Journal: Molecular Genetics and Metabolism Reports

Article Title: Nuclear tristetraprolin acts as a corepressor of multiple steroid nuclear receptors in breast cancer cells

doi: 10.1016/j.ymgmr.2016.02.004

Figure Lengend Snippet: TTP overexpression represses ERα, PR, GR and AR transactivation in MCF-7 cells. Human breast cancer MCF-7 cells were transiently transfected with empty pCMV-3TAG vector (control) or with 0.25 μg of pCMV-3TAG-TTP (FLAG-TTP) along with the corresponding luciferase reporter vector. The effect of TTP on nuclear hormone receptors transactivation was determined by assay of luciferase activity, as described under “Experimental Procedures.” Assays were performed in triplicate in three independent experiments in the presence (white bars) or absence (black bars) of the corresponding nuclear receptor ligands (17β-estradiol for ERα, progesterone for PR, 5α-Androstan-17β-ol-3-on for AR and dexamethasone for GR. The results are represented as mean ± S.E. Differences in ERα activity between control MCF-7 cells and TTP-expressing MCF-7 cells are statistically significant ( p < 0.05).

Article Snippet: Human ERα antibody (Sc D -12, Sc HC-20) and Human TTP antibody (Sc-12565) were purchased from Santa Cruz Biotechnology, Inc. and TTP polyclonal (T5327) antibody was from Sigma-Aldrich.

Techniques: Over Expression, Transfection, Plasmid Preparation, Control, Luciferase, Activity Assay, Expressing

Journal: Molecular Genetics and Metabolism Reports

Article Title: Nuclear tristetraprolin acts as a corepressor of multiple steroid nuclear receptors in breast cancer cells

doi: 10.1016/j.ymgmr.2016.02.004

Figure Lengend Snippet: TTP interacts with ERα, PR, GR and AR in vivo . Endogenous ERα (A), PR (B), AR (C) and GR (C) were immunoprecipitated from protein extracts prepared from MCF-7 cells using specific antibodies. Immunoprecipitated proteins were resolved by PAGE, and the binding of TTP was visualized by Western blot. The input lane represents 10% of the protein extract used in the coimmunoprecipitation assays. IP: immunoprecipitation, WB: Western blot.

Article Snippet: Human ERα antibody (Sc D -12, Sc HC-20) and Human TTP antibody (Sc-12565) were purchased from Santa Cruz Biotechnology, Inc. and TTP polyclonal (T5327) antibody was from Sigma-Aldrich.

Techniques: In Vivo, Immunoprecipitation, Binding Assay, Western Blot

Journal: Molecular Genetics and Metabolism Reports

Article Title: Nuclear tristetraprolin acts as a corepressor of multiple steroid nuclear receptors in breast cancer cells

doi: 10.1016/j.ymgmr.2016.02.004

Figure Lengend Snippet: siRNA-mediated knockdown of TTP protein levels in MCF-7 cells. MCF-7 cells were transfected with specific siRNA-TTP (1.25 μg) or with an unrelated control siRNA (2.5 μg). (A) Protein extracts from MCF-7 cultures were resolved by PAGE, and expression levels of TTP, ERα, PR, GR, AR and tubulin, as a loading control protein, were evaluated by Western blot using specific antibodies as described under “Experimental Procedures.” TTP knockdown increases ERα, PR, GR and AR transactivation. MCF-7 cells were transfected with an unrelated siRNA (control) or a specific TTP-siRNA (1.5 μg), along with TK-LUC, in the presence of the corresponding nuclear receptor ligands. The effect of TTP-siRNA on ERα (B), PR (C), GR (D) and AR (E) transactivation was determined by a luciferase assay and compared with luciferase activity in MCF-7 cells transfected with empty pCMV-3TAG vector and the corresponding Tk-LUC reporter vector. Results, in triplicate in three independent experiments, are represented as mean ± S.E. (error bars). Differences in ERα activity in MCF-7 cells transfected with TTP or with TTP-siRNA were shown to be statistically significant ( p < 0.05).

Article Snippet: Human ERα antibody (Sc D -12, Sc HC-20) and Human TTP antibody (Sc-12565) were purchased from Santa Cruz Biotechnology, Inc. and TTP polyclonal (T5327) antibody was from Sigma-Aldrich.

Techniques: Knockdown, Transfection, Control, Expressing, Western Blot, Luciferase, Activity Assay, Plasmid Preparation

Journal: eLife

Article Title: Differentiation of mouse fetal lung alveolar progenitors in serum-free organotypic cultures

doi: 10.7554/eLife.65811

Figure Lengend Snippet: ( A ) IC261, CX-4945, and DMAT treatments (48 h) lead to downregulation of AT2 cell markers. TTP22 and Emodin (also CK2 inhibitors) do not lead to the same phenotype, possibly due to differences in potency/target affinity. Expression levels relative to DMSO control. Three biological replicates (consisting of 2 technical replicates each) were analyzed per compound. ( B ) Casein Kinase inhibition by IC261, CX-4945, and DMAT (6 h) leads to reduced Axin2 relative expression. Treatment with TTP22 or Emodin does not significantly affect Axin2 levels. More than three biological replicates were analyzed. ( C ) CK inhibition reduced WNT/β-catenin-dependent transcription in HEK293T epithelial cells (SuperTOPFlash-based luciferase assay). ( B ) Mean values are displayed; error bars represent S.D.; p - values from one-way ANOVA, Tukey’s multiple comparisons test. ( C ) Mean values displayed; error bars represent S.D.; p-values from one-way ANOVA, Tukey’s multiple comparisons test; displayed p-values refer to comparisons with WNT3A-treated condition. Figure 4—source data 1. Normalized expression values of AT2 cell markers, CK inhibitors vs. DMSO control. Normalized Axin2 expression values, CK inhibitors vs. DMSO control and related statistics. Raw luciferase data. Normalized luciferase values and related statistics.

Article Snippet: Chemical compound, drug , TTP22 , Tocris , Tocris:4432 , (10 μM).

Techniques: Expressing, Control, Inhibition, Luciferase

Journal: eLife

Article Title: Differentiation of mouse fetal lung alveolar progenitors in serum-free organotypic cultures

doi: 10.7554/eLife.65811

Figure Lengend Snippet:

Article Snippet: Chemical compound, drug , TTP22 , Tocris , Tocris:4432 , (10 μM).

Techniques: Recombinant, Transfection, Construct, Plasmid Preparation, Mutagenesis, Reporter Assay, Reverse Transcription, SYBR Green Assay, Sequencing, Software

Journal: eLife

Article Title: Differentiation of mouse fetal lung alveolar progenitors in serum-free organotypic cultures

doi: 10.7554/elife.65811

Figure Lengend Snippet: Figure 4. Compounds promoting AT1 cell differentiation lead to concomitant loss of AT2 marker gene expression and WNT-dependent transcription. (A) IC261, CX-4945, and DMAT treatments (48 h) lead to downregulation of AT2 cell markers. TTP22 and Emodin (also CK2 inhibitors) do not lead to the same phenotype, possibly due to differences in potency/target affinity. Expression levels relative to DMSO control. Three biological replicates (consisting of 2 technical replicates each) were analyzed per compound. (B) Casein Kinase inhibition by IC261, CX-4945, and DMAT (6 h) leads to reduced Axin2 relative expression. Treatment with TTP22 or Emodin does not significantly affect Axin2 levels. More than three biological replicates were analyzed. (C) CK inhibition reduced WNT/β-catenin-dependent transcription in HEK293T epithelial cells (SuperTOPFlash-based luciferase assay). (B) Mean values are displayed; error bars represent S.D.; p-values from one-way ANOVA, Tukey’s multiple comparisons test. (C) Mean values displayed; error bars represent S.D.; p-values from one-way ANOVA, Tukey’s multiple comparisons test; displayed p-values refer to comparisons with WNT3A- treated condition.

Article Snippet: or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Emodin Tocris Tocris:3811 (10 μM) Chemical compound, drug TTP22 Tocris Tocris:4432 (10 μM) Chemical compound, drug IC261 Sigma Sigma:I0658 (10 μM) Chemical compound, drug CX- 4945 Enzo Life Sciences Enzo Life Sciences: ENZ- CHM151 (10 μM) Chemical compound, drug DMAT Sigma Sigma:SML2044 (10 μM) Chemical compound, drug IWR- 1 Sigma Sigma:I0161 (10 μM) Commercial assay or kit Dual- Luciferase Reporter Assay System Promega Promega:E1910 Commercial assay or kit NucleoSpin RNA kit Macherey- Nagel MachereyNagel:740955.50 Commercial assay or kit Superscript III Reverse Transcriptase system Invitrogen Thermo Fisher Scientific:18080093 Commercial assay or kit DyNAmo ColorFlash SYBR green qPCR kit Thermo Scientific Thermo Fisher Scientific:F416XL Sequencebased reagent qPCR This paper Supplementary file 1 Software, algorithm Fiji/ImageJ 1.53 c Schindelin et al., 2012; doi:10.1038/nmeth.2019 RRID:SCR_002285 Software, algorithm GraphPad Prism 8 GraphPad RRID:SCR_002798 Continued

Techniques: Cell Differentiation, Marker, Gene Expression, Expressing, Control, Inhibition, Luciferase

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) Forest plots depicting RNA and IHC-based for ZFP36 /TTP expression related to clinical outcomes (biochemical recurrence and disease-free survival) and risk of lethal prostate cancer (case-control cohorts). (B) (left) Upregulated and downregulated genes were identified by differential expression analysis of TCGA PRAD cases divided by lower quartile expression of ZFP36 ; (right). (C) Representative images of IF staining in human PCa used for expression analysis. Benign glands (arrowheads) stain for pan-cytokeratin (yellow) and basal (red) cocktails; tumor cells (arrows) demonstrate absent basal expression (panels ii & iv). Corresponding sections (i & iii) demonstrate intact epithelial staining for TTP (green). Panels v-vi: Diffuse prostate tumor with absent TTP expression. (D) Kaplan Meier survival analysis demonstrating that TTP deficiency, measured by protein expression (DFCI ( , )) and ZFP36 mRNA expression (TCGA PRAD ; Taylor et al ), results in shorter disease-free-survival, and even shorter disease-free-survival in combination with PTEN deficiency.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Expressing, Control, Quantitative Proteomics, Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) hematoxylin and eosin staining of murine tumors highlighting morphological progression of wild-type (WT), Pten f/f / Zfp36 +/+ ( Pten -/-), Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 +/-) and Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 -/-) dorsolateral prostate tissue at 8 18, and 38 weeks. Scale bar 100 μm. (B) Comparative weight of dorsolateral and ventral prostate tissue in GEMMs at 18 and 38 weeks. (C) Kaplan Meier graphs from GEMM aging studies show that prostate-specific deletion of Zfp36 significantly reduces time-to-ethical endpoint in PCa driven by loss of Pten. *p<0.05, **p<0.005.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting positively and negatively enriched Hallmark pathways. (B) Phos-p65 IF and Masson’s Trichrome staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: RNA Sequencing, Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting significant positively and negatively enriched GOBP pathways. (B) Ki-67 IHC, and Krt18 and αSMA IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Increased tumor cell proliferation and basement membrane breakdown is observed with loss of Zfp36 . (C) Number of mice that displayed PCa cells in distant organs by recombination PCR in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMMs. (D) Representative androgen receptor (AR) IF staining in pelvic lymph nodes of Pten -/- and Pten -/- Zfp36 -/- GEMMs highlighting local dissemination of prostate cells. Scale bar 100 μm. AR staining was over exposed during imaging to assist with prostate cell identification. (E) Representative images and quantification of budding in GEMM-derived organoids highlighting increased invasive and metastatic potential of Pten -/- Zfp36 -/-organoids. (F) Scratch assay in GEMM-derived 2D cells, comparing Pten -/- and Pten -/- Zfp36 -/- wound healing with that of Pten -/- Rb1 -/-, a previously described metastatic, neuroendocrine PCa murine cell line . *p<0.05, **p<0.005, ***p<0.001, ****p<0.0001.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: RNA Sequencing, Staining, Membrane, Imaging, Derivative Assay, Wound Healing Assay

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) AR, synaptophysin (Syp) and CD45 IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005. (B) Dual Krt8 and CD45 IF staining in Pten -/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks. Scale bar 50 μm.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) Kaplan Meier graph from GEMM aging studies where mice were surgically castrated at 38 weeks comparing Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- mice, and whole prostate weights and representative images from mice 12 weeks post-castration. (B) Quantification of GEMM-derived Pten -/- and Pten -/- Zfp36 -/- organoid growth in the presence and absence of enzalutamide (10 μM). (C) Allograft tumor growth in mice treated with DMAPT (100 mg/kg/day) or water vehicle ± surgical castration, n=5 mice per treatment group. (D) End-point tumor volumes from allograft therapy studies. (E) Representative images and (F) quantification of cell death (green) in GEMM-derived PCa organoids treated with DMAPT (5 μM), enzalutamide (10 μM) or the combination of both for 72 hours, n=10 organoids per treatment group. (G) Representative images and flow cytometry quantification for CD45, synaptophysin, and AR expression in GEMM-derived PCa organoids treated with DMAPT (5 μM) or DMSO vehicle for 72 hours. (H) Fold-change in expression of the AR response gene – Fkbp5 in GEMM-derived 2D cell lines treated with DMAPT (5 μM) or DMSO vehicle for 72 hours, R1881 (10nM was used to stimulate AR activity. *p<0.05, **p<0.005, ***p<0.001. (I) Schematic overview: i) when ZFP36 is intact epithelial cells present with a luminal lineage phenotype and sensitivity to AR inhibition. ii) loss of ZFP36 results in an alternative epithelial cell lineage phenotype with reduced AR expression, increased SYP and CD45 expression, and increased NF-κB activation and inflammation, leading to lack of response to AR inhibition. iii) DMAPT treatment inhibits NF-κB and inflammation signaling and restores a more luminal epithelial cell type and responsiveness to AR inhibition.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Derivative Assay, Flow Cytometry, Expressing, Activity Assay, Inhibition, Activation Assay