ttp Search Results


96
SPT Labtech mosquito liquid dispenser
Mosquito Liquid Dispenser, supplied by SPT Labtech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ttp/10__1074_slash_jbc__m114__619767-100-13-16?v=SPT+Labtech
Average 96 stars, based on 1 article reviews
mosquito liquid dispenser - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology human ttp antibody
<t>TTP</t> overexpression <t>represses</t> <t>ERα,</t> PR, GR and AR transactivation in MCF-7 cells. Human breast cancer MCF-7 cells were transiently transfected with empty pCMV-3TAG vector (control) or with 0.25 μg of pCMV-3TAG-TTP (FLAG-TTP) along with the corresponding luciferase reporter vector. The effect of TTP on nuclear hormone receptors transactivation was determined by assay of luciferase activity, as described under “Experimental Procedures.” Assays were performed in triplicate in three independent experiments in the presence (white bars) or absence (black bars) of the corresponding nuclear receptor ligands (17β-estradiol for ERα, progesterone for PR, 5α-Androstan-17β-ol-3-on for AR and dexamethasone for GR. The results are represented as mean ± S.E. Differences in ERα activity between control MCF-7 cells and TTP-expressing MCF-7 cells are statistically significant ( p < 0.05).
Human Ttp Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ttp/pmc04832087-28-9-16?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
human ttp antibody - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Tocris ttp 22
<t>TTP</t> overexpression <t>represses</t> <t>ERα,</t> PR, GR and AR transactivation in MCF-7 cells. Human breast cancer MCF-7 cells were transiently transfected with empty pCMV-3TAG vector (control) or with 0.25 μg of pCMV-3TAG-TTP (FLAG-TTP) along with the corresponding luciferase reporter vector. The effect of TTP on nuclear hormone receptors transactivation was determined by assay of luciferase activity, as described under “Experimental Procedures.” Assays were performed in triplicate in three independent experiments in the presence (white bars) or absence (black bars) of the corresponding nuclear receptor ligands (17β-estradiol for ERα, progesterone for PR, 5α-Androstan-17β-ol-3-on for AR and dexamethasone for GR. The results are represented as mean ± S.E. Differences in ERα activity between control MCF-7 cells and TTP-expressing MCF-7 cells are statistically significant ( p < 0.05).
Ttp 22, supplied by Tocris, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ttp/pmc05514713-458-0-7?v=Tocris
Average 90 stars, based on 1 article reviews
ttp 22 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

95
Proteintech antibodies against ttp
The highly expressed <t>TTP</t> was identified as a crucial factor in response to the IgE-mediated inflammatory syndrome. A , the robust rank aggregation (RRA) algorithm integrated upregulated genes (Log 2 Foldchange>1 and p < 0.05) from three datasets of three IgE-mediated inflammatory syndromes (allergic rhinitis, asthma, and atopic dermatitis) and their corresponding normal samples. B , the ranking graph displayed the genes that were upregulated in at least two datasets. Among them, the genes corresponding to the red dots (Frequency = 3) showed a significant increase in all three disease datasets, including TTP. C , intersection of the genes encoding CCCH-ZF (zinc finger)-type proteins with the genes upregulated in the nasal mucosa of patients with allergic rhinitis. D , the assessment of evolutionary conservation of amino acid positions, especially two CCCH-ZF repeat regions, in the mouse TTP protein. Conservation scores ranged from 1 to 9, where one was the most highly variable, five was of intermediate conservation, and nine was the most highly conserved position. E , experimental scheme of ragweed pollen (RW)-induced AR model, divided into the sensitization stage (0 and 7 days) and the stimulation stage (14–17 days). The control mice were treated with PBS instead of RW (N = 6 per group). F , relative RNA expressions of TTP in nasal tissues of RW-induced AR mice and control mice. G , compare the frequencies of sneezing and nose-rubbing within 10 min between control mice and AR mice after 14 days. H , immunofluorescence staining of TTP protein ( red ) <t>and</t> <t>CD4</t> protein ( green ) was performed in normal and RW nasal tissues. DAPI ( blue ) was used for nuclear staining (Scale bar = 50 μm). I , quantitative analyses of CD4 + T cell percentages and TTP fluorescence intensity in nasal mucosal tissues from sham and AR model mice. Data are shown as means ± SD (N = 6), Student's t test was used for statistical analysis of control mice and AR mice.
Antibodies Against Ttp, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ttp/pmc12992095-251-6-11?v=Proteintech
Average 95 stars, based on 1 article reviews
antibodies against ttp - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology human ttp
Figure 1. Dose-dependent induction of <t>TTP</t> in MDA-MB-231 cells by three compounds selected from the fourth screening of the natural compound library. (A) Dose-dependent changes in luciferase activity. MDA-MB-231 cells were transfected with pGL3/TTPp-1343 luciferase reporter vector containing the <t>human</t> <t>TTP</t> promoter, followed by stimulation with different concentrations of three selected compounds solubilized in DMSO for 48 h. The same volume of DMSO was added to the cells as controls. For each compound, the fold change in luciferase activity of stimulated cells was calculated relative to that of the DMSO control. The graphs are mean ± SD of three independent experiments (Two-way ANOVA). Black bars, control; red bars, 01-E10; green bars, 01-G05; violet bars, 05-A06. (B–D) Dose-dependent changes in endogenous TTP level. MDA-MB-231 cells were stimulated with different concentrations of compounds (B) 01-E10, (C) 01-G05, and (D) 05-A06 for 48 h. The expression level of TTP mRNA was analyzed by qRT-PCR. For each compound, the fold change in expression level was calculated relative to that of the DMSO control. The graphs are mean ± SD of three independent experiments (one-way ANOVA, * p < 0.01). (E) Structure of compound 05-A06, an enantiomer of BTM-21-P and DXM-21-P.
Human Ttp, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ttp/pm36430156-313-5-19?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
human ttp - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Addgene inc thettpplasmid
Figure 1. Dose-dependent induction of <t>TTP</t> in MDA-MB-231 cells by three compounds selected from the fourth screening of the natural compound library. (A) Dose-dependent changes in luciferase activity. MDA-MB-231 cells were transfected with pGL3/TTPp-1343 luciferase reporter vector containing the <t>human</t> <t>TTP</t> promoter, followed by stimulation with different concentrations of three selected compounds solubilized in DMSO for 48 h. The same volume of DMSO was added to the cells as controls. For each compound, the fold change in luciferase activity of stimulated cells was calculated relative to that of the DMSO control. The graphs are mean ± SD of three independent experiments (Two-way ANOVA). Black bars, control; red bars, 01-E10; green bars, 01-G05; violet bars, 05-A06. (B–D) Dose-dependent changes in endogenous TTP level. MDA-MB-231 cells were stimulated with different concentrations of compounds (B) 01-E10, (C) 01-G05, and (D) 05-A06 for 48 h. The expression level of TTP mRNA was analyzed by qRT-PCR. For each compound, the fold change in expression level was calculated relative to that of the DMSO control. The graphs are mean ± SD of three independent experiments (one-way ANOVA, * p < 0.01). (E) Structure of compound 05-A06, an enantiomer of BTM-21-P and DXM-21-P.
Thettpplasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ttp/10__1096_slash_fj__201900293rrr-91-0-1?v=Addgene+inc
Average 90 stars, based on 1 article reviews
thettpplasmid - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
OriGene ttp over expression vector
Figure 1. Dose-dependent induction of <t>TTP</t> in MDA-MB-231 cells by three compounds selected from the fourth screening of the natural compound library. (A) Dose-dependent changes in luciferase activity. MDA-MB-231 cells were transfected with pGL3/TTPp-1343 luciferase reporter vector containing the <t>human</t> <t>TTP</t> promoter, followed by stimulation with different concentrations of three selected compounds solubilized in DMSO for 48 h. The same volume of DMSO was added to the cells as controls. For each compound, the fold change in luciferase activity of stimulated cells was calculated relative to that of the DMSO control. The graphs are mean ± SD of three independent experiments (Two-way ANOVA). Black bars, control; red bars, 01-E10; green bars, 01-G05; violet bars, 05-A06. (B–D) Dose-dependent changes in endogenous TTP level. MDA-MB-231 cells were stimulated with different concentrations of compounds (B) 01-E10, (C) 01-G05, and (D) 05-A06 for 48 h. The expression level of TTP mRNA was analyzed by qRT-PCR. For each compound, the fold change in expression level was calculated relative to that of the DMSO control. The graphs are mean ± SD of three independent experiments (one-way ANOVA, * p < 0.01). (E) Structure of compound 05-A06, an enantiomer of BTM-21-P and DXM-21-P.
Ttp Over Expression Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ttp/pmc04951246-192-1-8?v=OriGene
Average 90 stars, based on 1 article reviews
ttp over expression vector - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Addgene inc paper n a pcdna4
Figure 1. Dose-dependent induction of <t>TTP</t> in MDA-MB-231 cells by three compounds selected from the fourth screening of the natural compound library. (A) Dose-dependent changes in luciferase activity. MDA-MB-231 cells were transfected with pGL3/TTPp-1343 luciferase reporter vector containing the <t>human</t> <t>TTP</t> promoter, followed by stimulation with different concentrations of three selected compounds solubilized in DMSO for 48 h. The same volume of DMSO was added to the cells as controls. For each compound, the fold change in luciferase activity of stimulated cells was calculated relative to that of the DMSO control. The graphs are mean ± SD of three independent experiments (Two-way ANOVA). Black bars, control; red bars, 01-E10; green bars, 01-G05; violet bars, 05-A06. (B–D) Dose-dependent changes in endogenous TTP level. MDA-MB-231 cells were stimulated with different concentrations of compounds (B) 01-E10, (C) 01-G05, and (D) 05-A06 for 48 h. The expression level of TTP mRNA was analyzed by qRT-PCR. For each compound, the fold change in expression level was calculated relative to that of the DMSO control. The graphs are mean ± SD of three independent experiments (one-way ANOVA, * p < 0.01). (E) Structure of compound 05-A06, an enantiomer of BTM-21-P and DXM-21-P.
Paper N A Pcdna4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ttp/pm30917308-199-17-44?v=Addgene+inc
Average 90 stars, based on 1 article reviews
paper n a pcdna4 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

93
Addgene inc murine zfp36
(A) Forest plots depicting RNA and IHC-based for <t>ZFP36</t> /TTP expression related to clinical outcomes (biochemical recurrence and disease-free survival) and risk of lethal prostate cancer (case-control cohorts). (B) (left) Upregulated and downregulated genes were identified by differential expression analysis of TCGA PRAD cases divided by lower quartile expression of ZFP36 ; (right). (C) Representative images of IF staining in human PCa used for expression analysis. Benign glands (arrowheads) stain for pan-cytokeratin (yellow) and basal (red) cocktails; tumor cells (arrows) demonstrate absent basal expression (panels ii & iv). Corresponding sections (i & iii) demonstrate intact epithelial staining for TTP (green). Panels v-vi: Diffuse prostate tumor with absent TTP expression. (D) Kaplan Meier survival analysis demonstrating that TTP deficiency, measured by protein expression (DFCI ( , )) and ZFP36 mRNA expression (TCGA PRAD ; Taylor et al ), results in shorter disease-free-survival, and even shorter disease-free-survival in combination with PTEN deficiency.
Murine Zfp36, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ttp/bio_rxiv__2022__08__05__500896-85-15-27?v=Addgene+inc
Average 93 stars, based on 1 article reviews
murine zfp36 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

96
SPT Labtech mosquito x1 pipetting robot
(A) Forest plots depicting RNA and IHC-based for <t>ZFP36</t> /TTP expression related to clinical outcomes (biochemical recurrence and disease-free survival) and risk of lethal prostate cancer (case-control cohorts). (B) (left) Upregulated and downregulated genes were identified by differential expression analysis of TCGA PRAD cases divided by lower quartile expression of ZFP36 ; (right). (C) Representative images of IF staining in human PCa used for expression analysis. Benign glands (arrowheads) stain for pan-cytokeratin (yellow) and basal (red) cocktails; tumor cells (arrows) demonstrate absent basal expression (panels ii & iv). Corresponding sections (i & iii) demonstrate intact epithelial staining for TTP (green). Panels v-vi: Diffuse prostate tumor with absent TTP expression. (D) Kaplan Meier survival analysis demonstrating that TTP deficiency, measured by protein expression (DFCI ( , )) and ZFP36 mRNA expression (TCGA PRAD ; Taylor et al ), results in shorter disease-free-survival, and even shorter disease-free-survival in combination with PTEN deficiency.
Mosquito X1 Pipetting Robot, supplied by SPT Labtech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ttp/pm29240790-230-27-31?v=SPT+Labtech
Average 96 stars, based on 1 article reviews
mosquito x1 pipetting robot - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

92
Proteintech sh3bp4 polyclonal antibody rabbit
(A) Forest plots depicting RNA and IHC-based for <t>ZFP36</t> /TTP expression related to clinical outcomes (biochemical recurrence and disease-free survival) and risk of lethal prostate cancer (case-control cohorts). (B) (left) Upregulated and downregulated genes were identified by differential expression analysis of TCGA PRAD cases divided by lower quartile expression of ZFP36 ; (right). (C) Representative images of IF staining in human PCa used for expression analysis. Benign glands (arrowheads) stain for pan-cytokeratin (yellow) and basal (red) cocktails; tumor cells (arrows) demonstrate absent basal expression (panels ii & iv). Corresponding sections (i & iii) demonstrate intact epithelial staining for TTP (green). Panels v-vi: Diffuse prostate tumor with absent TTP expression. (D) Kaplan Meier survival analysis demonstrating that TTP deficiency, measured by protein expression (DFCI ( , )) and ZFP36 mRNA expression (TCGA PRAD ; Taylor et al ), results in shorter disease-free-survival, and even shorter disease-free-survival in combination with PTEN deficiency.
Sh3bp4 Polyclonal Antibody Rabbit, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ttp/pm36329028-292-23-27?v=Proteintech
Average 92 stars, based on 1 article reviews
sh3bp4 polyclonal antibody rabbit - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

91
Santa Cruz Biotechnology zfp36 shrna plasmid
Figure 1. RNA-binding protein <t>ZFP36</t> expression is decreased during HSC ferroptosis. HSC-LX2 and HSC-T6 cells were treated with erastin (10 μM), sorafenib (10 μM), and RSL3 (2.5 μM), with or without the indicated inhibitors (liproxstatin-1, 100 nM; ZVAD-FMK, 10 μM; necrostatin-1, 10 μM) for 24 h. (A) Cell viability, MDA, and iron levels were assayed (n = 3 in every group, **, p < 0.01). (B and C) HSC-LX2 and HSC-T6 cells were treated with erastin (10 μM), sorafenib (10 μM), and RSL3 (2.5 μM) for 24 h. ZFP36 protein and mRNA levels were determined (n = 3 in every group, *, p < 0.05, **, p < 0.01, ***, p < 0.001). (D) HSC-LX2 and HSC-T6 cells were treated with sorafenib (10 μM) with or without MG-132 (10 μM) for 24 h. Cells were harvested for ubiquitination assay (n = 3 in every group). (E) HSC-LX2 cells were treated with erastin (10 μM) with or without cycloheximide (CHX, 20 μg/ml) or MG-132 (10 μM) for 24 h, and ZFP36 protein level was assayed (n = 3 in every group, *, p < 0.05, **, p < 0.01). (F) HSC-LX2 cells were treated with CHX (20 μg/ml) for 24 h or treated with erastin (10 μM) and CHX (20 μg/ml) for 24 h. ZFP36 protein levels were determined at the indicated time points (n = 3 in every group).
Zfp36 Shrna Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ttp/pm31679460-357-0-16?v=Santa+Cruz+Biotechnology
Average 91 stars, based on 1 article reviews
zfp36 shrna plasmid - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

Image Search Results


TTP overexpression represses ERα, PR, GR and AR transactivation in MCF-7 cells. Human breast cancer MCF-7 cells were transiently transfected with empty pCMV-3TAG vector (control) or with 0.25 μg of pCMV-3TAG-TTP (FLAG-TTP) along with the corresponding luciferase reporter vector. The effect of TTP on nuclear hormone receptors transactivation was determined by assay of luciferase activity, as described under “Experimental Procedures.” Assays were performed in triplicate in three independent experiments in the presence (white bars) or absence (black bars) of the corresponding nuclear receptor ligands (17β-estradiol for ERα, progesterone for PR, 5α-Androstan-17β-ol-3-on for AR and dexamethasone for GR. The results are represented as mean ± S.E. Differences in ERα activity between control MCF-7 cells and TTP-expressing MCF-7 cells are statistically significant ( p < 0.05).

Journal: Molecular Genetics and Metabolism Reports

Article Title: Nuclear tristetraprolin acts as a corepressor of multiple steroid nuclear receptors in breast cancer cells

doi: 10.1016/j.ymgmr.2016.02.004

Figure Lengend Snippet: TTP overexpression represses ERα, PR, GR and AR transactivation in MCF-7 cells. Human breast cancer MCF-7 cells were transiently transfected with empty pCMV-3TAG vector (control) or with 0.25 μg of pCMV-3TAG-TTP (FLAG-TTP) along with the corresponding luciferase reporter vector. The effect of TTP on nuclear hormone receptors transactivation was determined by assay of luciferase activity, as described under “Experimental Procedures.” Assays were performed in triplicate in three independent experiments in the presence (white bars) or absence (black bars) of the corresponding nuclear receptor ligands (17β-estradiol for ERα, progesterone for PR, 5α-Androstan-17β-ol-3-on for AR and dexamethasone for GR. The results are represented as mean ± S.E. Differences in ERα activity between control MCF-7 cells and TTP-expressing MCF-7 cells are statistically significant ( p < 0.05).

Article Snippet: Human ERα antibody (Sc D -12, Sc HC-20) and Human TTP antibody (Sc-12565) were purchased from Santa Cruz Biotechnology, Inc. and TTP polyclonal (T5327) antibody was from Sigma-Aldrich.

Techniques: Over Expression, Transfection, Plasmid Preparation, Control, Luciferase, Activity Assay, Expressing

TTP interacts with ERα, PR, GR and AR in vivo . Endogenous ERα (A), PR (B), AR (C) and GR (C) were immunoprecipitated from protein extracts prepared from MCF-7 cells using specific antibodies. Immunoprecipitated proteins were resolved by PAGE, and the binding of TTP was visualized by Western blot. The input lane represents 10% of the protein extract used in the coimmunoprecipitation assays. IP: immunoprecipitation, WB: Western blot.

Journal: Molecular Genetics and Metabolism Reports

Article Title: Nuclear tristetraprolin acts as a corepressor of multiple steroid nuclear receptors in breast cancer cells

doi: 10.1016/j.ymgmr.2016.02.004

Figure Lengend Snippet: TTP interacts with ERα, PR, GR and AR in vivo . Endogenous ERα (A), PR (B), AR (C) and GR (C) were immunoprecipitated from protein extracts prepared from MCF-7 cells using specific antibodies. Immunoprecipitated proteins were resolved by PAGE, and the binding of TTP was visualized by Western blot. The input lane represents 10% of the protein extract used in the coimmunoprecipitation assays. IP: immunoprecipitation, WB: Western blot.

Article Snippet: Human ERα antibody (Sc D -12, Sc HC-20) and Human TTP antibody (Sc-12565) were purchased from Santa Cruz Biotechnology, Inc. and TTP polyclonal (T5327) antibody was from Sigma-Aldrich.

Techniques: In Vivo, Immunoprecipitation, Binding Assay, Western Blot

siRNA-mediated knockdown of TTP protein levels in MCF-7 cells. MCF-7 cells were transfected with specific siRNA-TTP (1.25 μg) or with an unrelated control siRNA (2.5 μg). (A) Protein extracts from MCF-7 cultures were resolved by PAGE, and expression levels of TTP, ERα, PR, GR, AR and tubulin, as a loading control protein, were evaluated by Western blot using specific antibodies as described under “Experimental Procedures.” TTP knockdown increases ERα, PR, GR and AR transactivation. MCF-7 cells were transfected with an unrelated siRNA (control) or a specific TTP-siRNA (1.5 μg), along with TK-LUC, in the presence of the corresponding nuclear receptor ligands. The effect of TTP-siRNA on ERα (B), PR (C), GR (D) and AR (E) transactivation was determined by a luciferase assay and compared with luciferase activity in MCF-7 cells transfected with empty pCMV-3TAG vector and the corresponding Tk-LUC reporter vector. Results, in triplicate in three independent experiments, are represented as mean ± S.E. (error bars). Differences in ERα activity in MCF-7 cells transfected with TTP or with TTP-siRNA were shown to be statistically significant ( p < 0.05).

Journal: Molecular Genetics and Metabolism Reports

Article Title: Nuclear tristetraprolin acts as a corepressor of multiple steroid nuclear receptors in breast cancer cells

doi: 10.1016/j.ymgmr.2016.02.004

Figure Lengend Snippet: siRNA-mediated knockdown of TTP protein levels in MCF-7 cells. MCF-7 cells were transfected with specific siRNA-TTP (1.25 μg) or with an unrelated control siRNA (2.5 μg). (A) Protein extracts from MCF-7 cultures were resolved by PAGE, and expression levels of TTP, ERα, PR, GR, AR and tubulin, as a loading control protein, were evaluated by Western blot using specific antibodies as described under “Experimental Procedures.” TTP knockdown increases ERα, PR, GR and AR transactivation. MCF-7 cells were transfected with an unrelated siRNA (control) or a specific TTP-siRNA (1.5 μg), along with TK-LUC, in the presence of the corresponding nuclear receptor ligands. The effect of TTP-siRNA on ERα (B), PR (C), GR (D) and AR (E) transactivation was determined by a luciferase assay and compared with luciferase activity in MCF-7 cells transfected with empty pCMV-3TAG vector and the corresponding Tk-LUC reporter vector. Results, in triplicate in three independent experiments, are represented as mean ± S.E. (error bars). Differences in ERα activity in MCF-7 cells transfected with TTP or with TTP-siRNA were shown to be statistically significant ( p < 0.05).

Article Snippet: Human ERα antibody (Sc D -12, Sc HC-20) and Human TTP antibody (Sc-12565) were purchased from Santa Cruz Biotechnology, Inc. and TTP polyclonal (T5327) antibody was from Sigma-Aldrich.

Techniques: Knockdown, Transfection, Control, Expressing, Western Blot, Luciferase, Activity Assay, Plasmid Preparation

The highly expressed TTP was identified as a crucial factor in response to the IgE-mediated inflammatory syndrome. A , the robust rank aggregation (RRA) algorithm integrated upregulated genes (Log 2 Foldchange>1 and p < 0.05) from three datasets of three IgE-mediated inflammatory syndromes (allergic rhinitis, asthma, and atopic dermatitis) and their corresponding normal samples. B , the ranking graph displayed the genes that were upregulated in at least two datasets. Among them, the genes corresponding to the red dots (Frequency = 3) showed a significant increase in all three disease datasets, including TTP. C , intersection of the genes encoding CCCH-ZF (zinc finger)-type proteins with the genes upregulated in the nasal mucosa of patients with allergic rhinitis. D , the assessment of evolutionary conservation of amino acid positions, especially two CCCH-ZF repeat regions, in the mouse TTP protein. Conservation scores ranged from 1 to 9, where one was the most highly variable, five was of intermediate conservation, and nine was the most highly conserved position. E , experimental scheme of ragweed pollen (RW)-induced AR model, divided into the sensitization stage (0 and 7 days) and the stimulation stage (14–17 days). The control mice were treated with PBS instead of RW (N = 6 per group). F , relative RNA expressions of TTP in nasal tissues of RW-induced AR mice and control mice. G , compare the frequencies of sneezing and nose-rubbing within 10 min between control mice and AR mice after 14 days. H , immunofluorescence staining of TTP protein ( red ) and CD4 protein ( green ) was performed in normal and RW nasal tissues. DAPI ( blue ) was used for nuclear staining (Scale bar = 50 μm). I , quantitative analyses of CD4 + T cell percentages and TTP fluorescence intensity in nasal mucosal tissues from sham and AR model mice. Data are shown as means ± SD (N = 6), Student's t test was used for statistical analysis of control mice and AR mice.

Journal: The Journal of Biological Chemistry

Article Title: RNA-binding protein tristetraprolin inhibits Th2 cell activation and differentiation in allergic rhinitis by promoting TRIM18 mRNA decay

doi: 10.1016/j.jbc.2026.111240

Figure Lengend Snippet: The highly expressed TTP was identified as a crucial factor in response to the IgE-mediated inflammatory syndrome. A , the robust rank aggregation (RRA) algorithm integrated upregulated genes (Log 2 Foldchange>1 and p < 0.05) from three datasets of three IgE-mediated inflammatory syndromes (allergic rhinitis, asthma, and atopic dermatitis) and their corresponding normal samples. B , the ranking graph displayed the genes that were upregulated in at least two datasets. Among them, the genes corresponding to the red dots (Frequency = 3) showed a significant increase in all three disease datasets, including TTP. C , intersection of the genes encoding CCCH-ZF (zinc finger)-type proteins with the genes upregulated in the nasal mucosa of patients with allergic rhinitis. D , the assessment of evolutionary conservation of amino acid positions, especially two CCCH-ZF repeat regions, in the mouse TTP protein. Conservation scores ranged from 1 to 9, where one was the most highly variable, five was of intermediate conservation, and nine was the most highly conserved position. E , experimental scheme of ragweed pollen (RW)-induced AR model, divided into the sensitization stage (0 and 7 days) and the stimulation stage (14–17 days). The control mice were treated with PBS instead of RW (N = 6 per group). F , relative RNA expressions of TTP in nasal tissues of RW-induced AR mice and control mice. G , compare the frequencies of sneezing and nose-rubbing within 10 min between control mice and AR mice after 14 days. H , immunofluorescence staining of TTP protein ( red ) and CD4 protein ( green ) was performed in normal and RW nasal tissues. DAPI ( blue ) was used for nuclear staining (Scale bar = 50 μm). I , quantitative analyses of CD4 + T cell percentages and TTP fluorescence intensity in nasal mucosal tissues from sham and AR model mice. Data are shown as means ± SD (N = 6), Student's t test was used for statistical analysis of control mice and AR mice.

Article Snippet: Then, the sections were co-incubated with antibodies against TTP (1:100 dilution, Proteintech, Cat No.66938-1-Ig) and CD4 (1:50 dilution, Abclonal, Cat No.A0363) overnight at 4 °C.

Techniques: Control, Immunofluorescence, Staining, Fluorescence

TTP suppressed T helper 2 (Th2)-type inflammation in AR mice. A , schematics of splenocytes isolation from AR-mice and the differentiation of splenic naive CD4+ T cells model in vitro . B , the levels of Interleukin (IL)-4, IL-5, and IL-13, which belong to the Th2 cytokine family, were measured by ELISA assays in the cell supernatant. The cell supernatant was collected from mononuclear cells of the spleen that had been treated with ionomycin and phorbol 12-myristate 13-acetate (PMA) for 6 h. C , after treatment with ionomycin, PMA, and GolgiPlug, the cells with the double stain of anti-CD4 and anti-IL-4-APC were detected by flow cytometry to analyze the percentage of Th2 cells. Data are shown as means ± SD (N = 3 or 6). One-way analysis of variance (ANOVA) was used for statistical analysis of control mice, AR mice, and AR mice transduced with control vectors or TTP overexpression vectors.

Journal: The Journal of Biological Chemistry

Article Title: RNA-binding protein tristetraprolin inhibits Th2 cell activation and differentiation in allergic rhinitis by promoting TRIM18 mRNA decay

doi: 10.1016/j.jbc.2026.111240

Figure Lengend Snippet: TTP suppressed T helper 2 (Th2)-type inflammation in AR mice. A , schematics of splenocytes isolation from AR-mice and the differentiation of splenic naive CD4+ T cells model in vitro . B , the levels of Interleukin (IL)-4, IL-5, and IL-13, which belong to the Th2 cytokine family, were measured by ELISA assays in the cell supernatant. The cell supernatant was collected from mononuclear cells of the spleen that had been treated with ionomycin and phorbol 12-myristate 13-acetate (PMA) for 6 h. C , after treatment with ionomycin, PMA, and GolgiPlug, the cells with the double stain of anti-CD4 and anti-IL-4-APC were detected by flow cytometry to analyze the percentage of Th2 cells. Data are shown as means ± SD (N = 3 or 6). One-way analysis of variance (ANOVA) was used for statistical analysis of control mice, AR mice, and AR mice transduced with control vectors or TTP overexpression vectors.

Article Snippet: Then, the sections were co-incubated with antibodies against TTP (1:100 dilution, Proteintech, Cat No.66938-1-Ig) and CD4 (1:50 dilution, Abclonal, Cat No.A0363) overnight at 4 °C.

Techniques: Isolation, In Vitro, Enzyme-linked Immunosorbent Assay, Staining, Flow Cytometry, Control, Transduction, Over Expression

TTP overexpression inhibited Th2 differentiation in vitro . A , schematics of naive CD4+ isolation, activation, and Th2 differentiation. B , a representative flow cytometric plot and the percentage of Th2 cells was detected using flow cytometry. C , the protein and mRNA expression of TTP in CD4+ T cells. D , the protein and mRNA expression of TTP in Th2 cells after virus infection. E , the levels of IL-5 were detected using real-time PCR and ELISA, respectively, in Th2 cells after virus infection. F , the percentage of Th2 cells was detected using flow cytometry in Th2 cells after virus infection. Data are shown as means ± SD (N = 3). Student's t test and one-way ANOVA were used for statistical analysis.

Journal: The Journal of Biological Chemistry

Article Title: RNA-binding protein tristetraprolin inhibits Th2 cell activation and differentiation in allergic rhinitis by promoting TRIM18 mRNA decay

doi: 10.1016/j.jbc.2026.111240

Figure Lengend Snippet: TTP overexpression inhibited Th2 differentiation in vitro . A , schematics of naive CD4+ isolation, activation, and Th2 differentiation. B , a representative flow cytometric plot and the percentage of Th2 cells was detected using flow cytometry. C , the protein and mRNA expression of TTP in CD4+ T cells. D , the protein and mRNA expression of TTP in Th2 cells after virus infection. E , the levels of IL-5 were detected using real-time PCR and ELISA, respectively, in Th2 cells after virus infection. F , the percentage of Th2 cells was detected using flow cytometry in Th2 cells after virus infection. Data are shown as means ± SD (N = 3). Student's t test and one-way ANOVA were used for statistical analysis.

Article Snippet: Then, the sections were co-incubated with antibodies against TTP (1:100 dilution, Proteintech, Cat No.66938-1-Ig) and CD4 (1:50 dilution, Abclonal, Cat No.A0363) overnight at 4 °C.

Techniques: Over Expression, In Vitro, Isolation, Activation Assay, Flow Cytometry, Expressing, Virus, Infection, Real-time Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay

TTP knockdown exacerbated allergic phenotypes and promoted Th2-type inflammation in AR mice. A , experimental scheme of RW-induced AR mice with or without TTP knockdown via intravenous injection of lentiviral vectors (Lv-shNC or Lv-shTTP). B , expression of TTP mRNA in AR mice with or without TTP knockdown. C , immunofluorescence staining for TTP protein ( red ) and CD4 protein ( green ) in normal and RW-exposed nasal tissues. DAPI ( blue ) was used for nuclear staining (Scale bar = 50 μm). D , quantitative analysis of TTP fluorescence intensity in nasal mucosal tissues from lentivirus-injected mice. E , hematoxylin-eosin (H&E)-stained nasal mucosal tissue sections, showing nasal mucosa thickness (Scale bar = 100 μm). Dashed lines indicate the boundary between the epithelial layer and lamina propria. F and G , changes in the number of sneezes and nasal rubbings after TTP knockdown in AR mice. H , schematic of splenocyte isolation from AR mice and in vitro treatment. I – K , Levels of IL-4, IL-5, and IL-13 in the cell culture supernatant of splenocytes treated with ionomycin and PMA for 6 h. Data are presented as means ± SD (N = 3 or 6). Student's t test was used for statistical analysis of AR mice transduced with shNC or shTTP.

Journal: The Journal of Biological Chemistry

Article Title: RNA-binding protein tristetraprolin inhibits Th2 cell activation and differentiation in allergic rhinitis by promoting TRIM18 mRNA decay

doi: 10.1016/j.jbc.2026.111240

Figure Lengend Snippet: TTP knockdown exacerbated allergic phenotypes and promoted Th2-type inflammation in AR mice. A , experimental scheme of RW-induced AR mice with or without TTP knockdown via intravenous injection of lentiviral vectors (Lv-shNC or Lv-shTTP). B , expression of TTP mRNA in AR mice with or without TTP knockdown. C , immunofluorescence staining for TTP protein ( red ) and CD4 protein ( green ) in normal and RW-exposed nasal tissues. DAPI ( blue ) was used for nuclear staining (Scale bar = 50 μm). D , quantitative analysis of TTP fluorescence intensity in nasal mucosal tissues from lentivirus-injected mice. E , hematoxylin-eosin (H&E)-stained nasal mucosal tissue sections, showing nasal mucosa thickness (Scale bar = 100 μm). Dashed lines indicate the boundary between the epithelial layer and lamina propria. F and G , changes in the number of sneezes and nasal rubbings after TTP knockdown in AR mice. H , schematic of splenocyte isolation from AR mice and in vitro treatment. I – K , Levels of IL-4, IL-5, and IL-13 in the cell culture supernatant of splenocytes treated with ionomycin and PMA for 6 h. Data are presented as means ± SD (N = 3 or 6). Student's t test was used for statistical analysis of AR mice transduced with shNC or shTTP.

Article Snippet: Then, the sections were co-incubated with antibodies against TTP (1:100 dilution, Proteintech, Cat No.66938-1-Ig) and CD4 (1:50 dilution, Abclonal, Cat No.A0363) overnight at 4 °C.

Techniques: Knockdown, Injection, Expressing, Immunofluorescence, Staining, Fluorescence, Isolation, In Vitro, Cell Culture, Transduction

Transcriptional profiles of CD4+ T cell isolated from AR mouse spleen reveal categories of genes associated with TTP. A , RNA transcriptome microarray analysis of CD4+ T cell isolated from mouse. B , a volcano plot of all DEGs between CD4+ T cells isolated from LV-TTP and LV-Vector infected AR mouse. C , GSEA analysis identified significant enrichment of signaling pathways based on KEGG and GO analysis following TTP overexpression. D , KEGG pathway enrichment and GO functional classification analysis of DEGs. Data are shown as means ± SD (N = 3).

Journal: The Journal of Biological Chemistry

Article Title: RNA-binding protein tristetraprolin inhibits Th2 cell activation and differentiation in allergic rhinitis by promoting TRIM18 mRNA decay

doi: 10.1016/j.jbc.2026.111240

Figure Lengend Snippet: Transcriptional profiles of CD4+ T cell isolated from AR mouse spleen reveal categories of genes associated with TTP. A , RNA transcriptome microarray analysis of CD4+ T cell isolated from mouse. B , a volcano plot of all DEGs between CD4+ T cells isolated from LV-TTP and LV-Vector infected AR mouse. C , GSEA analysis identified significant enrichment of signaling pathways based on KEGG and GO analysis following TTP overexpression. D , KEGG pathway enrichment and GO functional classification analysis of DEGs. Data are shown as means ± SD (N = 3).

Article Snippet: Then, the sections were co-incubated with antibodies against TTP (1:100 dilution, Proteintech, Cat No.66938-1-Ig) and CD4 (1:50 dilution, Abclonal, Cat No.A0363) overnight at 4 °C.

Techniques: Isolation, Microarray, Plasmid Preparation, Infection, Protein-Protein interactions, Over Expression, Functional Assay

The TTP protein acted as a negative regulator of TRIM18-mediated Th2-type inflammation by reducing TRIM18 mRNA stability. A , protein–protein interaction network of 16 potential substrates of E3 ubiquitin ligase TRIM18, constructed using the STRING database and supplemented with functional annotations via GO (Gene Ontology) pathway enrichment analyses, highlighting key biological processes and signaling pathways associated with these substrates. B and C , the qRT-PCR and ELISA were performed to detect the mRNA level and secreted protein concentration of IL-5, respectively, in naive CD4+ T cells or in vitro differentiated Th2 cells transfected with TRIM18 overexpression vector or empty vector. D , schematic diagram of the experimental workflow: Naive CD4+ T cells were induced to differentiate into Th2 cells under in vitro and were co-transfected with combinations of TTP overexpression vector, TRIM18 overexpression vector, or corresponding empty vectors. E , the mRNA level of TRIM18 in differentiated Th2 cells from the three groups (Control, TTP-OE, TTP+TRIM18-OE) was detected by qRT-PCR assays. F and G , The mRNA level and secreted protein concentration of IL-5 were measured by qRT-PCR and ELISA, respectively, in differentiated Th2 cells from the three groups (Control, TTP-OE, TTP+TRIM18-OE). H , flow cytometric analysis of the percentage of CD4+IL-4+ Th2 cells among the three groups after in vitro differentiation, and the proportion of double-positive cells was quantified to assess the impact of TTP and/or TRIM18 overexpression on Th2 cell differentiation. Data are shown as means ± SD (N = 3), One-way ANOVA was used for statistical analysis.

Journal: The Journal of Biological Chemistry

Article Title: RNA-binding protein tristetraprolin inhibits Th2 cell activation and differentiation in allergic rhinitis by promoting TRIM18 mRNA decay

doi: 10.1016/j.jbc.2026.111240

Figure Lengend Snippet: The TTP protein acted as a negative regulator of TRIM18-mediated Th2-type inflammation by reducing TRIM18 mRNA stability. A , protein–protein interaction network of 16 potential substrates of E3 ubiquitin ligase TRIM18, constructed using the STRING database and supplemented with functional annotations via GO (Gene Ontology) pathway enrichment analyses, highlighting key biological processes and signaling pathways associated with these substrates. B and C , the qRT-PCR and ELISA were performed to detect the mRNA level and secreted protein concentration of IL-5, respectively, in naive CD4+ T cells or in vitro differentiated Th2 cells transfected with TRIM18 overexpression vector or empty vector. D , schematic diagram of the experimental workflow: Naive CD4+ T cells were induced to differentiate into Th2 cells under in vitro and were co-transfected with combinations of TTP overexpression vector, TRIM18 overexpression vector, or corresponding empty vectors. E , the mRNA level of TRIM18 in differentiated Th2 cells from the three groups (Control, TTP-OE, TTP+TRIM18-OE) was detected by qRT-PCR assays. F and G , The mRNA level and secreted protein concentration of IL-5 were measured by qRT-PCR and ELISA, respectively, in differentiated Th2 cells from the three groups (Control, TTP-OE, TTP+TRIM18-OE). H , flow cytometric analysis of the percentage of CD4+IL-4+ Th2 cells among the three groups after in vitro differentiation, and the proportion of double-positive cells was quantified to assess the impact of TTP and/or TRIM18 overexpression on Th2 cell differentiation. Data are shown as means ± SD (N = 3), One-way ANOVA was used for statistical analysis.

Article Snippet: Then, the sections were co-incubated with antibodies against TTP (1:100 dilution, Proteintech, Cat No.66938-1-Ig) and CD4 (1:50 dilution, Abclonal, Cat No.A0363) overnight at 4 °C.

Techniques: Ubiquitin Proteomics, Construct, Functional Assay, Protein-Protein interactions, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Protein Concentration, In Vitro, Transfection, Over Expression, Plasmid Preparation, Control, Cell Differentiation

Figure 1. Dose-dependent induction of TTP in MDA-MB-231 cells by three compounds selected from the fourth screening of the natural compound library. (A) Dose-dependent changes in luciferase activity. MDA-MB-231 cells were transfected with pGL3/TTPp-1343 luciferase reporter vector containing the human TTP promoter, followed by stimulation with different concentrations of three selected compounds solubilized in DMSO for 48 h. The same volume of DMSO was added to the cells as controls. For each compound, the fold change in luciferase activity of stimulated cells was calculated relative to that of the DMSO control. The graphs are mean ± SD of three independent experiments (Two-way ANOVA). Black bars, control; red bars, 01-E10; green bars, 01-G05; violet bars, 05-A06. (B–D) Dose-dependent changes in endogenous TTP level. MDA-MB-231 cells were stimulated with different concentrations of compounds (B) 01-E10, (C) 01-G05, and (D) 05-A06 for 48 h. The expression level of TTP mRNA was analyzed by qRT-PCR. For each compound, the fold change in expression level was calculated relative to that of the DMSO control. The graphs are mean ± SD of three independent experiments (one-way ANOVA, * p < 0.01). (E) Structure of compound 05-A06, an enantiomer of BTM-21-P and DXM-21-P.

Journal: International journal of molecular sciences

Article Title: FOXO1 Is a Key Mediator of Glucocorticoid-Induced Expression of Tristetraprolin in MDA-MB-231 Breast Cancer Cells.

doi: 10.3390/ijms232213673

Figure Lengend Snippet: Figure 1. Dose-dependent induction of TTP in MDA-MB-231 cells by three compounds selected from the fourth screening of the natural compound library. (A) Dose-dependent changes in luciferase activity. MDA-MB-231 cells were transfected with pGL3/TTPp-1343 luciferase reporter vector containing the human TTP promoter, followed by stimulation with different concentrations of three selected compounds solubilized in DMSO for 48 h. The same volume of DMSO was added to the cells as controls. For each compound, the fold change in luciferase activity of stimulated cells was calculated relative to that of the DMSO control. The graphs are mean ± SD of three independent experiments (Two-way ANOVA). Black bars, control; red bars, 01-E10; green bars, 01-G05; violet bars, 05-A06. (B–D) Dose-dependent changes in endogenous TTP level. MDA-MB-231 cells were stimulated with different concentrations of compounds (B) 01-E10, (C) 01-G05, and (D) 05-A06 for 48 h. The expression level of TTP mRNA was analyzed by qRT-PCR. For each compound, the fold change in expression level was calculated relative to that of the DMSO control. The graphs are mean ± SD of three independent experiments (one-way ANOVA, * p < 0.01). (E) Structure of compound 05-A06, an enantiomer of BTM-21-P and DXM-21-P.

Article Snippet: Small interfering RNAs (siRNAs) against human TTP (TTP-siRNA, sc-36761) and control siRNA [scrambled siRNA (scRNA), sc-37007] were purchased from Santa Cruz Biotechnology (Santa Cruz, Santa Cruz, CA, USA).

Techniques: Drug discovery, Luciferase, Activity Assay, Transfection, Plasmid Preparation, Control, Expressing, Quantitative RT-PCR

Figure 6. DXM-induced TTP mediates the anti-viability function of DXM in MDA-MB-231 cells. (A–C) DXM treatment decreases expression of ARE-containing genes in MDA-MB-231 cells. MDA- MB-231 cells were stimulated with 500 nM DXM, and the expression of ARE-containing genes such as (A) Myc, (B) VEGF, and (C) COX2 was analyzed by qRT-PCR. Fold change in expression level was calculated relative to that of the DMSO control. The graphs are mean ± SD of three independent experiments (Student’s t test, * p < 0.05). (D) TTP mediates the anti-viability function of DXM in MDA-MB-231 cells. MDA-MB-231 cells were transfected with TTP-specific siRNA (siTTP) or control scrambled siRNA (scRNA) and stimulated with 500 nM DXM. Viability of MDA-MB-231 cells was assessed using MTS assays. Graphs show relative cell viability. Data are mean ± SD of three independent experiments (one-way ANOVA, ** p < 0.01).

Journal: International journal of molecular sciences

Article Title: FOXO1 Is a Key Mediator of Glucocorticoid-Induced Expression of Tristetraprolin in MDA-MB-231 Breast Cancer Cells.

doi: 10.3390/ijms232213673

Figure Lengend Snippet: Figure 6. DXM-induced TTP mediates the anti-viability function of DXM in MDA-MB-231 cells. (A–C) DXM treatment decreases expression of ARE-containing genes in MDA-MB-231 cells. MDA- MB-231 cells were stimulated with 500 nM DXM, and the expression of ARE-containing genes such as (A) Myc, (B) VEGF, and (C) COX2 was analyzed by qRT-PCR. Fold change in expression level was calculated relative to that of the DMSO control. The graphs are mean ± SD of three independent experiments (Student’s t test, * p < 0.05). (D) TTP mediates the anti-viability function of DXM in MDA-MB-231 cells. MDA-MB-231 cells were transfected with TTP-specific siRNA (siTTP) or control scrambled siRNA (scRNA) and stimulated with 500 nM DXM. Viability of MDA-MB-231 cells was assessed using MTS assays. Graphs show relative cell viability. Data are mean ± SD of three independent experiments (one-way ANOVA, ** p < 0.01).

Article Snippet: Small interfering RNAs (siRNAs) against human TTP (TTP-siRNA, sc-36761) and control siRNA [scrambled siRNA (scRNA), sc-37007] were purchased from Santa Cruz Biotechnology (Santa Cruz, Santa Cruz, CA, USA).

Techniques: Expressing, Quantitative RT-PCR, Control, Transfection

(A) Forest plots depicting RNA and IHC-based for ZFP36 /TTP expression related to clinical outcomes (biochemical recurrence and disease-free survival) and risk of lethal prostate cancer (case-control cohorts). (B) (left) Upregulated and downregulated genes were identified by differential expression analysis of TCGA PRAD cases divided by lower quartile expression of ZFP36 ; (right). (C) Representative images of IF staining in human PCa used for expression analysis. Benign glands (arrowheads) stain for pan-cytokeratin (yellow) and basal (red) cocktails; tumor cells (arrows) demonstrate absent basal expression (panels ii & iv). Corresponding sections (i & iii) demonstrate intact epithelial staining for TTP (green). Panels v-vi: Diffuse prostate tumor with absent TTP expression. (D) Kaplan Meier survival analysis demonstrating that TTP deficiency, measured by protein expression (DFCI ( , )) and ZFP36 mRNA expression (TCGA PRAD ; Taylor et al ), results in shorter disease-free-survival, and even shorter disease-free-survival in combination with PTEN deficiency.

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) Forest plots depicting RNA and IHC-based for ZFP36 /TTP expression related to clinical outcomes (biochemical recurrence and disease-free survival) and risk of lethal prostate cancer (case-control cohorts). (B) (left) Upregulated and downregulated genes were identified by differential expression analysis of TCGA PRAD cases divided by lower quartile expression of ZFP36 ; (right). (C) Representative images of IF staining in human PCa used for expression analysis. Benign glands (arrowheads) stain for pan-cytokeratin (yellow) and basal (red) cocktails; tumor cells (arrows) demonstrate absent basal expression (panels ii & iv). Corresponding sections (i & iii) demonstrate intact epithelial staining for TTP (green). Panels v-vi: Diffuse prostate tumor with absent TTP expression. (D) Kaplan Meier survival analysis demonstrating that TTP deficiency, measured by protein expression (DFCI ( , )) and ZFP36 mRNA expression (TCGA PRAD ; Taylor et al ), results in shorter disease-free-survival, and even shorter disease-free-survival in combination with PTEN deficiency.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Expressing, Control, Quantitative Proteomics, Staining

(A) hematoxylin and eosin staining of murine tumors highlighting morphological progression of wild-type (WT), Pten f/f / Zfp36 +/+ ( Pten -/-), Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 +/-) and Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 -/-) dorsolateral prostate tissue at 8 18, and 38 weeks. Scale bar 100 μm. (B) Comparative weight of dorsolateral and ventral prostate tissue in GEMMs at 18 and 38 weeks. (C) Kaplan Meier graphs from GEMM aging studies show that prostate-specific deletion of Zfp36 significantly reduces time-to-ethical endpoint in PCa driven by loss of Pten. *p<0.05, **p<0.005.

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) hematoxylin and eosin staining of murine tumors highlighting morphological progression of wild-type (WT), Pten f/f / Zfp36 +/+ ( Pten -/-), Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 +/-) and Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 -/-) dorsolateral prostate tissue at 8 18, and 38 weeks. Scale bar 100 μm. (B) Comparative weight of dorsolateral and ventral prostate tissue in GEMMs at 18 and 38 weeks. (C) Kaplan Meier graphs from GEMM aging studies show that prostate-specific deletion of Zfp36 significantly reduces time-to-ethical endpoint in PCa driven by loss of Pten. *p<0.05, **p<0.005.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Staining

(A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting positively and negatively enriched Hallmark pathways. (B) Phos-p65 IF and Masson’s Trichrome staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005.

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting positively and negatively enriched Hallmark pathways. (B) Phos-p65 IF and Masson’s Trichrome staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: RNA Sequencing, Staining

(A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting significant positively and negatively enriched GOBP pathways. (B) Ki-67 IHC, and Krt18 and αSMA IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Increased tumor cell proliferation and basement membrane breakdown is observed with loss of Zfp36 . (C) Number of mice that displayed PCa cells in distant organs by recombination PCR in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMMs. (D) Representative androgen receptor (AR) IF staining in pelvic lymph nodes of Pten -/- and Pten -/- Zfp36 -/- GEMMs highlighting local dissemination of prostate cells. Scale bar 100 μm. AR staining was over exposed during imaging to assist with prostate cell identification. (E) Representative images and quantification of budding in GEMM-derived organoids highlighting increased invasive and metastatic potential of Pten -/- Zfp36 -/-organoids. (F) Scratch assay in GEMM-derived 2D cells, comparing Pten -/- and Pten -/- Zfp36 -/- wound healing with that of Pten -/- Rb1 -/-, a previously described metastatic, neuroendocrine PCa murine cell line . *p<0.05, **p<0.005, ***p<0.001, ****p<0.0001.

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting significant positively and negatively enriched GOBP pathways. (B) Ki-67 IHC, and Krt18 and αSMA IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Increased tumor cell proliferation and basement membrane breakdown is observed with loss of Zfp36 . (C) Number of mice that displayed PCa cells in distant organs by recombination PCR in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMMs. (D) Representative androgen receptor (AR) IF staining in pelvic lymph nodes of Pten -/- and Pten -/- Zfp36 -/- GEMMs highlighting local dissemination of prostate cells. Scale bar 100 μm. AR staining was over exposed during imaging to assist with prostate cell identification. (E) Representative images and quantification of budding in GEMM-derived organoids highlighting increased invasive and metastatic potential of Pten -/- Zfp36 -/-organoids. (F) Scratch assay in GEMM-derived 2D cells, comparing Pten -/- and Pten -/- Zfp36 -/- wound healing with that of Pten -/- Rb1 -/-, a previously described metastatic, neuroendocrine PCa murine cell line . *p<0.05, **p<0.005, ***p<0.001, ****p<0.0001.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: RNA Sequencing, Staining, Membrane, Imaging, Derivative Assay, Wound Healing Assay

(A) AR, synaptophysin (Syp) and CD45 IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005. (B) Dual Krt8 and CD45 IF staining in Pten -/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks. Scale bar 50 μm.

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) AR, synaptophysin (Syp) and CD45 IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005. (B) Dual Krt8 and CD45 IF staining in Pten -/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks. Scale bar 50 μm.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Staining

(A) Kaplan Meier graph from GEMM aging studies where mice were surgically castrated at 38 weeks comparing Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- mice, and whole prostate weights and representative images from mice 12 weeks post-castration. (B) Quantification of GEMM-derived Pten -/- and Pten -/- Zfp36 -/- organoid growth in the presence and absence of enzalutamide (10 μM). (C) Allograft tumor growth in mice treated with DMAPT (100 mg/kg/day) or water vehicle ± surgical castration, n=5 mice per treatment group. (D) End-point tumor volumes from allograft therapy studies. (E) Representative images and (F) quantification of cell death (green) in GEMM-derived PCa organoids treated with DMAPT (5 μM), enzalutamide (10 μM) or the combination of both for 72 hours, n=10 organoids per treatment group. (G) Representative images and flow cytometry quantification for CD45, synaptophysin, and AR expression in GEMM-derived PCa organoids treated with DMAPT (5 μM) or DMSO vehicle for 72 hours. (H) Fold-change in expression of the AR response gene – Fkbp5 in GEMM-derived 2D cell lines treated with DMAPT (5 μM) or DMSO vehicle for 72 hours, R1881 (10nM was used to stimulate AR activity. *p<0.05, **p<0.005, ***p<0.001. (I) Schematic overview: i) when ZFP36 is intact epithelial cells present with a luminal lineage phenotype and sensitivity to AR inhibition. ii) loss of ZFP36 results in an alternative epithelial cell lineage phenotype with reduced AR expression, increased SYP and CD45 expression, and increased NF-κB activation and inflammation, leading to lack of response to AR inhibition. iii) DMAPT treatment inhibits NF-κB and inflammation signaling and restores a more luminal epithelial cell type and responsiveness to AR inhibition.

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) Kaplan Meier graph from GEMM aging studies where mice were surgically castrated at 38 weeks comparing Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- mice, and whole prostate weights and representative images from mice 12 weeks post-castration. (B) Quantification of GEMM-derived Pten -/- and Pten -/- Zfp36 -/- organoid growth in the presence and absence of enzalutamide (10 μM). (C) Allograft tumor growth in mice treated with DMAPT (100 mg/kg/day) or water vehicle ± surgical castration, n=5 mice per treatment group. (D) End-point tumor volumes from allograft therapy studies. (E) Representative images and (F) quantification of cell death (green) in GEMM-derived PCa organoids treated with DMAPT (5 μM), enzalutamide (10 μM) or the combination of both for 72 hours, n=10 organoids per treatment group. (G) Representative images and flow cytometry quantification for CD45, synaptophysin, and AR expression in GEMM-derived PCa organoids treated with DMAPT (5 μM) or DMSO vehicle for 72 hours. (H) Fold-change in expression of the AR response gene – Fkbp5 in GEMM-derived 2D cell lines treated with DMAPT (5 μM) or DMSO vehicle for 72 hours, R1881 (10nM was used to stimulate AR activity. *p<0.05, **p<0.005, ***p<0.001. (I) Schematic overview: i) when ZFP36 is intact epithelial cells present with a luminal lineage phenotype and sensitivity to AR inhibition. ii) loss of ZFP36 results in an alternative epithelial cell lineage phenotype with reduced AR expression, increased SYP and CD45 expression, and increased NF-κB activation and inflammation, leading to lack of response to AR inhibition. iii) DMAPT treatment inhibits NF-κB and inflammation signaling and restores a more luminal epithelial cell type and responsiveness to AR inhibition.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Derivative Assay, Flow Cytometry, Expressing, Activity Assay, Inhibition, Activation Assay

Figure 1. RNA-binding protein ZFP36 expression is decreased during HSC ferroptosis. HSC-LX2 and HSC-T6 cells were treated with erastin (10 μM), sorafenib (10 μM), and RSL3 (2.5 μM), with or without the indicated inhibitors (liproxstatin-1, 100 nM; ZVAD-FMK, 10 μM; necrostatin-1, 10 μM) for 24 h. (A) Cell viability, MDA, and iron levels were assayed (n = 3 in every group, **, p < 0.01). (B and C) HSC-LX2 and HSC-T6 cells were treated with erastin (10 μM), sorafenib (10 μM), and RSL3 (2.5 μM) for 24 h. ZFP36 protein and mRNA levels were determined (n = 3 in every group, *, p < 0.05, **, p < 0.01, ***, p < 0.001). (D) HSC-LX2 and HSC-T6 cells were treated with sorafenib (10 μM) with or without MG-132 (10 μM) for 24 h. Cells were harvested for ubiquitination assay (n = 3 in every group). (E) HSC-LX2 cells were treated with erastin (10 μM) with or without cycloheximide (CHX, 20 μg/ml) or MG-132 (10 μM) for 24 h, and ZFP36 protein level was assayed (n = 3 in every group, *, p < 0.05, **, p < 0.01). (F) HSC-LX2 cells were treated with CHX (20 μg/ml) for 24 h or treated with erastin (10 μM) and CHX (20 μg/ml) for 24 h. ZFP36 protein levels were determined at the indicated time points (n = 3 in every group).

Journal: Autophagy

Article Title: RNA-binding protein ZFP36/TTP protects against ferroptosis by regulating autophagy signaling pathway in hepatic stellate cells.

doi: 10.1080/15548627.2019.1687985

Figure Lengend Snippet: Figure 1. RNA-binding protein ZFP36 expression is decreased during HSC ferroptosis. HSC-LX2 and HSC-T6 cells were treated with erastin (10 μM), sorafenib (10 μM), and RSL3 (2.5 μM), with or without the indicated inhibitors (liproxstatin-1, 100 nM; ZVAD-FMK, 10 μM; necrostatin-1, 10 μM) for 24 h. (A) Cell viability, MDA, and iron levels were assayed (n = 3 in every group, **, p < 0.01). (B and C) HSC-LX2 and HSC-T6 cells were treated with erastin (10 μM), sorafenib (10 μM), and RSL3 (2.5 μM) for 24 h. ZFP36 protein and mRNA levels were determined (n = 3 in every group, *, p < 0.05, **, p < 0.01, ***, p < 0.001). (D) HSC-LX2 and HSC-T6 cells were treated with sorafenib (10 μM) with or without MG-132 (10 μM) for 24 h. Cells were harvested for ubiquitination assay (n = 3 in every group). (E) HSC-LX2 cells were treated with erastin (10 μM) with or without cycloheximide (CHX, 20 μg/ml) or MG-132 (10 μM) for 24 h, and ZFP36 protein level was assayed (n = 3 in every group, *, p < 0.05, **, p < 0.01). (F) HSC-LX2 cells were treated with CHX (20 μg/ml) for 24 h or treated with erastin (10 μM) and CHX (20 μg/ml) for 24 h. ZFP36 protein levels were determined at the indicated time points (n = 3 in every group).

Article Snippet: ZFP36 shRNA plasmid (sc-36760-SH, sc-36761-SH), FBXW7 shRNA plasmid (sc-37547-SH, sc-37548-SH) and empty vector were purchased from Santa Cruz Biotechnology.

Techniques: RNA Binding Assay, Expressing, Ubiquitin Proteomics

Figure 2. The ubiquitin ligase FBXW7 decreases ZFP36 protein expression by recognizing SFSGLPS motif. (A) Amino acid sequence alignment between human and rat ZFP36 protein was determined. (B) HSC-LX2 cells were treated with erastin (10 μM), sorafenib (10 μM), and RSL3 (2.5 μM) for 24 h. The binding of ZFP36 and FBXW7 was determined by immunoprecipitation assay (n = 3 in every group). (C and D) FBXW7-deficient HSC-LX2 and HSC-T6 cells were treated with erastin (10 μM) for 24 h. The ubiquitylation of ZFP36 and the protein levels of ZFP36 and FBXW7 were determined (n = 3 in every group). (E) FBXW7-deficient HSC-LX2 cells were treated with erastin (10 μM) for 24 h. the mRNA levels of ZFP36 and FBXW7 were determined (n = 3 in every group, *, p < 0.05, **, p < 0.01, N.S., not significant). (F-H) HSC- LX2 cells were stably transferred with ZFP36 Δ186-192 plasmid, ZFP36 plasmid, or FBXW7 plasmid, and then were treated with erastin (10 μM) for 24 h. The binding of ZFP36 and FBXW7, the ubiquitylation of ZFP36, and the protein levels of ZFP36 were determined (n = 3 in every group, *, p < 0.05, N.S., not significant). (I) HSC-LX2 cells were treated with erastin (10 μM) with or without autophagy inhibitors (3-MA, 10 mM; bafilomycin A1, 5 nM) for 24 h. The protein levels of ZFP36 were determined (n = 3 in every group, ***, p < 0.001, N.S., not significant).

Journal: Autophagy

Article Title: RNA-binding protein ZFP36/TTP protects against ferroptosis by regulating autophagy signaling pathway in hepatic stellate cells.

doi: 10.1080/15548627.2019.1687985

Figure Lengend Snippet: Figure 2. The ubiquitin ligase FBXW7 decreases ZFP36 protein expression by recognizing SFSGLPS motif. (A) Amino acid sequence alignment between human and rat ZFP36 protein was determined. (B) HSC-LX2 cells were treated with erastin (10 μM), sorafenib (10 μM), and RSL3 (2.5 μM) for 24 h. The binding of ZFP36 and FBXW7 was determined by immunoprecipitation assay (n = 3 in every group). (C and D) FBXW7-deficient HSC-LX2 and HSC-T6 cells were treated with erastin (10 μM) for 24 h. The ubiquitylation of ZFP36 and the protein levels of ZFP36 and FBXW7 were determined (n = 3 in every group). (E) FBXW7-deficient HSC-LX2 cells were treated with erastin (10 μM) for 24 h. the mRNA levels of ZFP36 and FBXW7 were determined (n = 3 in every group, *, p < 0.05, **, p < 0.01, N.S., not significant). (F-H) HSC- LX2 cells were stably transferred with ZFP36 Δ186-192 plasmid, ZFP36 plasmid, or FBXW7 plasmid, and then were treated with erastin (10 μM) for 24 h. The binding of ZFP36 and FBXW7, the ubiquitylation of ZFP36, and the protein levels of ZFP36 were determined (n = 3 in every group, *, p < 0.05, N.S., not significant). (I) HSC-LX2 cells were treated with erastin (10 μM) with or without autophagy inhibitors (3-MA, 10 mM; bafilomycin A1, 5 nM) for 24 h. The protein levels of ZFP36 were determined (n = 3 in every group, ***, p < 0.001, N.S., not significant).

Article Snippet: ZFP36 shRNA plasmid (sc-36760-SH, sc-36761-SH), FBXW7 shRNA plasmid (sc-37547-SH, sc-37548-SH) and empty vector were purchased from Santa Cruz Biotechnology.

Techniques: Ubiquitin Proteomics, Expressing, Sequencing, Binding Assay, Immunoprecipitation, Stable Transfection, Plasmid Preparation

Figure 4. Reduced ferroptosis by ZFP36 plasmid is associated with autophagy inactivation. (A) HSC-LX2 cells overexpressing ZFP36 were treated with sorafenib (10 μM) for 24 h, and total RNAs were extracted for RNA-Seq. Microarray heat map demonstrates clustering of HSC-LX2 cells. Hierarchical cluster analyses of significantly differentially expressed mRNAs: bright blue, underexpression; gray, no change; bright red, overexpression (Control vector, n = 3; ZFP36 plasmid, n = 3). (B-D) HSC-LX2 cells overexpressing ZFP36 and FBXW7 were treated with erastin (10 μM), sorafenib (10 μM), and RSL3 (2.5 μM) for 24 h. The protein levels of ATG3, ATG4A, ATG12– ATG5, BECN1, ATG7, ATG9A, and ATG16L1 were determined (n = 3 in every group). (E) HSC-LX2 cells overexpressing ZFP36 and FBXW7 were treated with sorafenib (10 μM) for 24 h. The protein complex of ATG12–ATG5-ATG16L1 was assayed by immunocoprecipitation (n = 3 in every group). (F) HSC-LX2 and HSC-T6 cells overexpressing ZFP36 and FBXW7 were treated with sorafenib (10 μM) for 24 h. The protein levels of LC3-I/II were determined (n = 3 in every group).

Journal: Autophagy

Article Title: RNA-binding protein ZFP36/TTP protects against ferroptosis by regulating autophagy signaling pathway in hepatic stellate cells.

doi: 10.1080/15548627.2019.1687985

Figure Lengend Snippet: Figure 4. Reduced ferroptosis by ZFP36 plasmid is associated with autophagy inactivation. (A) HSC-LX2 cells overexpressing ZFP36 were treated with sorafenib (10 μM) for 24 h, and total RNAs were extracted for RNA-Seq. Microarray heat map demonstrates clustering of HSC-LX2 cells. Hierarchical cluster analyses of significantly differentially expressed mRNAs: bright blue, underexpression; gray, no change; bright red, overexpression (Control vector, n = 3; ZFP36 plasmid, n = 3). (B-D) HSC-LX2 cells overexpressing ZFP36 and FBXW7 were treated with erastin (10 μM), sorafenib (10 μM), and RSL3 (2.5 μM) for 24 h. The protein levels of ATG3, ATG4A, ATG12– ATG5, BECN1, ATG7, ATG9A, and ATG16L1 were determined (n = 3 in every group). (E) HSC-LX2 cells overexpressing ZFP36 and FBXW7 were treated with sorafenib (10 μM) for 24 h. The protein complex of ATG12–ATG5-ATG16L1 was assayed by immunocoprecipitation (n = 3 in every group). (F) HSC-LX2 and HSC-T6 cells overexpressing ZFP36 and FBXW7 were treated with sorafenib (10 μM) for 24 h. The protein levels of LC3-I/II were determined (n = 3 in every group).

Article Snippet: ZFP36 shRNA plasmid (sc-36760-SH, sc-36761-SH), FBXW7 shRNA plasmid (sc-37547-SH, sc-37548-SH) and empty vector were purchased from Santa Cruz Biotechnology.

Techniques: Plasmid Preparation, RNA Sequencing, Microarray, Over Expression, Control

Figure 5. ZFP36 plasmid inhibits HSC ferroptosis by regulating autophagy signaling. (A) HSC-LX2 cells overexpressing ZFP36 and FBXW7 were stably transferred with pGM-CMV-GFP-hLC3 plasmid, and then were treated with sorafenib (10 μM) for 24 h. The green fluorescence spots were detected. Scale bars: 50 μm. Representative photographs were shown (n = 3 in every group, **, p < 0.01, ***, p < 0.001). (B) HSC-LX2 cells overexpressing ZFP36 and FBXW7 were treated with sorafenib (10 μM) for 24 h. The endogenous LC3 levels were determined by immunofluorescence. Scale bars: 50 μm. Representative photographs were shown (n = 3 in every group, **, p < 0.01, ***, p < 0.001). (C) HSC-LX2 cells were stably transferred with CMV-TurboRFP-EGFP-LC3-PGK-Puro plasmid and ZFP36 plasmid, and then were treated with sorafenib (10 μM) with or without autophagy inhibitors (3-MA, 10 mM; bafilomycin A1, 5 nM) for 24 h. The yellow fluorescence and red fluorescence spots were detected. Scale bars: 50 μm. Representative photographs were shown (n = 3 in every group, *, p < 0.05, **, p < 0.01). (D) HSC-LX2 cells overexpressing ZFP36 and FBXW7 were treated with sorafenib (10 μM) for 24 h. Autophagosomes and autolysosomes were determined by transmission electron microscopy. Scale bars: 0.5 μm. Representative photographs were shown (n = 3 in every group, *, p < 0.05, **, p < 0.01, ##, p < 0.01).

Journal: Autophagy

Article Title: RNA-binding protein ZFP36/TTP protects against ferroptosis by regulating autophagy signaling pathway in hepatic stellate cells.

doi: 10.1080/15548627.2019.1687985

Figure Lengend Snippet: Figure 5. ZFP36 plasmid inhibits HSC ferroptosis by regulating autophagy signaling. (A) HSC-LX2 cells overexpressing ZFP36 and FBXW7 were stably transferred with pGM-CMV-GFP-hLC3 plasmid, and then were treated with sorafenib (10 μM) for 24 h. The green fluorescence spots were detected. Scale bars: 50 μm. Representative photographs were shown (n = 3 in every group, **, p < 0.01, ***, p < 0.001). (B) HSC-LX2 cells overexpressing ZFP36 and FBXW7 were treated with sorafenib (10 μM) for 24 h. The endogenous LC3 levels were determined by immunofluorescence. Scale bars: 50 μm. Representative photographs were shown (n = 3 in every group, **, p < 0.01, ***, p < 0.001). (C) HSC-LX2 cells were stably transferred with CMV-TurboRFP-EGFP-LC3-PGK-Puro plasmid and ZFP36 plasmid, and then were treated with sorafenib (10 μM) with or without autophagy inhibitors (3-MA, 10 mM; bafilomycin A1, 5 nM) for 24 h. The yellow fluorescence and red fluorescence spots were detected. Scale bars: 50 μm. Representative photographs were shown (n = 3 in every group, *, p < 0.05, **, p < 0.01). (D) HSC-LX2 cells overexpressing ZFP36 and FBXW7 were treated with sorafenib (10 μM) for 24 h. Autophagosomes and autolysosomes were determined by transmission electron microscopy. Scale bars: 0.5 μm. Representative photographs were shown (n = 3 in every group, *, p < 0.05, **, p < 0.01, ##, p < 0.01).

Article Snippet: ZFP36 shRNA plasmid (sc-36760-SH, sc-36761-SH), FBXW7 shRNA plasmid (sc-37547-SH, sc-37548-SH) and empty vector were purchased from Santa Cruz Biotechnology.

Techniques: Plasmid Preparation, Stable Transfection, Fluorescence, Immunofluorescence, Transmission Assay, Electron Microscopy

Figure 7. ZFP36 plasmid promotes autophagy inactivation and ATG16L1 mRNA decay via binding to the AU-rich elements. (A) The predicted hits of the ZFP36 signature motif in human ATG16L1 and TNF mRNA 3ʹ-UTR were assayed. (B) HSC-LX2 cells overexpressing ZFP36 were treated with sorafenib (10 μM), ActD (10 μg/ml) and DBR (5 μM) for indicated times. The remaining ATG16L1 mRNA levels were measured by real-time PCR and normalized to the results at 0 min after ActD/DRB treatment (n = 3 in every group, **, p < 0.01). (C) HSC-LX2 cells overexpressing ZFP36 were treated with sorafenib (10 μM) and CHX (20 μg/ml) for 150 min. ATG16L1 protein level was determined at the indicated time points (n = 3 in every group). (D) Association of endogenous ZFP36 with endogenous ATG16L1 mRNA was measured by real-time PCR after ribonucleoprotein immunoprecipitation (RNP IP) (n = 3 in every group, **, p < 0.01). (E) mRNA affinity isolation assay was performed with biotinylated transcripts of the ATG16L1 mRNA 5ʹ-UTR, coding region (CR), 3ʹ-UTR or the TNF mRNA 3ʹ-UTR (n = 3 in every group). (F) Luciferase constructs carrying the 3ʹ-UTRs of genes encoding ACTB (3ʹ-UTR-ACTB), TNF (3ʹ-UTR-TNF), ATG16L1 (3ʹ-UTR-ATG16L1) or empty vector (pGL3) was stably transfected into HSC-LX2 cells. Cells were treated with sorafenib (10 μM) for 24 h, and luciferase activities were measured and normalized to the activities obtained in pGL3-transfected cells without treatment (n = 3 in every group, ***, p < 0.001). (G) Luciferase constructs carrying the 3ʹ-UTRs of genes encoding ACTB (3ʹ-UTR-ACTB) and ATG16L1 (3ʹ-UTR- ATG16L1) were stably transfected into HSC-LX2 cells. Luciferase mRNA half-life was measured by real-time PCR after sorafenib (10 μM) and ActD/DRB treatment for indicated times (n = 3 in every group, ***, p < 0.001). (H) HSC-LX2 cells overexpressing ZFP36 were stably transfected with the luciferase constructs carrying the 3ʹ- UTRs of genes encoding ACTB (3ʹ-UTR-ACTB), TNF (3ʹ-UTR-TNF), ATG16L1 (3ʹ-UTR-ATG16L1) or empty vector (pGL3), and then were treated with sorafenib (10 μM) for 24 h. Luciferase activities were measured and normalized to the activities obtained in pGL3-transfected cells without treatment (n = 3 in every group, ***, p < 0.001). (I) ATG16L1 3ʹ-UTR luciferase construct was co-transfected with different amounts of ZFP36 plasmid into HSC-LX2 cells. Luciferase activity was detected after sorafenib (10 μM) treatment for 24 h and normalized to the cells transfected with empty plasmid (n = 3 in every group, *, p < 0.05, **, p < 0.01, ***, p < 0.001). (J) mRNA pull down assay was performed by mixing ATG16L1-AGE-Bio, TNF-AGE-Bio, and Mut-ATG16L1-AGE-Bio with total cell extracts from HSC-LX2 cells. Precipitates were prepared for western blot (n = 3 in every group). (K) Cold ATG16L1-AGE probes or Mut-ATG16L1-AGE probes with different concentrations were used to compete for the binding between ATG16L1-AGE-Bio and ZFP36 (n = 3 in every group).

Journal: Autophagy

Article Title: RNA-binding protein ZFP36/TTP protects against ferroptosis by regulating autophagy signaling pathway in hepatic stellate cells.

doi: 10.1080/15548627.2019.1687985

Figure Lengend Snippet: Figure 7. ZFP36 plasmid promotes autophagy inactivation and ATG16L1 mRNA decay via binding to the AU-rich elements. (A) The predicted hits of the ZFP36 signature motif in human ATG16L1 and TNF mRNA 3ʹ-UTR were assayed. (B) HSC-LX2 cells overexpressing ZFP36 were treated with sorafenib (10 μM), ActD (10 μg/ml) and DBR (5 μM) for indicated times. The remaining ATG16L1 mRNA levels were measured by real-time PCR and normalized to the results at 0 min after ActD/DRB treatment (n = 3 in every group, **, p < 0.01). (C) HSC-LX2 cells overexpressing ZFP36 were treated with sorafenib (10 μM) and CHX (20 μg/ml) for 150 min. ATG16L1 protein level was determined at the indicated time points (n = 3 in every group). (D) Association of endogenous ZFP36 with endogenous ATG16L1 mRNA was measured by real-time PCR after ribonucleoprotein immunoprecipitation (RNP IP) (n = 3 in every group, **, p < 0.01). (E) mRNA affinity isolation assay was performed with biotinylated transcripts of the ATG16L1 mRNA 5ʹ-UTR, coding region (CR), 3ʹ-UTR or the TNF mRNA 3ʹ-UTR (n = 3 in every group). (F) Luciferase constructs carrying the 3ʹ-UTRs of genes encoding ACTB (3ʹ-UTR-ACTB), TNF (3ʹ-UTR-TNF), ATG16L1 (3ʹ-UTR-ATG16L1) or empty vector (pGL3) was stably transfected into HSC-LX2 cells. Cells were treated with sorafenib (10 μM) for 24 h, and luciferase activities were measured and normalized to the activities obtained in pGL3-transfected cells without treatment (n = 3 in every group, ***, p < 0.001). (G) Luciferase constructs carrying the 3ʹ-UTRs of genes encoding ACTB (3ʹ-UTR-ACTB) and ATG16L1 (3ʹ-UTR- ATG16L1) were stably transfected into HSC-LX2 cells. Luciferase mRNA half-life was measured by real-time PCR after sorafenib (10 μM) and ActD/DRB treatment for indicated times (n = 3 in every group, ***, p < 0.001). (H) HSC-LX2 cells overexpressing ZFP36 were stably transfected with the luciferase constructs carrying the 3ʹ- UTRs of genes encoding ACTB (3ʹ-UTR-ACTB), TNF (3ʹ-UTR-TNF), ATG16L1 (3ʹ-UTR-ATG16L1) or empty vector (pGL3), and then were treated with sorafenib (10 μM) for 24 h. Luciferase activities were measured and normalized to the activities obtained in pGL3-transfected cells without treatment (n = 3 in every group, ***, p < 0.001). (I) ATG16L1 3ʹ-UTR luciferase construct was co-transfected with different amounts of ZFP36 plasmid into HSC-LX2 cells. Luciferase activity was detected after sorafenib (10 μM) treatment for 24 h and normalized to the cells transfected with empty plasmid (n = 3 in every group, *, p < 0.05, **, p < 0.01, ***, p < 0.001). (J) mRNA pull down assay was performed by mixing ATG16L1-AGE-Bio, TNF-AGE-Bio, and Mut-ATG16L1-AGE-Bio with total cell extracts from HSC-LX2 cells. Precipitates were prepared for western blot (n = 3 in every group). (K) Cold ATG16L1-AGE probes or Mut-ATG16L1-AGE probes with different concentrations were used to compete for the binding between ATG16L1-AGE-Bio and ZFP36 (n = 3 in every group).

Article Snippet: ZFP36 shRNA plasmid (sc-36760-SH, sc-36761-SH), FBXW7 shRNA plasmid (sc-37547-SH, sc-37548-SH) and empty vector were purchased from Santa Cruz Biotechnology.

Techniques: Plasmid Preparation, Binding Assay, Real-time Polymerase Chain Reaction, Immunoprecipitation, Isolation, Luciferase, Construct, Stable Transfection, Transfection, Activity Assay, Pull Down Assay, Western Blot

Figure 10. RNA-binding protein ZFP36 protects against ferroptosis by regulating autophagy signaling pathway in HSCs. ZFP36 overexpression can result in ATG16L1 mRNA decay via binding to the AREs in the 3ʹ-UTR, thus triggering autophagy inactivation, blocking autophagic ferritin degradation, and eventually conferring resistance to ferroptosis.

Journal: Autophagy

Article Title: RNA-binding protein ZFP36/TTP protects against ferroptosis by regulating autophagy signaling pathway in hepatic stellate cells.

doi: 10.1080/15548627.2019.1687985

Figure Lengend Snippet: Figure 10. RNA-binding protein ZFP36 protects against ferroptosis by regulating autophagy signaling pathway in HSCs. ZFP36 overexpression can result in ATG16L1 mRNA decay via binding to the AREs in the 3ʹ-UTR, thus triggering autophagy inactivation, blocking autophagic ferritin degradation, and eventually conferring resistance to ferroptosis.

Article Snippet: ZFP36 shRNA plasmid (sc-36760-SH, sc-36761-SH), FBXW7 shRNA plasmid (sc-37547-SH, sc-37548-SH) and empty vector were purchased from Santa Cruz Biotechnology.

Techniques: RNA Binding Assay, Over Expression, Binding Assay, Blocking Assay