKO P21 retinae. (E) Western blot analysis of NF-kB family proteins level in VC and Uhrf1 KO UCI-Rb-1. Actin was used as loading control. (F) Schematic summary of the role of Uhrf1 in retinoblastomagenesis.

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: RNA Sequencing, Two Tailed Test, Western Blot, Control

Journal: Oncotarget

Article Title: UHRF1 regulates global DNA hypomethylation and is associated with poor prognosis in esophageal squamous cell carcinoma

doi: 10.18632/oncotarget.11067

Figure Lengend Snippet: ( A ) UHRF1 mRNA expression levels in esophageal cancers and matched normal mucosa ( N = 16). The cancer tissues showed significantly higher levels of expression than the matched normal mucosa ( P < 0.0001 by paired t -test). ( B ) UHRF1 immunostaining of esophageal cancer and normal esophageal mucosa. (a) Cancerous lesions show positive staining whereas normal mucosa shows negative staining. (b) Positive expression of UHRF1 in nuclei of esophageal cancer cells. (c) Negative expression of UHRF1 in nuclei of esophageal cancer cells. ( C ) UHRF1 mRNA expression levels were negatively associated with LINE-1 methylation levels ( P = 0.0044). ( D ) UHRF1-positive tumors showed significantly lower levels of LINE-1 methylation than UHRF1-negative tumors ( P = 0.00080 by paired t -test).

Article Snippet: The primers for real-time PCR were as follows: UHRF1 , Hs00273589_m1 (Taqman probe, Applied Biosystems, Foster City, CA), and 18S , Hs99999901_S1 (Taqman probe, Applied Biosystems).

Techniques: Expressing, Immunostaining, Staining, Negative Staining, Methylation

Journal: Oncotarget

Article Title: UHRF1 regulates global DNA hypomethylation and is associated with poor prognosis in esophageal squamous cell carcinoma

doi: 10.18632/oncotarget.11067

Figure Lengend Snippet: ( A ) Western blot analysis of UHRF1 expression in KYSE30 cells treated with GFP-fused UHRF1 vector. ( B ) Vector-mediated UHRF1 overexpression caused LINE-1 hypomethylation ( P = 0.005). ( C ) Pyrograms for LINE-1 methylation levels in KYSE30. ( D , E ) Changes in DNA methylation after co-transfection with UHRF1 vector and EGFP-MBD1 vector. ( F ) Expression of EGFP-MBD1 after co-transfection determined by western blot analysis.

Article Snippet: The primers for real-time PCR were as follows: UHRF1 , Hs00273589_m1 (Taqman probe, Applied Biosystems, Foster City, CA), and 18S , Hs99999901_S1 (Taqman probe, Applied Biosystems).

Techniques: Western Blot, Expressing, Plasmid Preparation, Over Expression, Methylation, DNA Methylation Assay, Cotransfection

Journal: Oncotarget

Article Title: UHRF1 regulates global DNA hypomethylation and is associated with poor prognosis in esophageal squamous cell carcinoma

doi: 10.18632/oncotarget.11067

Figure Lengend Snippet: ( A ) Western blot analysis of UHRF1 expression in cells transfected with siUHRF1. ( B , C ) Changes in DNA methylation after cotransfection with siUHRF1 and EGFP-MBD1 vector. ( D ) EGFP-MBD1 expression after cotransfection, as determined by western blotting.

Article Snippet: The primers for real-time PCR were as follows: UHRF1 , Hs00273589_m1 (Taqman probe, Applied Biosystems, Foster City, CA), and 18S , Hs99999901_S1 (Taqman probe, Applied Biosystems).

Techniques: Western Blot, Expressing, Transfection, DNA Methylation Assay, Cotransfection, Plasmid Preparation

Journal: Oncotarget

Article Title: UHRF1 regulates global DNA hypomethylation and is associated with poor prognosis in esophageal squamous cell carcinoma

doi: 10.18632/oncotarget.11067

Figure Lengend Snippet: Relationship beween UHRF1 expression, clinical and pathological features

Article Snippet: The primers for real-time PCR were as follows: UHRF1 , Hs00273589_m1 (Taqman probe, Applied Biosystems, Foster City, CA), and 18S , Hs99999901_S1 (Taqman probe, Applied Biosystems).

Techniques: Expressing

Journal: Oncotarget

Article Title: UHRF1 regulates global DNA hypomethylation and is associated with poor prognosis in esophageal squamous cell carcinoma

doi: 10.18632/oncotarget.11067

Figure Lengend Snippet: ( A ) Kaplan–Meier curves according to UHRF1 expression status. ( B ) Kaplan–Meier curves according to LINE-1 methylation status. ( C ) Possible mechanism by which UHRF1 confers a poor prognosis in ESCC.

Article Snippet: The primers for real-time PCR were as follows: UHRF1 , Hs00273589_m1 (Taqman probe, Applied Biosystems, Foster City, CA), and 18S , Hs99999901_S1 (Taqman probe, Applied Biosystems).

Techniques: Expressing, Methylation

Journal: Journal of Ovarian Research

Article Title: UHRF1 gene silencing inhibits cell proliferation and promotes cell apoptosis in human cervical squamous cell carcinoma CaSki cells

doi: 10.1186/s13048-016-0253-8

Figure Lengend Snippet: PCR primer sequences

Article Snippet: UHRF1 siRNA and control siRNA were purchased from Santa Cruz (sc-76805, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA).

Techniques: Sequencing

Journal: Journal of Ovarian Research

Article Title: UHRF1 gene silencing inhibits cell proliferation and promotes cell apoptosis in human cervical squamous cell carcinoma CaSki cells

doi: 10.1186/s13048-016-0253-8

Figure Lengend Snippet: UHRF1 mRNA expression detected by quantificational real-time polymerase chain reaction. a Comparison in UHRF1 expression between CSCC tissues ( n = 47) and normal cervical tissues ( n = 40), revealing that UHRF1 expression in CSCC tissues was much higher than that in normal cervical tissues; *, P < 0.05 compared with the Control group; b Comparison in UHRF1 expression among CaSki cells of different transfection groups ( n = 3), revealing that the UHRF1 Silence group had a significantly lower level of UHRF1 mRNA expression than the Blank group and the NC group; #, P < 0.05 compared with the Blank group; &, P < 0.05 compared with the NC group; UHRF1 , ubiquitin-like, containing plant homeodomain (PHD) and really interesting new gene (RING) finger domains 1 ; CSCC, cervical squamous cell carcinoma; NC, negative control

Article Snippet: UHRF1 siRNA and control siRNA were purchased from Santa Cruz (sc-76805, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA).

Techniques: Expressing, Real-time Polymerase Chain Reaction, Comparison, Control, Transfection, Ubiquitin Proteomics, Negative Control

Journal: Journal of Ovarian Research

Article Title: UHRF1 gene silencing inhibits cell proliferation and promotes cell apoptosis in human cervical squamous cell carcinoma CaSki cells

doi: 10.1186/s13048-016-0253-8

Figure Lengend Snippet: UHRF1 protein expression detected by Western blot. a Western blot map of CSCC tissues ( n = 47), normal cervical tissues ( n = 40) and CaSki cells in different transfection groups ( n = 3); b Comparison of UHRF1 protein expression between CSCC tissues ( n = 47) and normal cervical tissues ( n = 40), showing that CSCC tissues had a significantly higher UHRF1 protein expression level than normal cervical tissues; *, P < 0.05 compared with the Control group; c Comparison of UHRF1 protein expression among CaSki cells in different transfection groups ( n = 3), showing that the UHRF1 Silence group had a significantly lower level of UHRF1 protein expression than the Blank group and the NC group; #, P < 0.05 compared with the Blank group; &, P < 0.05 compared with the NC group; UHRF1, ubiquitin-like, containing plant homeodomain (PHD) and really interesting new gene (RING) finger domains 1; CSCC, cervical squamous cell carcinoma; NC, negative control

Article Snippet: UHRF1 siRNA and control siRNA were purchased from Santa Cruz (sc-76805, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA).

Techniques: Expressing, Western Blot, Transfection, Comparison, Control, Ubiquitin Proteomics, Negative Control

Journal: Journal of Ovarian Research

Article Title: UHRF1 gene silencing inhibits cell proliferation and promotes cell apoptosis in human cervical squamous cell carcinoma CaSki cells

doi: 10.1186/s13048-016-0253-8

Figure Lengend Snippet: Cell proliferation detected by CCK-8. At each time point, the UHRF1 Silence group had a much lower proliferation ability than the Blank group and the NC group; *, P < 0.05 compared with the Control group, n = 3; UHRF1, ubiquitin-like, containing plant homeodomain (PHD) and really interesting new gene (RING) finger domains 1; NC, negative control

Article Snippet: UHRF1 siRNA and control siRNA were purchased from Santa Cruz (sc-76805, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA).

Techniques: CCK-8 Assay, Control, Ubiquitin Proteomics, Negative Control

Journal: Journal of Ovarian Research

Article Title: UHRF1 gene silencing inhibits cell proliferation and promotes cell apoptosis in human cervical squamous cell carcinoma CaSki cells

doi: 10.1186/s13048-016-0253-8

Figure Lengend Snippet: Cell cycle detected by flow cytometer. Compared with the Blank group and the NC group, the ratio of S-G2M phase cells in UHRF1 Silence group decreased significantly, while the ratio of G0/G1 phase cells increased obviously. The UHRF1 Silence group induced the apoptosis of CaSki cells, which could be substantiated by the appearance of sub-G1 peak in flow cytometric DNA histogram. The peak appeared ahead of the G0/G1 peak, and represented cell apoptosis. *, P < 0.05 compared with the Blank group; #, P < 0.05 compared with the NC group; n = 3; UHRF1, ubiquitin-like, containing plant homeodomain (PHD) and really interesting new gene (RING) finger domains 1; NC, negative control

Article Snippet: UHRF1 siRNA and control siRNA were purchased from Santa Cruz (sc-76805, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA).

Techniques: Flow Cytometry, Ubiquitin Proteomics, Negative Control

Journal: Journal of Ovarian Research

Article Title: UHRF1 gene silencing inhibits cell proliferation and promotes cell apoptosis in human cervical squamous cell carcinoma CaSki cells

doi: 10.1186/s13048-016-0253-8

Figure Lengend Snippet: Cell apoptosis detected by flow cytometer. Annexin V + PI - represents early apoptosis cells (Q4), annexin V + PI + represents late apoptosis cells (Q2). The Annexin V-positive cells (early and late apoptosis cells) in the UHRF1 Silence group increased evidently as compared with the Blank group and the NC group, which indicated increased apoptosis cells. *, P < 0.05 compared with the Blank group; #, P < 0.05 compared with the NC group; n = 3; UHRF1, ubiquitin-like, containing plant homeodomain (PHD) and really interesting new gene (RING) finger domains 1; NC, negative control

Article Snippet: UHRF1 siRNA and control siRNA were purchased from Santa Cruz (sc-76805, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA).

Techniques: Flow Cytometry, Ubiquitin Proteomics, Negative Control

Journal: Journal of Ovarian Research

Article Title: UHRF1 gene silencing inhibits cell proliferation and promotes cell apoptosis in human cervical squamous cell carcinoma CaSki cells

doi: 10.1186/s13048-016-0253-8

Figure Lengend Snippet: Apoptosis related protein expression detected by Western blot. Compared with the Blank group and the NC group, apoptosis-related proteins, namely Caspase3, Caspase8, Caspase9 and Bax, had a much higher level in the UHRF1 Silence group, while anti-apoptotic protein (Bcl-2) had a much lower level. *, P < 0.05 compared with the Blank group; #, P < 0.05 compared with the NC group, n = 3; UHRF1, ubiquitin-like, containing plant homeodomain (PHD) and really interesting new gene (RING) finger domains 1; NC, negative control

Article Snippet: UHRF1 siRNA and control siRNA were purchased from Santa Cruz (sc-76805, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA).

Techniques: Expressing, Western Blot, Ubiquitin Proteomics, Negative Control

Journal: Journal of Ovarian Research

Article Title: UHRF1 gene silencing inhibits cell proliferation and promotes cell apoptosis in human cervical squamous cell carcinoma CaSki cells

doi: 10.1186/s13048-016-0253-8

Figure Lengend Snippet: Tumor-bearing nude mice model experiment. a growth curve of tumor volume. The tumor growth speed in the UHRF1 Silence group was much slower than that in the Blank group and NC group; b tumor weight. The tumor weight in the UHRF1 Silence group was much lower than that in the Blank group and the NC group; c immunohistochemical staining of tumor sections; d the number of PCNA-positive cells. The number of UHRF1-positive and PCNA-positive cells in the UHRF1 Silence group was much smaller than that in the Blank group and NC group. *, P < 0.05 compared with the NC group; #, P < 0.05 compared with the NC group; UHRF1, ubiquitin-like, containing plant homeodomain (PHD) and really interesting new gene (RING) finger domains 1; NC, negative control; PCNA, proliferating cell nuclear antigen

Article Snippet: UHRF1 siRNA and control siRNA were purchased from Santa Cruz (sc-76805, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA).

Techniques: Immunohistochemical staining, Staining, Ubiquitin Proteomics, Negative Control

Journal: Cell reports

Article Title: SMYD3 represses tumor-intrinsic interferon response in HPV-negative squamous cell carcinoma of the head and neck

doi: 10.1016/j.celrep.2023.112823

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: HA-UHRF1 plasmid , SinoBiological , Cat# HG17896-CY.

Techniques: Recombinant, Staining, Purification, Negative Control, CRISPR, Plasmid Preparation, Software, Blocking Assay

Journal: Investigative Ophthalmology & Visual Science

Article Title: Setd1a Plays Pivotal Roles for the Survival and Proliferation of Retinal Progenitors via Histone Modifications of Uhrf1

doi: 10.1167/iovs.62.6.1

Figure Lengend Snippet: Expression of Uhrf1 transcripts was decreased by the expression of shSetd1. ( A ) Schematic representation of alternative splicing products of Uhrf1 . Adapted from the schematic data of asia.ensembl.org. ( B ) . Transition of expression level of transcripts of Uhrf1 during mouse retinal development from RNA-Seq data of whole mouse retina (GSE87064). ( C ) Retinas at E17 were transfected with control or shSetd1a plasmids with an EGFP expression vector and cultured 2 days. EGFP positive-cells were purified, and RNA-Seq was performed. Expression levels of Uhrf1 splicing variants in the control or shSet1a-expressing retinas are shown. Values are average of 3 or 4 samples of RNA-Seq (GSE154498) data with standard deviation. *q < 0.05 (false discovery rate). TPM, transcripts per million. ( D ) H3K4me3 levels at Uhrf1 locus during mouse retinal development from ChIP-Seq data of whole mouse retina (viz.stjude.cloud). Locus of three primer sets for ChIP-qPCR (E) are shown in the red box . ( E ) The retinas at E17 were transfected with control or shSetd1a with EGFP expression plasmids and cultured for 2 days. EGFP-positive cells were collected and subjected to ChIP-qPCR using anti-H3K4me3 antibody. Uhrf1 promoter regions were amplified by using three different primer sets. Values are average of at least three independent samples with standard deviation. * p < 0.05 (Student t -test).

Article Snippet: The full-length Uhrf1_HA was purchased from Sino Biological (MG53591-CY, China), and shUhrf1‐resistant Uhrf1 was made by inverse PCR using the KOD‐Plus‐Mutagenesis Kit (Toyobo).

Techniques: Expressing, RNA Sequencing Assay, Transfection, Plasmid Preparation, Cell Culture, Purification, Standard Deviation, ChIP-sequencing, Amplification

Journal: Investigative Ophthalmology & Visual Science

Article Title: Setd1a Plays Pivotal Roles for the Survival and Proliferation of Retinal Progenitors via Histone Modifications of Uhrf1

doi: 10.1167/iovs.62.6.1

Figure Lengend Snippet: Expression of shUhrf1 perturbed retinal development. Plasmids encoding control, shUhrf1, UHRF1, or shSetd1a and EGFP expression plasmids were electroporated into mouse retina at E14 (B, C) or E17 (A, D – F) . Combination of transfected plasmids are indicated in the figures. ( A ) After sorting EGFP-positive cells, total RNA was purified and served to RT-qPCR. The averages of three independent samples with standard deviations are shown. * p < 0.05 (Student t -test). ( B–E ) Immunostaining using anti-AC3 (B, D) or anti-Ki67 (C, E) with -EGFP antibodies was done. ( F ) The incorporated EdU was detected by a click reaction. The percentages of EGFP and AC3 (B, D) , EGFP and Ki67 (C, E) , or EGFP and EdU (F) double-positive cells in the total EGFP-positive cells are shown. Values are average of three independent samples with standard deviation. * p < 0.05 (Student t -test or Tukey's HSD test). Scale bar = 50 µm. GCL, ganglion cell layer; NBL, neuroblastic layer.

Article Snippet: The full-length Uhrf1_HA was purchased from Sino Biological (MG53591-CY, China), and shUhrf1‐resistant Uhrf1 was made by inverse PCR using the KOD‐Plus‐Mutagenesis Kit (Toyobo).

Techniques: Expressing, Transfection, Purification, Quantitative RT-PCR, Immunostaining, Standard Deviation