tnf alpha Search Results


86
Servicebio Inc f4 80
F4 80, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tnf+alpha/anti+tnf+%CE%B1/pmc11927336-61-44-45
Average 86 stars, based on 1 article reviews
f4 80 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Eurofins il 6 nm 031168 probe eurofins 50cagataagctggagtcacagaaggagtgg 30 tnf alpha
Il 6 Nm 031168 Probe Eurofins 50cagataagctggagtcacagaaggagtgg 30 Tnf Alpha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tnf+alpha/031168+30+50cagataagctggagtcacagaaggagtgg+6+alpha+eurofins+il+nm+probe+tnf/pm30995475-232-95-98
Average 86 stars, based on 1 article reviews
il 6 nm 031168 probe eurofins 50cagataagctggagtcacagaaggagtgg 30 tnf alpha - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Procell Inc tnf α
Tnf α, supplied by Procell Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tnf+alpha/tnf+%CE%B1/pm38493291-90-27-29
Average 86 stars, based on 1 article reviews
tnf α - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Jackson Laboratory t cell specific tnf knockout mice
T Cell Specific Tnf Knockout Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tnf+alpha/6+c57bl+knockout+ko+mice+tnf+%CE%B1/pmc11790381-49-1-16
Average 86 stars, based on 1 article reviews
t cell specific tnf knockout mice - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

97
R&D Systems tnf α
Tnf α, supplied by R&D Systems, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tnf+alpha/Mouse+TNF-alpha+DuoSet+ELISA/pm39796030-331-57-59
Average 97 stars, based on 1 article reviews
tnf α - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

97
Miltenyi Biotec anti tnfα
Anti Tnfα, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tnf+alpha/TNF-%CE%B1+Secretion+Assay+-+Detection+Kit+(PE)%2C+human/10__1038_slash_s41596___019___0195___x-607-58-63
Average 97 stars, based on 1 article reviews
anti tnfα - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

97
R&D Systems recombinant murine tnfα
3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml <t>TNFα</t> (TNFα), or both (Rosi+TNFα), together with vehicle (DMSO, bars 1-4) or 660 nM TSA (TSA, bars 5-8) for 24 h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of seven independent experiments. Asterisks denote significant differences (***p<0.001). NS, not significant. ## p<0.01 bar 5 vs 1.
Recombinant Murine Tnfα, supplied by R&D Systems, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tnf+alpha/Recombinant+Mouse+TNF-alpha+(aa+80-235)+Protein/pmc03739734-58-0-7
Average 97 stars, based on 1 article reviews
recombinant murine tnfα - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

93
R&D Systems human tnfα
A. 5×10 5 RAW264.7 cells were seeded in 96 wells for 18 h. Cells were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. <t>TNF</t> cytokine releases were monitored <t>by</t> <t>ELISA.</t> B. PBMC (0.2 ml at 1×10 5 /ml) were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. TNF cytokine releases were monitored by ELISA. % of TNF secretion were calculated and graphed. C. Summary of compound IC 50 . The data represent n = 3–6 experiments.
Human Tnfα, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tnf+alpha/Human+TNF-alpha+ELISA+Kit+(Colorimetric)/pmc04280171-96-6-10
Average 93 stars, based on 1 article reviews
human tnfα - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

99
R&D Systems recombinant human tnf
A. 5×10 5 RAW264.7 cells were seeded in 96 wells for 18 h. Cells were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. <t>TNF</t> cytokine releases were monitored <t>by</t> <t>ELISA.</t> B. PBMC (0.2 ml at 1×10 5 /ml) were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. TNF cytokine releases were monitored by ELISA. % of TNF secretion were calculated and graphed. C. Summary of compound IC 50 . The data represent n = 3–6 experiments.
Recombinant Human Tnf, supplied by R&D Systems, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tnf+alpha/Recombinant+Human+TNF-alpha+Protein/pm31281956-40-16-19
Average 99 stars, based on 1 article reviews
recombinant human tnf - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

95
R&D Systems human tnf α
A. 5×10 5 RAW264.7 cells were seeded in 96 wells for 18 h. Cells were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. <t>TNF</t> cytokine releases were monitored <t>by</t> <t>ELISA.</t> B. PBMC (0.2 ml at 1×10 5 /ml) were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. TNF cytokine releases were monitored by ELISA. % of TNF secretion were calculated and graphed. C. Summary of compound IC 50 . The data represent n = 3–6 experiments.
Human Tnf α, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tnf+alpha/Recombinant+Human+TNF-alpha+Protein%2C+CF/pmc03098240-185-88-93
Average 95 stars, based on 1 article reviews
human tnf α - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

94
R&D Systems blocking antibody for tnfα
A. 5×10 5 RAW264.7 cells were seeded in 96 wells for 18 h. Cells were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. <t>TNF</t> cytokine releases were monitored <t>by</t> <t>ELISA.</t> B. PBMC (0.2 ml at 1×10 5 /ml) were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. TNF cytokine releases were monitored by ELISA. % of TNF secretion were calculated and graphed. C. Summary of compound IC 50 . The data represent n = 3–6 experiments.
Blocking Antibody For Tnfα, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tnf+alpha/Mouse+TNF-alpha+Antibody/pmc03101673-117-36-47
Average 94 stars, based on 1 article reviews
blocking antibody for tnfα - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

95
R&D Systems tnf alpha blocking antibody
A. 5×10 5 RAW264.7 cells were seeded in 96 wells for 18 h. Cells were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. <t>TNF</t> cytokine releases were monitored <t>by</t> <t>ELISA.</t> B. PBMC (0.2 ml at 1×10 5 /ml) were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. TNF cytokine releases were monitored by ELISA. % of TNF secretion were calculated and graphed. C. Summary of compound IC 50 . The data represent n = 3–6 experiments.
Tnf Alpha Blocking Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tnf+alpha/Human%2FMouse+TNF-alpha+Antibody/pmc03026185-26-33-39
Average 95 stars, based on 1 article reviews
tnf alpha blocking antibody - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

Image Search Results


3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα), together with vehicle (DMSO, bars 1-4) or 660 nM TSA (TSA, bars 5-8) for 24 h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of seven independent experiments. Asterisks denote significant differences (***p<0.001). NS, not significant. ## p<0.01 bar 5 vs 1.

Journal: PLoS ONE

Article Title: Trichostatin A Modulates Thiazolidinedione-Mediated Suppression of Tumor Necrosis Factor α-Induced Lipolysis in 3T3-L1 Adipocytes

doi: 10.1371/journal.pone.0071517

Figure Lengend Snippet: 3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα), together with vehicle (DMSO, bars 1-4) or 660 nM TSA (TSA, bars 5-8) for 24 h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of seven independent experiments. Asterisks denote significant differences (***p<0.001). NS, not significant. ## p<0.01 bar 5 vs 1.

Article Snippet: Recombinant murine TNFα (No. 410-MT) was from R & D Systems (Minneapolis, MN).

Techniques: Control

3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα), together with increasing TSA doses (0, 6.6, 66, 660, 6600 nM) for 24 h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of three independent experiments. Asterisks denote significant differences (p<0.05). NS, not significant. # p<0.05 vs 0 nM control.

Journal: PLoS ONE

Article Title: Trichostatin A Modulates Thiazolidinedione-Mediated Suppression of Tumor Necrosis Factor α-Induced Lipolysis in 3T3-L1 Adipocytes

doi: 10.1371/journal.pone.0071517

Figure Lengend Snippet: 3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα), together with increasing TSA doses (0, 6.6, 66, 660, 6600 nM) for 24 h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of three independent experiments. Asterisks denote significant differences (p<0.05). NS, not significant. # p<0.05 vs 0 nM control.

Article Snippet: Recombinant murine TNFα (No. 410-MT) was from R & D Systems (Minneapolis, MN).

Techniques: Control

(A) 3T3-L1 adipocytes were transfected with non-targeting luciferase siRNA (Luc), or siRNA against SMRT, NCoR, or PPARγ. The levels of mRNA were determined by qPCR. Each point represents the mean ± S.E. of at least three independent experiments. (B) 3T3-L1 adipocytes were transfected with control (Luc), SMRT, NCoR, or PPARγ siRNA. 24 h post transfection, cells were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα) for additional 24 h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of four independent experiments. Asterisks denote significant differences (*p<0.05; **p<0.01). NS, not significant.

Journal: PLoS ONE

Article Title: Trichostatin A Modulates Thiazolidinedione-Mediated Suppression of Tumor Necrosis Factor α-Induced Lipolysis in 3T3-L1 Adipocytes

doi: 10.1371/journal.pone.0071517

Figure Lengend Snippet: (A) 3T3-L1 adipocytes were transfected with non-targeting luciferase siRNA (Luc), or siRNA against SMRT, NCoR, or PPARγ. The levels of mRNA were determined by qPCR. Each point represents the mean ± S.E. of at least three independent experiments. (B) 3T3-L1 adipocytes were transfected with control (Luc), SMRT, NCoR, or PPARγ siRNA. 24 h post transfection, cells were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα) for additional 24 h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of four independent experiments. Asterisks denote significant differences (*p<0.05; **p<0.01). NS, not significant.

Article Snippet: Recombinant murine TNFα (No. 410-MT) was from R & D Systems (Minneapolis, MN).

Techniques: Transfection, Luciferase, Control

(A) 3T3-L1 adipocytes were treated with DMSO, 660 nM TSA, 20 µM SAHA, 10 µM MS275, or 5 µM MC1568 for 24 h. Cellular proteins were solubilized and subjected to SDS-PAGE and Western blot analysis with the indicated antibodies. Samples were treated in duplicate. Representative immunoblots from three independent experiments are shown. (B) 3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα), together with vehicle (DMSO), 660 nM TSA, 10 µM MS275, 5 µM MC1568, or combination of MS275 and MC1568 (MS275+MC1568) for 24 h. (C) 3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα), together with vehicle (DMSO), 660 nM TSA (TSA), 5 or 20 µM SAHA (SAHA) for 24 h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of four independent experiments. Asterisks denote significant differences (*p<0.05; **p<0.01; ***p<0.001). NS: not significant. # p<0.05, ## p<0.01 vs the corresponding DMSO Control.

Journal: PLoS ONE

Article Title: Trichostatin A Modulates Thiazolidinedione-Mediated Suppression of Tumor Necrosis Factor α-Induced Lipolysis in 3T3-L1 Adipocytes

doi: 10.1371/journal.pone.0071517

Figure Lengend Snippet: (A) 3T3-L1 adipocytes were treated with DMSO, 660 nM TSA, 20 µM SAHA, 10 µM MS275, or 5 µM MC1568 for 24 h. Cellular proteins were solubilized and subjected to SDS-PAGE and Western blot analysis with the indicated antibodies. Samples were treated in duplicate. Representative immunoblots from three independent experiments are shown. (B) 3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα), together with vehicle (DMSO), 660 nM TSA, 10 µM MS275, 5 µM MC1568, or combination of MS275 and MC1568 (MS275+MC1568) for 24 h. (C) 3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα), together with vehicle (DMSO), 660 nM TSA (TSA), 5 or 20 µM SAHA (SAHA) for 24 h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of four independent experiments. Asterisks denote significant differences (*p<0.05; **p<0.01; ***p<0.001). NS: not significant. # p<0.05, ## p<0.01 vs the corresponding DMSO Control.

Article Snippet: Recombinant murine TNFα (No. 410-MT) was from R & D Systems (Minneapolis, MN).

Techniques: SDS Page, Western Blot, Control

(A and B) 3T3-L1 adipocytes were pretreated with vehicle (DMSO) or 660 nM TSA, together with or without 1 µM Rosi (Rosi) for 24h. Cells were then treated with or without 10 ng/ml TNFα for 30 min. Cellular proteins were solubilized and subjected to SDS-PAGE and Western analysis with the indicated antibodies. Representative immunoblots and quantification data from five independent experiments are shown in 5A and B, respectively. (C) ERK phosphorylation correlates highly with lipolysis in the treatments of Rosi, TNFα, or both in the presence or absence of TSA, as shown by fitting with linear regression. Individual values were obtained from the experiments described in Figures. 1 and 7B.

Journal: PLoS ONE

Article Title: Trichostatin A Modulates Thiazolidinedione-Mediated Suppression of Tumor Necrosis Factor α-Induced Lipolysis in 3T3-L1 Adipocytes

doi: 10.1371/journal.pone.0071517

Figure Lengend Snippet: (A and B) 3T3-L1 adipocytes were pretreated with vehicle (DMSO) or 660 nM TSA, together with or without 1 µM Rosi (Rosi) for 24h. Cells were then treated with or without 10 ng/ml TNFα for 30 min. Cellular proteins were solubilized and subjected to SDS-PAGE and Western analysis with the indicated antibodies. Representative immunoblots and quantification data from five independent experiments are shown in 5A and B, respectively. (C) ERK phosphorylation correlates highly with lipolysis in the treatments of Rosi, TNFα, or both in the presence or absence of TSA, as shown by fitting with linear regression. Individual values were obtained from the experiments described in Figures. 1 and 7B.

Article Snippet: Recombinant murine TNFα (No. 410-MT) was from R & D Systems (Minneapolis, MN).

Techniques: SDS Page, Western Blot, Phospho-proteomics

(A) 3T3-L1 adipocytes were pretreated with vehicle (DMSO) or 25 µM U0126 for 1 h, followed by treatment with or without 10 ng/ml TNFα for 30 min. Cellular proteins were solubilized and subjected to SDS-PAGE and Western blot analysis with the indicated antibodies. (B) 3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα), together with DMSO (bars 1-4), 660 nM TSA (bars 5-8), 25 µM U0126 (bars 9-12), or both (bars 13-16) for 24h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of four independent experiments. Asterisks denote significant differences (**: p<0.01). NS, not significant. ## p<0.01 vs Treatment No.1.

Journal: PLoS ONE

Article Title: Trichostatin A Modulates Thiazolidinedione-Mediated Suppression of Tumor Necrosis Factor α-Induced Lipolysis in 3T3-L1 Adipocytes

doi: 10.1371/journal.pone.0071517

Figure Lengend Snippet: (A) 3T3-L1 adipocytes were pretreated with vehicle (DMSO) or 25 µM U0126 for 1 h, followed by treatment with or without 10 ng/ml TNFα for 30 min. Cellular proteins were solubilized and subjected to SDS-PAGE and Western blot analysis with the indicated antibodies. (B) 3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα), together with DMSO (bars 1-4), 660 nM TSA (bars 5-8), 25 µM U0126 (bars 9-12), or both (bars 13-16) for 24h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of four independent experiments. Asterisks denote significant differences (**: p<0.01). NS, not significant. ## p<0.01 vs Treatment No.1.

Article Snippet: Recombinant murine TNFα (No. 410-MT) was from R & D Systems (Minneapolis, MN).

Techniques: SDS Page, Western Blot, Control

A. 5×10 5 RAW264.7 cells were seeded in 96 wells for 18 h. Cells were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. TNF cytokine releases were monitored by ELISA. B. PBMC (0.2 ml at 1×10 5 /ml) were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. TNF cytokine releases were monitored by ELISA. % of TNF secretion were calculated and graphed. C. Summary of compound IC 50 . The data represent n = 3–6 experiments.

Journal: PLoS ONE

Article Title: Novel PDE4 Inhibitors Derived from Chinese Medicine Forsythia

doi: 10.1371/journal.pone.0115937

Figure Lengend Snippet: A. 5×10 5 RAW264.7 cells were seeded in 96 wells for 18 h. Cells were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. TNF cytokine releases were monitored by ELISA. B. PBMC (0.2 ml at 1×10 5 /ml) were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. TNF cytokine releases were monitored by ELISA. % of TNF secretion were calculated and graphed. C. Summary of compound IC 50 . The data represent n = 3–6 experiments.

Article Snippet: IL1β, TNFα, IL6 mouse ELISA kit, human TNFα were from R&D systems.

Techniques: Concentration Assay, Enzyme-linked Immunosorbent Assay