Journal: American Journal of Physiology - Renal Physiology

Article Title: SGLT2 inhibitor empagliflozin reduces renal growth and albuminuria in proportion to hyperglycemia and prevents glomerular hyperfiltration in diabetic Akita mice

doi: 10.1152/ajprenal.00520.2013

Figure Lengend Snippet: Real-time PCR primers used

Article Snippet: Each experiment was performed in triplicate. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Target Forward Reverse SGLT1 Mm00451203_m1 (Applied Biosystems) SGLT2 Mm00453831_m1 (Applied Biosystems) GLUT1 AACATGGAACCACCGCTACG GTGGTGAGTGTGGTGGATGG GLUT2 ATCGCCCTCTGCTTCCAGTAC GAACACGTAAGGCCCAAGGA PEPCK Mm01247058_m1 (Applied Biosystems) NFkB Mm00476361_m1 (Applied Biosystems) CCL2 Mm00441242-m1 (Applied Biosystems) CCL5 Mm01302428-m1 (Applied Biosystems) CD14 Mm00438094_g1 (Applied Biosystems) TIMP2 Mm00441825_m1 (Applied Biosystems) IL6 Mm00446190-m1 (Applied Biosystems) TGF-β Mm01178820-m1 (Applied Biosystems) NOX4 Mm00479246_m1 (Applied Biosystems) NOX2 Mm01287743_m1 (Applied Biosystems) Open in a separate window Real-time PCR primers used Determination of adipocyte size.

Techniques: Real-time Polymerase Chain Reaction

Journal: American Journal of Physiology - Renal Physiology

Article Title: SGLT2 inhibitor empagliflozin reduces renal growth and albuminuria in proportion to hyperglycemia and prevents glomerular hyperfiltration in diabetic Akita mice

doi: 10.1152/ajprenal.00520.2013

Figure Lengend Snippet: Empagliflozin attenuated diabetes-induced rise in renal expression of markers of kidney growth and inflammation. Empagliflozin (300 mg/kg of diet) or repelleted diet (vehicle) were given to Akita/+ and WT mice and kidneys harvested after 15 wk. Depicted are results for renal nuclear expression of p27 and p21 and renal cytosolic expression of HO-1 (A), and renal mRNA expression of NFkB, CCL2, CD14, TIMP2, and IL6 (B). *P < 0.05 vs. vehicle treatment in same genotype; #P < 0.05 vs. WT. ANOVA and unpaired Student's t-test and linear regression analysis. Linear regression lines were included when statistical significance was achieved. n = 10–13 per group.

Article Snippet: Each experiment was performed in triplicate. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Target Forward Reverse SGLT1 Mm00451203_m1 (Applied Biosystems) SGLT2 Mm00453831_m1 (Applied Biosystems) GLUT1 AACATGGAACCACCGCTACG GTGGTGAGTGTGGTGGATGG GLUT2 ATCGCCCTCTGCTTCCAGTAC GAACACGTAAGGCCCAAGGA PEPCK Mm01247058_m1 (Applied Biosystems) NFkB Mm00476361_m1 (Applied Biosystems) CCL2 Mm00441242-m1 (Applied Biosystems) CCL5 Mm01302428-m1 (Applied Biosystems) CD14 Mm00438094_g1 (Applied Biosystems) TIMP2 Mm00441825_m1 (Applied Biosystems) IL6 Mm00446190-m1 (Applied Biosystems) TGF-β Mm01178820-m1 (Applied Biosystems) NOX4 Mm00479246_m1 (Applied Biosystems) NOX2 Mm01287743_m1 (Applied Biosystems) Open in a separate window Real-time PCR primers used Determination of adipocyte size.

Techniques: Expressing

Journal: Oncotarget

Article Title: TIMP-1 and CD82, a promising combined evaluation marker for PDAC

doi: 10.18632/oncotarget.14133

Figure Lengend Snippet: a . Culture system model of 293A cells and PANC-1 cells. b . The culture system was effective. (I) 293A cells were transfected with peGFP-N2 or pTIMP-1–eGFP. Cell lysates were immunoblotted with anti-GFP and anti–α-tubulin mAbs. (II) ELISA of TIMP-1 in 293A culture supernatant. TIMP-1 level in culture supernatant from 293A cells transfected with pTIMP-1-eGFP was almost twice as much as it from 293A cells transfected with eGFP. (III) PANC-1 cells were treated with culture supernatant from eGFP/eGFP-TIMP-1 transfected 293A cells. Outside-in GFP was detectable in PANC-1 cells. Cell lysates were immunoblotted with anti-GFP and anti–α-tubulin mAbs. Endogenous CD82 could be immunoprecipitated by outside-in TIMP-1 (eGFP-tagged) in PANC-1 (as arrowhead pointed at). c . TIMP-1–eGFP membrane–cytoplasm translocation in PANC-1 cells. PANC-1 cells were cultured with culture supernatant of 293A cells transfected with peGFP-N2 or pTIMP-1–eGFP. PANC-1 cells were immunostained with mouse anti-GFP mAb and counterstained with DAPI. d . CD82 mediated TIMP-1–eGFP membrane–cytoplasm translocation in PANC-1 cells. PANC-1 cells which were transfected with siNC (100 nM) or siCD82 (100 nM) for 48h were treated with culture supernatant of 293A cells transfected with peGFP-N2 or pTIMP-1–eGFP. PANC-1 cells were immunostained with mouse anti-GFP mAb and counterstained with DAPI. Scale bar = 20μm. CD82 deletion was confirmed by western blotting. e . CD82-eYFP fusion protein overexpression by pCD82-eYFP transfection. 293A cells were transfected with peYFP-N2 or pCD82-eYFP for 24 h. Cell lysates (using 1% Triton X-100) were immunoblotted with mouse anti-CD82 and anti–α-tubulin mAbs. Images shown are representative of eYFP and CD82-eYFP distribution in live PANC-1 cells. Scale bar = 20μm. f . TIMP-1 protein but not TIMP-2 triggers CD82 leaving from cytomembrane into cytoplasm. Images shown are representative of intense foci of CD82-eYFP fluorescence in the 0 th , 3 th , 15 th minute since TIMP-1 or TIMP-2 protein (100 ng/ml) addition in live PANC-1 cells. The scatter diagram quantified the images in the right by calculating outside-in spots (less than 0.5μm, reflecting CD82) in PANC-1 cytoplasm using Imaris8.0.

Article Snippet: Recombinant human TIMP-1 (Cys 24-Ala 207), TIMP-2 (Cys 27-Pro 220) and CD82-LEL (Gly 111-Leu 228) were procured from Sino Biological, Inc. (Beijing, China).

Techniques: Transfection, Enzyme-linked Immunosorbent Assay, Immunoprecipitation, Translocation Assay, Cell Culture, Western Blot, Over Expression, Fluorescence

Journal: Oncotarget

Article Title: TIMP-1 and CD82, a promising combined evaluation marker for PDAC

doi: 10.18632/oncotarget.14133

Figure Lengend Snippet: a . Migration inhibitory effect of cyclopamine and TIMP-1 in PANC-1 cells. Cells were treated with cyclopamine (10 μM) or TIMP-1 (50, 100 ng/mL) for 24 h. b . Mild CD82 deletion weakened TIMP-1 inhibition of PANC-1 cell migration. Cells were transfected with siNC (20 nM) or two independent siRNAs (20 nM) targeting CD82 for 48h. Cells were then treated with TIMP-1 (100 ng/mL) for 6 h. Scale bar = 60μm. c . TIMP-2 had no inhibitory effect on PANC-1 cell migration. Cells were treated with TIMP-2 or cyclopamine (10 μM) for 24 h. d . DN–TIMP-1 significantly weakened TIMP-1 inhibition of PANC-1 cell migration. Cells were treated with TIMP-1 (100 ng/mL) or DN–TIMP-1 (100 ng/mL) for 18 h. Error bars represent SD . * p < 0.05; ** p <0.01; *** p <0.001; ns denotes no statistical significance.

Article Snippet: Recombinant human TIMP-1 (Cys 24-Ala 207), TIMP-2 (Cys 27-Pro 220) and CD82-LEL (Gly 111-Leu 228) were procured from Sino Biological, Inc. (Beijing, China).

Techniques: Migration, Inhibition, Transfection