|
Miltenyi Biotec
anti tnfα Anti Tnfα, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tnf/10__1038_slash_s41596___019___0195___x-607-58-63?v=Miltenyi+Biotec Average 97 stars, based on 1 article reviews
anti tnfα - by Bioz Stars,
2026-08
97/100 stars
|
Buy from Supplier |
|
Servicebio Inc
f4 80 F4 80, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tnf/pmc11927336-61-44-45?v=Servicebio+Inc Average 86 stars, based on 1 article reviews
f4 80 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Eurofins
il 6 nm 031168 probe eurofins 50cagataagctggagtcacagaaggagtgg 30 tnf alpha Il 6 Nm 031168 Probe Eurofins 50cagataagctggagtcacagaaggagtgg 30 Tnf Alpha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tnf/pm30995475-232-95-98?v=Eurofins Average 86 stars, based on 1 article reviews
il 6 nm 031168 probe eurofins 50cagataagctggagtcacagaaggagtgg 30 tnf alpha - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Procell Inc
tnf α Tnf α, supplied by Procell Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tnf/pm38493291-90-27-29?v=Procell+Inc Average 86 stars, based on 1 article reviews
tnf α - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
t cell specific tnf knockout mice T Cell Specific Tnf Knockout Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tnf/pmc11790381-49-1-16?v=Jackson+Laboratory Average 86 stars, based on 1 article reviews
t cell specific tnf knockout mice - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Wuhan Sanying Biotechnology
tnfα Tnfα, supplied by Wuhan Sanying Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tnf/pmc12399170-47-75-76?v=Wuhan+Sanying+Biotechnology Average 86 stars, based on 1 article reviews
tnfα - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
R&D Systems
tnf α Tnf α, supplied by R&D Systems, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tnf/pm39796030-331-57-59?v=R%26D+Systems Average 97 stars, based on 1 article reviews
tnf α - by Bioz Stars,
2026-08
97/100 stars
|
Buy from Supplier |
|
R&D Systems
recombinant murine tnfα ![]() Recombinant Murine Tnfα, supplied by R&D Systems, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tnf/pmc03739734-58-0-7?v=R%26D+Systems Average 97 stars, based on 1 article reviews
recombinant murine tnfα - by Bioz Stars,
2026-08
97/100 stars
|
Buy from Supplier |
|
R&D Systems
human tnfα ![]() Human Tnfα, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tnf/pmc04280171-96-6-10?v=R%26D+Systems Average 93 stars, based on 1 article reviews
human tnfα - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
R&D Systems
recombinant human tnf ![]() Recombinant Human Tnf, supplied by R&D Systems, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tnf/pm31281956-40-16-19?v=R%26D+Systems Average 99 stars, based on 1 article reviews
recombinant human tnf - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
R&D Systems
human tnf α ![]() Human Tnf α, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tnf/pmc03098240-185-88-93?v=R%26D+Systems Average 95 stars, based on 1 article reviews
human tnf α - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
Proteintech
jess simple western ![]() Jess Simple Western, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tnf/pmc12487847__jciinsight-10-184309-s163-97-12-18?v=Proteintech Average 93 stars, based on 1 article reviews
jess simple western - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: PLoS ONE
Article Title: Trichostatin A Modulates Thiazolidinedione-Mediated Suppression of Tumor Necrosis Factor α-Induced Lipolysis in 3T3-L1 Adipocytes
doi: 10.1371/journal.pone.0071517
Figure Lengend Snippet: 3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα), together with vehicle (DMSO, bars 1-4) or 660 nM TSA (TSA, bars 5-8) for 24 h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of seven independent experiments. Asterisks denote significant differences (***p<0.001). NS, not significant. ## p<0.01 bar 5 vs 1.
Article Snippet:
Techniques: Control
Journal: PLoS ONE
Article Title: Trichostatin A Modulates Thiazolidinedione-Mediated Suppression of Tumor Necrosis Factor α-Induced Lipolysis in 3T3-L1 Adipocytes
doi: 10.1371/journal.pone.0071517
Figure Lengend Snippet: 3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα), together with increasing TSA doses (0, 6.6, 66, 660, 6600 nM) for 24 h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of three independent experiments. Asterisks denote significant differences (p<0.05). NS, not significant. # p<0.05 vs 0 nM control.
Article Snippet:
Techniques: Control
Journal: PLoS ONE
Article Title: Trichostatin A Modulates Thiazolidinedione-Mediated Suppression of Tumor Necrosis Factor α-Induced Lipolysis in 3T3-L1 Adipocytes
doi: 10.1371/journal.pone.0071517
Figure Lengend Snippet: (A) 3T3-L1 adipocytes were transfected with non-targeting luciferase siRNA (Luc), or siRNA against SMRT, NCoR, or PPARγ. The levels of mRNA were determined by qPCR. Each point represents the mean ± S.E. of at least three independent experiments. (B) 3T3-L1 adipocytes were transfected with control (Luc), SMRT, NCoR, or PPARγ siRNA. 24 h post transfection, cells were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα) for additional 24 h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of four independent experiments. Asterisks denote significant differences (*p<0.05; **p<0.01). NS, not significant.
Article Snippet:
Techniques: Transfection, Luciferase, Control
Journal: PLoS ONE
Article Title: Trichostatin A Modulates Thiazolidinedione-Mediated Suppression of Tumor Necrosis Factor α-Induced Lipolysis in 3T3-L1 Adipocytes
doi: 10.1371/journal.pone.0071517
Figure Lengend Snippet: (A) 3T3-L1 adipocytes were treated with DMSO, 660 nM TSA, 20 µM SAHA, 10 µM MS275, or 5 µM MC1568 for 24 h. Cellular proteins were solubilized and subjected to SDS-PAGE and Western blot analysis with the indicated antibodies. Samples were treated in duplicate. Representative immunoblots from three independent experiments are shown. (B) 3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα), together with vehicle (DMSO), 660 nM TSA, 10 µM MS275, 5 µM MC1568, or combination of MS275 and MC1568 (MS275+MC1568) for 24 h. (C) 3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα), together with vehicle (DMSO), 660 nM TSA (TSA), 5 or 20 µM SAHA (SAHA) for 24 h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of four independent experiments. Asterisks denote significant differences (*p<0.05; **p<0.01; ***p<0.001). NS: not significant. # p<0.05, ## p<0.01 vs the corresponding DMSO Control.
Article Snippet:
Techniques: SDS Page, Western Blot, Control
Journal: PLoS ONE
Article Title: Trichostatin A Modulates Thiazolidinedione-Mediated Suppression of Tumor Necrosis Factor α-Induced Lipolysis in 3T3-L1 Adipocytes
doi: 10.1371/journal.pone.0071517
Figure Lengend Snippet: (A and B) 3T3-L1 adipocytes were pretreated with vehicle (DMSO) or 660 nM TSA, together with or without 1 µM Rosi (Rosi) for 24h. Cells were then treated with or without 10 ng/ml TNFα for 30 min. Cellular proteins were solubilized and subjected to SDS-PAGE and Western analysis with the indicated antibodies. Representative immunoblots and quantification data from five independent experiments are shown in 5A and B, respectively. (C) ERK phosphorylation correlates highly with lipolysis in the treatments of Rosi, TNFα, or both in the presence or absence of TSA, as shown by fitting with linear regression. Individual values were obtained from the experiments described in Figures. 1 and 7B.
Article Snippet:
Techniques: SDS Page, Western Blot, Phospho-proteomics
Journal: PLoS ONE
Article Title: Trichostatin A Modulates Thiazolidinedione-Mediated Suppression of Tumor Necrosis Factor α-Induced Lipolysis in 3T3-L1 Adipocytes
doi: 10.1371/journal.pone.0071517
Figure Lengend Snippet: (A) 3T3-L1 adipocytes were pretreated with vehicle (DMSO) or 25 µM U0126 for 1 h, followed by treatment with or without 10 ng/ml TNFα for 30 min. Cellular proteins were solubilized and subjected to SDS-PAGE and Western blot analysis with the indicated antibodies. (B) 3T3-L1 adipocytes were treated with vehicle (Control), 1 µM Rosi (Rosi), 10 ng/ml TNFα (TNFα), or both (Rosi+TNFα), together with DMSO (bars 1-4), 660 nM TSA (bars 5-8), 25 µM U0126 (bars 9-12), or both (bars 13-16) for 24h. Glycerol released into the media and protein concentrations of cell lysate were determined as described in Materials and Methods . Each point represents the mean ± S.E. of four independent experiments. Asterisks denote significant differences (**: p<0.01). NS, not significant. ## p<0.01 vs Treatment No.1.
Article Snippet:
Techniques: SDS Page, Western Blot, Control
Journal: PLoS ONE
Article Title: Novel PDE4 Inhibitors Derived from Chinese Medicine Forsythia
doi: 10.1371/journal.pone.0115937
Figure Lengend Snippet: A. 5×10 5 RAW264.7 cells were seeded in 96 wells for 18 h. Cells were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. TNF cytokine releases were monitored by ELISA. B. PBMC (0.2 ml at 1×10 5 /ml) were primed with compounds at different concentration for 3 h before treated with LPS (1 ng/ml) for additional 8 h. TNF cytokine releases were monitored by ELISA. % of TNF secretion were calculated and graphed. C. Summary of compound IC 50 . The data represent n = 3–6 experiments.
Article Snippet: IL1β, TNFα, IL6 mouse ELISA kit,
Techniques: Concentration Assay, Enzyme-linked Immunosorbent Assay