timp3 Search Results


86
Thermo Fisher gene exp timp3 rn00441826 m1
Upregulated genes in miR-146a-transfected hepatic stellate cell-2
Gene Exp Timp3 Rn00441826 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp timp3 rn00441826 m1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp timp3 rn00441826 m1 - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

93
R&D Systems timp3
Photomicrographs illustrating immunohistochemical staining for estrogen receptor 1 (ESR1), progesterone receptor (PGR) MMP26, <t>TIMP3,</t> Ki-67 and androgen receptor (AR) in the endometrial functionalis zone of the macaque uterus from representative females in each treatment group (C, T, WSD, T+WSD). Brown staining denotes positive expression of proteins. Sections are counterstained with hematoxylin (blue) staining. ESR1, PGR, Ki-67 and AR staining is nuclear, while MMP26 and TIMP3 show cytoplasmic localization. Inset shows a negative control with an irrelevant antibody (Anti-Br(d)U). TIMP3 staining was localized to the predecidual cells around the spiral arteries.
Timp3, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/timp3/product/R&D Systems
Average 93 stars, based on 1 article reviews
timp3 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

94
Santa Cruz Biotechnology timp3 antibody
Figure 1. <t>TIMP3</t> was downregulated in colon cancer tissues. (a) TIMP3 expression at mRNA level was detected in colon cancers and paired normal mucosal tissues. TIMP3 was expressed in normal mucosal tissues but not cancer tissues. (N, normal mucosal tissue and C, colon cancer tissue); (b) Western blot showed lower expression of TIMP3 in colon cancer tissues than in normal mucosa; (c) A pair of the stained tissues from the same patient to show TIMP3 expression (left: normal mucosal tissue, right: colon cancer tissue). TIMP3 expression was obvious in cytoplasm of normal mucosal cell, but was shut off in cancer tissue. (d) The quantitative analysis of the TIMP3 staining in tissue array. TIMP3 expression was much lower in cancer tissues than that in normal control tissues (compared with normal mucosa, *Po0.01).
Timp3 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/timp3 antibody/product/Santa Cruz Biotechnology
Average 94 stars, based on 1 article reviews
timp3 antibody - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

93
Boster Bio timp3 antibody
Gastric carcinoma <t> TIMP3 </t> promoter methylation and protein expression
Timp3 Antibody, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/timp3 antibody/product/Boster Bio
Average 93 stars, based on 1 article reviews
timp3 antibody - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

90
Boster Bio rabbit polyclonal anti tissue inhibitor
Gastric carcinoma <t> TIMP3 </t> promoter methylation and protein expression
Rabbit Polyclonal Anti Tissue Inhibitor, supplied by Boster Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit polyclonal anti tissue inhibitor/product/Boster Bio
Average 90 stars, based on 1 article reviews
rabbit polyclonal anti tissue inhibitor - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc anti timp3
Gastric carcinoma <t> TIMP3 </t> promoter methylation and protein expression
Anti Timp3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti timp3/product/Cell Signaling Technology Inc
Average 94 stars, based on 1 article reviews
anti timp3 - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

93
Proteintech timp 3
Gastric carcinoma <t> TIMP3 </t> promoter methylation and protein expression
Timp 3, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/timp 3/product/Proteintech
Average 93 stars, based on 1 article reviews
timp 3 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

96
Thermo Fisher gene exp timp3 hs00165949 m1
T3-induced genes in WERI cells (fold-change ≥ 4, p-value ≤0.01)
Gene Exp Timp3 Hs00165949 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp timp3 hs00165949 m1/product/Thermo Fisher
Average 96 stars, based on 1 article reviews
gene exp timp3 hs00165949 m1 - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

94
R&D Systems recombinant timp 3 protein
T3-induced genes in WERI cells (fold-change ≥ 4, p-value ≤0.01)
Recombinant Timp 3 Protein, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant timp 3 protein/product/R&D Systems
Average 94 stars, based on 1 article reviews
recombinant timp 3 protein - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

93
Bio-Techne corporation timp3
( A ) Schematic overview of experimental design. ExM: expansion medium; MDM: minimal differentiation medium. ( B ) Uniform Manifold Approximation and Projection (UMAP) visualization (left panel) and relative proportions (right panel) of subpopulations in endometrial assembloid decidualized in the presence or absence of dasatinib. ( C ) Number of differentially expressed genes (DEGs) in each subpopulation in response to dasatinib pre-treatment. ( D ) Secreted levels of CXCL8 and decidual cell factors in spent medium from assembloids treated with or without dasatinib. Secreted levels in individual assembloids established from four different endometrial assembloids decidualized with or without dasatinib are shown by dotted and solid lines, respectively. Full lists of DEGs and associated GO analysis can be found in and , respectively. Data used in ( D ) are available in . Figure 5—source data 1. Differentially expressed genes for day 4 populations treated with and without dasatinib. Specified pairwise comparisons were generated in Seurat v3 using FindMarkers. Supports . Figure 5—source data 2. GO analysis for day 4 populations treated with and without dasatinib. Figure 5—source data 3. ELISA data. Secreted levels of key senescent (CXCL8) and decidual stromal cell markers (CXCL14, IL-15, <t>TIMP3)</t> (pg/ml) were examined by ELISA in spent medium from assembloids treated with or without dasatinib. Supports .
Timp3, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/timp3/product/Bio-Techne corporation
Average 93 stars, based on 1 article reviews
timp3 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

92
R&D Systems anti human timp 3
( A ) Schematic overview of experimental design. ExM: expansion medium; MDM: minimal differentiation medium. ( B ) Uniform Manifold Approximation and Projection (UMAP) visualization (left panel) and relative proportions (right panel) of subpopulations in endometrial assembloid decidualized in the presence or absence of dasatinib. ( C ) Number of differentially expressed genes (DEGs) in each subpopulation in response to dasatinib pre-treatment. ( D ) Secreted levels of CXCL8 and decidual cell factors in spent medium from assembloids treated with or without dasatinib. Secreted levels in individual assembloids established from four different endometrial assembloids decidualized with or without dasatinib are shown by dotted and solid lines, respectively. Full lists of DEGs and associated GO analysis can be found in and , respectively. Data used in ( D ) are available in . Figure 5—source data 1. Differentially expressed genes for day 4 populations treated with and without dasatinib. Specified pairwise comparisons were generated in Seurat v3 using FindMarkers. Supports . Figure 5—source data 2. GO analysis for day 4 populations treated with and without dasatinib. Figure 5—source data 3. ELISA data. Secreted levels of key senescent (CXCL8) and decidual stromal cell markers (CXCL14, IL-15, <t>TIMP3)</t> (pg/ml) were examined by ELISA in spent medium from assembloids treated with or without dasatinib. Supports .
Anti Human Timp 3, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti human timp 3/product/R&D Systems
Average 92 stars, based on 1 article reviews
anti human timp 3 - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

Image Search Results


Upregulated genes in miR-146a-transfected hepatic stellate cell-2

Journal: World Journal of Gastroenterology : WJG

Article Title: miRNA studies in in vitro and in vivo activated hepatic stellate cells

doi: 10.3748/wjg.v17.i22.

Figure Lengend Snippet: Upregulated genes in miR-146a-transfected hepatic stellate cell-2

Article Snippet: Taqman assays used were smooth muscle α-actin (SMAA) (Rn01759928_g1), Col1a1 (Rn01463849_g1), interleukin (IL)-6 (Rn00561420_m1), cyclooxygenase-2 (Cox-2) (Rn00568225_m1), RelA (Rn01502266_m1), CD31 (Rn01467259_m1), Albumin (Rn01413833_m1), CD68 (Rn01495643_g1) and tissue inhibitor of metalloproteinase (TIMP)-3 (Rn00441826_m1).

Techniques: Membrane, Translocation Assay, Coagulation, Sequencing, Binding Assay, Clinical Proteomics, Protein Binding, Activity Assay, RNA Binding Assay, Starch

Photomicrographs illustrating immunohistochemical staining for estrogen receptor 1 (ESR1), progesterone receptor (PGR) MMP26, TIMP3, Ki-67 and androgen receptor (AR) in the endometrial functionalis zone of the macaque uterus from representative females in each treatment group (C, T, WSD, T+WSD). Brown staining denotes positive expression of proteins. Sections are counterstained with hematoxylin (blue) staining. ESR1, PGR, Ki-67 and AR staining is nuclear, while MMP26 and TIMP3 show cytoplasmic localization. Inset shows a negative control with an irrelevant antibody (Anti-Br(d)U). TIMP3 staining was localized to the predecidual cells around the spiral arteries.

Journal: Human Reproduction (Oxford, England)

Article Title: Chronic hyperandrogenemia in the presence and absence of a western-style diet impairs ovarian and uterine structure/function in young adult rhesus monkeys

doi: 10.1093/humrep/dex338

Figure Lengend Snippet: Photomicrographs illustrating immunohistochemical staining for estrogen receptor 1 (ESR1), progesterone receptor (PGR) MMP26, TIMP3, Ki-67 and androgen receptor (AR) in the endometrial functionalis zone of the macaque uterus from representative females in each treatment group (C, T, WSD, T+WSD). Brown staining denotes positive expression of proteins. Sections are counterstained with hematoxylin (blue) staining. ESR1, PGR, Ki-67 and AR staining is nuclear, while MMP26 and TIMP3 show cytoplasmic localization. Inset shows a negative control with an irrelevant antibody (Anti-Br(d)U). TIMP3 staining was localized to the predecidual cells around the spiral arteries.

Article Snippet: Antibodies used were against estrogen receptor 1 (ESR1,ER-ID5; Cat#: MS-354-P, Thermo Fisher Scientific), progesterone receptor (PGR, Cat#: Ms-298-P, 1 μg, Lab Vision/NeoMarkers, Fremont, CA, USA), androgen receptor (AR-F39 (Cat#: MU256, 1/50, BioGenex, Fremont, CA, USA), Ki67 (Cat#: MU370-UC, 1/200, BioGenex), MMP26 (Cat# ab57636; Abcam, Cambridge, MA, USA) and TIMP3 (Cat#:MAB973, R&D Systems, Inc. Minneapolis, MN, USA).

Techniques: Immunohistochemical staining, Staining, Expressing, Negative Control

Expression of ESR1, PGR, MMP26 and TIMP3 mRNAs as detected by qRT-PCR in endometrial biopsies collected from macaques in the mid-luteal phase of the cycle. Significant (P < 0.05) differences between individual treatment groups are denoted by different uppercase letters above columns.

Journal: Human Reproduction (Oxford, England)

Article Title: Chronic hyperandrogenemia in the presence and absence of a western-style diet impairs ovarian and uterine structure/function in young adult rhesus monkeys

doi: 10.1093/humrep/dex338

Figure Lengend Snippet: Expression of ESR1, PGR, MMP26 and TIMP3 mRNAs as detected by qRT-PCR in endometrial biopsies collected from macaques in the mid-luteal phase of the cycle. Significant (P < 0.05) differences between individual treatment groups are denoted by different uppercase letters above columns.

Article Snippet: Antibodies used were against estrogen receptor 1 (ESR1,ER-ID5; Cat#: MS-354-P, Thermo Fisher Scientific), progesterone receptor (PGR, Cat#: Ms-298-P, 1 μg, Lab Vision/NeoMarkers, Fremont, CA, USA), androgen receptor (AR-F39 (Cat#: MU256, 1/50, BioGenex, Fremont, CA, USA), Ki67 (Cat#: MU370-UC, 1/200, BioGenex), MMP26 (Cat# ab57636; Abcam, Cambridge, MA, USA) and TIMP3 (Cat#:MAB973, R&D Systems, Inc. Minneapolis, MN, USA).

Techniques: Expressing, Quantitative RT-PCR

Figure 1. TIMP3 was downregulated in colon cancer tissues. (a) TIMP3 expression at mRNA level was detected in colon cancers and paired normal mucosal tissues. TIMP3 was expressed in normal mucosal tissues but not cancer tissues. (N, normal mucosal tissue and C, colon cancer tissue); (b) Western blot showed lower expression of TIMP3 in colon cancer tissues than in normal mucosa; (c) A pair of the stained tissues from the same patient to show TIMP3 expression (left: normal mucosal tissue, right: colon cancer tissue). TIMP3 expression was obvious in cytoplasm of normal mucosal cell, but was shut off in cancer tissue. (d) The quantitative analysis of the TIMP3 staining in tissue array. TIMP3 expression was much lower in cancer tissues than that in normal control tissues (compared with normal mucosa, *Po0.01).

Journal: Cancer gene therapy

Article Title: Tissue inhibitor of metalloproteinases-3 transfer suppresses malignant behaviors of colorectal cancer cells.

doi: 10.1038/cgt.2012.70

Figure Lengend Snippet: Figure 1. TIMP3 was downregulated in colon cancer tissues. (a) TIMP3 expression at mRNA level was detected in colon cancers and paired normal mucosal tissues. TIMP3 was expressed in normal mucosal tissues but not cancer tissues. (N, normal mucosal tissue and C, colon cancer tissue); (b) Western blot showed lower expression of TIMP3 in colon cancer tissues than in normal mucosa; (c) A pair of the stained tissues from the same patient to show TIMP3 expression (left: normal mucosal tissue, right: colon cancer tissue). TIMP3 expression was obvious in cytoplasm of normal mucosal cell, but was shut off in cancer tissue. (d) The quantitative analysis of the TIMP3 staining in tissue array. TIMP3 expression was much lower in cancer tissues than that in normal control tissues (compared with normal mucosa, *Po0.01).

Article Snippet: The TIMP3 antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Expressing, Western Blot, Staining, Control

Figure 2. Ad-TIMP3 induced cell apoptosis and suppressed cell growth. (a) TIMP3 mRNA expression was gradually upregulated with increased MOI after Ad-TIMP3 infection, whereas TIMP3 was not detectable by RT-PCR in control CT26 cells. The fold change of TIMP3 mRNA expression relative to that of 50 MOI infection was calculated. (b) By Ad-TIMP3 infection, TIMP3 protein was increased at a dose-dependent manner. To show the exogenous TIMP3-induced apoptosis, we detected the PARP cleavage. It showed the PARP cleavage occurred with the intensity of Ad-TIMP3 infection. (c) CT26 cells were transfected by Ad-TIMP3 or Ad-Null at the indicated MOI for 72 h and then subjected to annexin V-FITC assay. Percentage of apoptosis was defined by % of cells that were FITC þ/PI and FITC þ/PI þ. The experiment was performed twice independently; (d) CT26 cells were infected with Ad-TIMP3 or Ad-Null at the indicated MOI for 72 h. Trypan blue exclusion was used to determine cell number (compared with Ad-Null, *Po0.05). (e) Ad-TIMP3 infection suppressed the activity of MMP2 and MMP9 in the culture supernatant. In the gelatin zymography assay, MMP2 and MMP9 activity was suppressed in a dose-dependent manner by Ad-TIMP3.

Journal: Cancer gene therapy

Article Title: Tissue inhibitor of metalloproteinases-3 transfer suppresses malignant behaviors of colorectal cancer cells.

doi: 10.1038/cgt.2012.70

Figure Lengend Snippet: Figure 2. Ad-TIMP3 induced cell apoptosis and suppressed cell growth. (a) TIMP3 mRNA expression was gradually upregulated with increased MOI after Ad-TIMP3 infection, whereas TIMP3 was not detectable by RT-PCR in control CT26 cells. The fold change of TIMP3 mRNA expression relative to that of 50 MOI infection was calculated. (b) By Ad-TIMP3 infection, TIMP3 protein was increased at a dose-dependent manner. To show the exogenous TIMP3-induced apoptosis, we detected the PARP cleavage. It showed the PARP cleavage occurred with the intensity of Ad-TIMP3 infection. (c) CT26 cells were transfected by Ad-TIMP3 or Ad-Null at the indicated MOI for 72 h and then subjected to annexin V-FITC assay. Percentage of apoptosis was defined by % of cells that were FITC þ/PI and FITC þ/PI þ. The experiment was performed twice independently; (d) CT26 cells were infected with Ad-TIMP3 or Ad-Null at the indicated MOI for 72 h. Trypan blue exclusion was used to determine cell number (compared with Ad-Null, *Po0.05). (e) Ad-TIMP3 infection suppressed the activity of MMP2 and MMP9 in the culture supernatant. In the gelatin zymography assay, MMP2 and MMP9 activity was suppressed in a dose-dependent manner by Ad-TIMP3.

Article Snippet: The TIMP3 antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Expressing, Infection, Reverse Transcription Polymerase Chain Reaction, Control, Transfection, Activity Assay, Zymography Assay

Figure 3. Ad-TIMP3 impaired metastasis ability of cancer cells. (a) Adhesion ability of cancer cells was impaired by Ad-TIMP3 infection in a dose-dependent manner. The control virus Ad-Null did not significantly affect the adhesion ability at 50 MOI of infection. Similarly, Ad-TIMP3 decreased the migration (b) and invasion (c) ability of CT26 cells (compared with Ad-Null, *Po0.05). Representative micrographs of the transwell migration (d) and invasion (e) were shown ( 200 magnification).

Journal: Cancer gene therapy

Article Title: Tissue inhibitor of metalloproteinases-3 transfer suppresses malignant behaviors of colorectal cancer cells.

doi: 10.1038/cgt.2012.70

Figure Lengend Snippet: Figure 3. Ad-TIMP3 impaired metastasis ability of cancer cells. (a) Adhesion ability of cancer cells was impaired by Ad-TIMP3 infection in a dose-dependent manner. The control virus Ad-Null did not significantly affect the adhesion ability at 50 MOI of infection. Similarly, Ad-TIMP3 decreased the migration (b) and invasion (c) ability of CT26 cells (compared with Ad-Null, *Po0.05). Representative micrographs of the transwell migration (d) and invasion (e) were shown ( 200 magnification).

Article Snippet: The TIMP3 antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Infection, Control, Virus, Migration

Figure 4. Ad-TIMP3 infection decreased the tumor-formation ability of cancer cells. In the in invo tumor-formation assay, Ad-TIMP3 was used to treat the cancer cells at 25 MOI before the cells were implanted into the right flank of the mice. When the tumors can be touched, they were measured and recorded for the volumes. (a) The tumor growth curve. Ad-TIMP3-treated CT26 cells formed tumors were much smaller than that of the control group. (b) At the end of the observation, by tumor weight, Ad-TIMP3 pretreatment suppressed the tumor-formation ability of CT26 cells. (compared with Ad-Null, *Po0.05; #Po0.01). (c) Tumor growth curve during the Ad-TIMP3 treatment. Ad-TIMP3 significantly delayed the growth of tumors (Ad-TIMP3 compared with Ad-Null, *Po0.01, #Po0.05); (d) Compared with control Ad-Null, the tumor weight in Ad-TIMP3 was much lower than that in control groups (compared with Ad-con, *Po0.01, #Po0.05 ). (e) Metastatic lesions formed in liver. Eighteen mice were randomized into three groups and injected with variously treated CT26 cells (1 105 cells each). Seven days later, mice were killed and the liver metastatic lesions were counted on the sections (H&E staining). The Ad-TIMP3 group has much fewer lesions than other groups.

Journal: Cancer gene therapy

Article Title: Tissue inhibitor of metalloproteinases-3 transfer suppresses malignant behaviors of colorectal cancer cells.

doi: 10.1038/cgt.2012.70

Figure Lengend Snippet: Figure 4. Ad-TIMP3 infection decreased the tumor-formation ability of cancer cells. In the in invo tumor-formation assay, Ad-TIMP3 was used to treat the cancer cells at 25 MOI before the cells were implanted into the right flank of the mice. When the tumors can be touched, they were measured and recorded for the volumes. (a) The tumor growth curve. Ad-TIMP3-treated CT26 cells formed tumors were much smaller than that of the control group. (b) At the end of the observation, by tumor weight, Ad-TIMP3 pretreatment suppressed the tumor-formation ability of CT26 cells. (compared with Ad-Null, *Po0.05; #Po0.01). (c) Tumor growth curve during the Ad-TIMP3 treatment. Ad-TIMP3 significantly delayed the growth of tumors (Ad-TIMP3 compared with Ad-Null, *Po0.01, #Po0.05); (d) Compared with control Ad-Null, the tumor weight in Ad-TIMP3 was much lower than that in control groups (compared with Ad-con, *Po0.01, #Po0.05 ). (e) Metastatic lesions formed in liver. Eighteen mice were randomized into three groups and injected with variously treated CT26 cells (1 105 cells each). Seven days later, mice were killed and the liver metastatic lesions were counted on the sections (H&E staining). The Ad-TIMP3 group has much fewer lesions than other groups.

Article Snippet: The TIMP3 antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Infection, Tube Formation Assay, Control, Injection, Staining

Gastric carcinoma  TIMP3  promoter methylation and protein expression

Journal: Diagnostic Pathology

Article Title: Promoter methylation and expression of TIMP3 gene in gastric cancer

doi: 10.1186/1746-1596-8-110

Figure Lengend Snippet: Gastric carcinoma TIMP3 promoter methylation and protein expression

Article Snippet: TIMP3 antibody and SP kit were purchased from Boster Biological Engineering Co., Ltd. (Dalian).

Techniques: Methylation, Expressing

TIMP3 protein immunohistochemisty (SP 400×): a, normal gastric tissue; b, early gastric cancer; c, advanced gastric cancer; d, transfer of lymph node.

Journal: Diagnostic Pathology

Article Title: Promoter methylation and expression of TIMP3 gene in gastric cancer

doi: 10.1186/1746-1596-8-110

Figure Lengend Snippet: TIMP3 protein immunohistochemisty (SP 400×): a, normal gastric tissue; b, early gastric cancer; c, advanced gastric cancer; d, transfer of lymph node.

Article Snippet: TIMP3 antibody and SP kit were purchased from Boster Biological Engineering Co., Ltd. (Dalian).

Techniques:

Relationship between advanced gastric cancer pathology  TIMP3  methylation and its protein expression level

Journal: Diagnostic Pathology

Article Title: Promoter methylation and expression of TIMP3 gene in gastric cancer

doi: 10.1186/1746-1596-8-110

Figure Lengend Snippet: Relationship between advanced gastric cancer pathology TIMP3 methylation and its protein expression level

Article Snippet: TIMP3 antibody and SP kit were purchased from Boster Biological Engineering Co., Ltd. (Dalian).

Techniques: Methylation, Expressing

T3-induced genes in WERI cells (fold-change ≥ 4, p-value ≤0.01)

Journal:

Article Title: Identification of Novel Retinal Target Genes of Thyroid Hormone in the Human WERI Cells by Expression Microarray Analysis

doi: 10.1016/j.visres.2007.04.023

Figure Lengend Snippet: T3-induced genes in WERI cells (fold-change ≥ 4, p-value ≤0.01)

Article Snippet: Taqman-based qPCR assays were purchased from Applied Biosystems (ABI) and are listed as follows: APOE (Hs00171168_m1), ARR3 (Hs00182888_m1), CRX (Hs00230899_m1), CRYM (Hs00157121_m1), CST11 (Hs00370023_m1), DELGEF (Hs00183730_m1), DPP4 (Hs00175210_m1), GAPDH (Hs99999905_m1), GNB3 (Hs00157740_m1), GNGT1 (Hs00184207_m1), GNGT2 (Hs00258864_m1), GCAP1 (Hs00181172_m1), HEG1 (Hs00419997_m1), HR (Hs00218222_m1), IMPDH1 (Hs00265302_m1), LIPG (Hs00195812_m1), LMOD1 (Hs00201704_m1), OPN1LW/OPN1MW (Hs00241039_m1), PDE6C (Hs00196421_m1), PDE6H (Hs00196432_m1), PYY (Hs00373890_g1), RP1L1 (Hs00698865_m1), RRAD (Hs00188163_m1), SAG (Hs00167021_m1), SALL1 (Hs00231307_m1), TIMP3 (Hs00165949_m1). table ft1 table-wrap mode="anchored" t5 caption a7 Methods Gene Symbol Primer Sequence (5’ to 3’) Cycling Condition Gel analysis GAPDH GAPDH1F CGCTGAGTACGTCGTGGAGTC 95°C 15 s and 64°C 50s(25 cycles) GAPDH1R CACAGTCTTCTGGGTGGCAGT RXRA hRXRα-F CAT CTT TGA CAG GGT GCT GAC 95°C 15 s, 62°C 30s, 72°C 40s (35 cycles) hRXRα-R TGC TCT GGG TAC TTG TGC TTG RXRB hRXRβ-F GAG TAG GAG CCA TCT TTG ATC G hRXRβ-R TAG CAG CAG CTT GGC AAA CCG RXRG hRXRγ-F GGT CGG CTC CAT CTT TGA CAG hRXRγ-R TTG GCA AAC CTG CCT GGC TG L/M opsin CB196 TACCCCGGGGTGCAGTCTTAC 98°C 10 s and 66°C 30 s (30 cycles) CB78 TTGGCAGCAGCAAAGCATGCG SYBR-qPCR M-opsin (OPN1MW) CB7G ACCCCACTCAGCATCATCGT 95°C 15 s and 62°C 40 s (40 cycles) CB79G CCAGCAGAAGCAGAATGCCAGGAC L-opsin (OPN1LW) CB7R ATCCCACTCGCTATCATCAT CB79R CCAGCAGACGCAGTACGCAAAGATC GMPR GMPR-F1 CGTGTTCAGCTAACCCTGGGGAC 95°C 15 s and 65°C 40s (40 cycles) GMPR-R1 ACCATTCAGGAGCAGCCAGAAGC ITM2C ITM2C-F1 AAGCAAGGAGCTAGGACCCCCAG ITM2C-R1 GACTGAGCAGTGACCTTGCCTGC KIAA1755 KIAA1755-F1 TCATTGTGGAAAGACCTGTCGGC KIAA1755-R1 ACCCGAGGGGAGAGCTGTGTATG MARCO MARCO-F1 GGGACAATTTGCGATGACGAGTG MARCO-R1 CCAGCTCCCACTTTGTACAGGGC PAMLM2-AKAP2 PALM2-AKAP2-F1 TGCATTCTGCCGTGTTTATAGGTG PALM2-AKAP2-R1 TGCCACTGACAGACCCTGTTTCC RARI14 RAI14-F1 ACGCTTGCAACTTCCCTTATGGC RAI14-R1 ACTGAGGCCAAGCAGCCTTGTG SPON2 SPON2-F1 CTGCTCTCAGCCTCCTCCTCCTG SPON2-R1 CCCCTGGACGATGAAGGACAATC TFF1 TFF1-F1 TCGACGTCCCTCCAGAAGAGGAG TFF1-R1 GCAGAAGCGTGTCTGAGGTGTCC THEDC1 THEDC1-F1 GTACATTCAAAGGCCTGGCATCG THEDC1-R1 CTTCAGCAAAATGCTTGGGGGTG TP53I3 TP53I3-F1 AGGCAAGATCGTCCTGGAACTGC TP53I3-R1 TAAACGGCTCTGGAGGAAGCACC TRA@ TRA@-F1 CTCGAACCGAACAGCAGTGCTTC TRA@-R1 TCTCTCAGCTGGTACACGGCAGG TU3A TU3A-F1 TGGTGTGAGGACCATGCTGTGAG TU3A-R1 GTTGCAGAAGTGGGGTGGGAATC Open in a separate window Primers used for RT-PCR and SYBR-based qRT-PCR analyses All qPCR analyses were performed using the Applied Biosystems 7500 apparatus and analyzed by the Relative Quantification ddCt method.

Techniques: Membrane, Sequencing, Activity Assay

Validation of microarray data by qRT-PCR analysis

Journal:

Article Title: Identification of Novel Retinal Target Genes of Thyroid Hormone in the Human WERI Cells by Expression Microarray Analysis

doi: 10.1016/j.visres.2007.04.023

Figure Lengend Snippet: Validation of microarray data by qRT-PCR analysis

Article Snippet: Taqman-based qPCR assays were purchased from Applied Biosystems (ABI) and are listed as follows: APOE (Hs00171168_m1), ARR3 (Hs00182888_m1), CRX (Hs00230899_m1), CRYM (Hs00157121_m1), CST11 (Hs00370023_m1), DELGEF (Hs00183730_m1), DPP4 (Hs00175210_m1), GAPDH (Hs99999905_m1), GNB3 (Hs00157740_m1), GNGT1 (Hs00184207_m1), GNGT2 (Hs00258864_m1), GCAP1 (Hs00181172_m1), HEG1 (Hs00419997_m1), HR (Hs00218222_m1), IMPDH1 (Hs00265302_m1), LIPG (Hs00195812_m1), LMOD1 (Hs00201704_m1), OPN1LW/OPN1MW (Hs00241039_m1), PDE6C (Hs00196421_m1), PDE6H (Hs00196432_m1), PYY (Hs00373890_g1), RP1L1 (Hs00698865_m1), RRAD (Hs00188163_m1), SAG (Hs00167021_m1), SALL1 (Hs00231307_m1), TIMP3 (Hs00165949_m1). table ft1 table-wrap mode="anchored" t5 caption a7 Methods Gene Symbol Primer Sequence (5’ to 3’) Cycling Condition Gel analysis GAPDH GAPDH1F CGCTGAGTACGTCGTGGAGTC 95°C 15 s and 64°C 50s(25 cycles) GAPDH1R CACAGTCTTCTGGGTGGCAGT RXRA hRXRα-F CAT CTT TGA CAG GGT GCT GAC 95°C 15 s, 62°C 30s, 72°C 40s (35 cycles) hRXRα-R TGC TCT GGG TAC TTG TGC TTG RXRB hRXRβ-F GAG TAG GAG CCA TCT TTG ATC G hRXRβ-R TAG CAG CAG CTT GGC AAA CCG RXRG hRXRγ-F GGT CGG CTC CAT CTT TGA CAG hRXRγ-R TTG GCA AAC CTG CCT GGC TG L/M opsin CB196 TACCCCGGGGTGCAGTCTTAC 98°C 10 s and 66°C 30 s (30 cycles) CB78 TTGGCAGCAGCAAAGCATGCG SYBR-qPCR M-opsin (OPN1MW) CB7G ACCCCACTCAGCATCATCGT 95°C 15 s and 62°C 40 s (40 cycles) CB79G CCAGCAGAAGCAGAATGCCAGGAC L-opsin (OPN1LW) CB7R ATCCCACTCGCTATCATCAT CB79R CCAGCAGACGCAGTACGCAAAGATC GMPR GMPR-F1 CGTGTTCAGCTAACCCTGGGGAC 95°C 15 s and 65°C 40s (40 cycles) GMPR-R1 ACCATTCAGGAGCAGCCAGAAGC ITM2C ITM2C-F1 AAGCAAGGAGCTAGGACCCCCAG ITM2C-R1 GACTGAGCAGTGACCTTGCCTGC KIAA1755 KIAA1755-F1 TCATTGTGGAAAGACCTGTCGGC KIAA1755-R1 ACCCGAGGGGAGAGCTGTGTATG MARCO MARCO-F1 GGGACAATTTGCGATGACGAGTG MARCO-R1 CCAGCTCCCACTTTGTACAGGGC PAMLM2-AKAP2 PALM2-AKAP2-F1 TGCATTCTGCCGTGTTTATAGGTG PALM2-AKAP2-R1 TGCCACTGACAGACCCTGTTTCC RARI14 RAI14-F1 ACGCTTGCAACTTCCCTTATGGC RAI14-R1 ACTGAGGCCAAGCAGCCTTGTG SPON2 SPON2-F1 CTGCTCTCAGCCTCCTCCTCCTG SPON2-R1 CCCCTGGACGATGAAGGACAATC TFF1 TFF1-F1 TCGACGTCCCTCCAGAAGAGGAG TFF1-R1 GCAGAAGCGTGTCTGAGGTGTCC THEDC1 THEDC1-F1 GTACATTCAAAGGCCTGGCATCG THEDC1-R1 CTTCAGCAAAATGCTTGGGGGTG TP53I3 TP53I3-F1 AGGCAAGATCGTCCTGGAACTGC TP53I3-R1 TAAACGGCTCTGGAGGAAGCACC TRA@ TRA@-F1 CTCGAACCGAACAGCAGTGCTTC TRA@-R1 TCTCTCAGCTGGTACACGGCAGG TU3A TU3A-F1 TGGTGTGAGGACCATGCTGTGAG TU3A-R1 GTTGCAGAAGTGGGGTGGGAATC Open in a separate window Primers used for RT-PCR and SYBR-based qRT-PCR analyses All qPCR analyses were performed using the Applied Biosystems 7500 apparatus and analyzed by the Relative Quantification ddCt method.

Techniques: Biomarker Discovery, Microarray

RNA samples used for microarray analysis mock (Mock) and 100 nM T3 (TH), were subjected to qRT-PCR to measure the expression levels of the 37 target genes identified by microarray analysis. The data for all 37 genes can be found in Table 4. This figure shows the amplification curves of 8 genes: GAPDH (used for normalization), LMOD1 (an up-regulated non-retinal gene), 5 up-regulated retinal genes (OPN1LW/MW, CRX, RP1L1, TIMP3 and GNGT2), and 1 down-regulated retinal gene (GNGT1). Each sample contains three biological replicates and was assayed in duplicate.

Journal:

Article Title: Identification of Novel Retinal Target Genes of Thyroid Hormone in the Human WERI Cells by Expression Microarray Analysis

doi: 10.1016/j.visres.2007.04.023

Figure Lengend Snippet: RNA samples used for microarray analysis mock (Mock) and 100 nM T3 (TH), were subjected to qRT-PCR to measure the expression levels of the 37 target genes identified by microarray analysis. The data for all 37 genes can be found in Table 4. This figure shows the amplification curves of 8 genes: GAPDH (used for normalization), LMOD1 (an up-regulated non-retinal gene), 5 up-regulated retinal genes (OPN1LW/MW, CRX, RP1L1, TIMP3 and GNGT2), and 1 down-regulated retinal gene (GNGT1). Each sample contains three biological replicates and was assayed in duplicate.

Article Snippet: Taqman-based qPCR assays were purchased from Applied Biosystems (ABI) and are listed as follows: APOE (Hs00171168_m1), ARR3 (Hs00182888_m1), CRX (Hs00230899_m1), CRYM (Hs00157121_m1), CST11 (Hs00370023_m1), DELGEF (Hs00183730_m1), DPP4 (Hs00175210_m1), GAPDH (Hs99999905_m1), GNB3 (Hs00157740_m1), GNGT1 (Hs00184207_m1), GNGT2 (Hs00258864_m1), GCAP1 (Hs00181172_m1), HEG1 (Hs00419997_m1), HR (Hs00218222_m1), IMPDH1 (Hs00265302_m1), LIPG (Hs00195812_m1), LMOD1 (Hs00201704_m1), OPN1LW/OPN1MW (Hs00241039_m1), PDE6C (Hs00196421_m1), PDE6H (Hs00196432_m1), PYY (Hs00373890_g1), RP1L1 (Hs00698865_m1), RRAD (Hs00188163_m1), SAG (Hs00167021_m1), SALL1 (Hs00231307_m1), TIMP3 (Hs00165949_m1). table ft1 table-wrap mode="anchored" t5 caption a7 Methods Gene Symbol Primer Sequence (5’ to 3’) Cycling Condition Gel analysis GAPDH GAPDH1F CGCTGAGTACGTCGTGGAGTC 95°C 15 s and 64°C 50s(25 cycles) GAPDH1R CACAGTCTTCTGGGTGGCAGT RXRA hRXRα-F CAT CTT TGA CAG GGT GCT GAC 95°C 15 s, 62°C 30s, 72°C 40s (35 cycles) hRXRα-R TGC TCT GGG TAC TTG TGC TTG RXRB hRXRβ-F GAG TAG GAG CCA TCT TTG ATC G hRXRβ-R TAG CAG CAG CTT GGC AAA CCG RXRG hRXRγ-F GGT CGG CTC CAT CTT TGA CAG hRXRγ-R TTG GCA AAC CTG CCT GGC TG L/M opsin CB196 TACCCCGGGGTGCAGTCTTAC 98°C 10 s and 66°C 30 s (30 cycles) CB78 TTGGCAGCAGCAAAGCATGCG SYBR-qPCR M-opsin (OPN1MW) CB7G ACCCCACTCAGCATCATCGT 95°C 15 s and 62°C 40 s (40 cycles) CB79G CCAGCAGAAGCAGAATGCCAGGAC L-opsin (OPN1LW) CB7R ATCCCACTCGCTATCATCAT CB79R CCAGCAGACGCAGTACGCAAAGATC GMPR GMPR-F1 CGTGTTCAGCTAACCCTGGGGAC 95°C 15 s and 65°C 40s (40 cycles) GMPR-R1 ACCATTCAGGAGCAGCCAGAAGC ITM2C ITM2C-F1 AAGCAAGGAGCTAGGACCCCCAG ITM2C-R1 GACTGAGCAGTGACCTTGCCTGC KIAA1755 KIAA1755-F1 TCATTGTGGAAAGACCTGTCGGC KIAA1755-R1 ACCCGAGGGGAGAGCTGTGTATG MARCO MARCO-F1 GGGACAATTTGCGATGACGAGTG MARCO-R1 CCAGCTCCCACTTTGTACAGGGC PAMLM2-AKAP2 PALM2-AKAP2-F1 TGCATTCTGCCGTGTTTATAGGTG PALM2-AKAP2-R1 TGCCACTGACAGACCCTGTTTCC RARI14 RAI14-F1 ACGCTTGCAACTTCCCTTATGGC RAI14-R1 ACTGAGGCCAAGCAGCCTTGTG SPON2 SPON2-F1 CTGCTCTCAGCCTCCTCCTCCTG SPON2-R1 CCCCTGGACGATGAAGGACAATC TFF1 TFF1-F1 TCGACGTCCCTCCAGAAGAGGAG TFF1-R1 GCAGAAGCGTGTCTGAGGTGTCC THEDC1 THEDC1-F1 GTACATTCAAAGGCCTGGCATCG THEDC1-R1 CTTCAGCAAAATGCTTGGGGGTG TP53I3 TP53I3-F1 AGGCAAGATCGTCCTGGAACTGC TP53I3-R1 TAAACGGCTCTGGAGGAAGCACC TRA@ TRA@-F1 CTCGAACCGAACAGCAGTGCTTC TRA@-R1 TCTCTCAGCTGGTACACGGCAGG TU3A TU3A-F1 TGGTGTGAGGACCATGCTGTGAG TU3A-R1 GTTGCAGAAGTGGGGTGGGAATC Open in a separate window Primers used for RT-PCR and SYBR-based qRT-PCR analyses All qPCR analyses were performed using the Applied Biosystems 7500 apparatus and analyzed by the Relative Quantification ddCt method.

Techniques: Microarray, Quantitative RT-PCR, Expressing, Amplification

( A ) Schematic overview of experimental design. ExM: expansion medium; MDM: minimal differentiation medium. ( B ) Uniform Manifold Approximation and Projection (UMAP) visualization (left panel) and relative proportions (right panel) of subpopulations in endometrial assembloid decidualized in the presence or absence of dasatinib. ( C ) Number of differentially expressed genes (DEGs) in each subpopulation in response to dasatinib pre-treatment. ( D ) Secreted levels of CXCL8 and decidual cell factors in spent medium from assembloids treated with or without dasatinib. Secreted levels in individual assembloids established from four different endometrial assembloids decidualized with or without dasatinib are shown by dotted and solid lines, respectively. Full lists of DEGs and associated GO analysis can be found in and , respectively. Data used in ( D ) are available in . Figure 5—source data 1. Differentially expressed genes for day 4 populations treated with and without dasatinib. Specified pairwise comparisons were generated in Seurat v3 using FindMarkers. Supports . Figure 5—source data 2. GO analysis for day 4 populations treated with and without dasatinib. Figure 5—source data 3. ELISA data. Secreted levels of key senescent (CXCL8) and decidual stromal cell markers (CXCL14, IL-15, TIMP3) (pg/ml) were examined by ELISA in spent medium from assembloids treated with or without dasatinib. Supports .

Journal: eLife

Article Title: Modelling the impact of decidual senescence on embryo implantation in human endometrial assembloids

doi: 10.7554/eLife.69603

Figure Lengend Snippet: ( A ) Schematic overview of experimental design. ExM: expansion medium; MDM: minimal differentiation medium. ( B ) Uniform Manifold Approximation and Projection (UMAP) visualization (left panel) and relative proportions (right panel) of subpopulations in endometrial assembloid decidualized in the presence or absence of dasatinib. ( C ) Number of differentially expressed genes (DEGs) in each subpopulation in response to dasatinib pre-treatment. ( D ) Secreted levels of CXCL8 and decidual cell factors in spent medium from assembloids treated with or without dasatinib. Secreted levels in individual assembloids established from four different endometrial assembloids decidualized with or without dasatinib are shown by dotted and solid lines, respectively. Full lists of DEGs and associated GO analysis can be found in and , respectively. Data used in ( D ) are available in . Figure 5—source data 1. Differentially expressed genes for day 4 populations treated with and without dasatinib. Specified pairwise comparisons were generated in Seurat v3 using FindMarkers. Supports . Figure 5—source data 2. GO analysis for day 4 populations treated with and without dasatinib. Figure 5—source data 3. ELISA data. Secreted levels of key senescent (CXCL8) and decidual stromal cell markers (CXCL14, IL-15, TIMP3) (pg/ml) were examined by ELISA in spent medium from assembloids treated with or without dasatinib. Supports .

Article Snippet: Duoset solid-phase sandwich enzyme-linked immunosorbent assay (ELISA) kits (Bio-Techne, Abingdon, UK) were used for the detection of PRL (DY682), TIMP3 (DY973), IL-8 (DY208), IL-15 (DY247), CXCL14 (DY866), and HCG (DY9034).

Techniques: Generated, Enzyme-linked Immunosorbent Assay