tdp-43-wt Search Results



93
Addgene inc entry vector pdonr tdp 43 yfp
Entry Vector Pdonr Tdp 43 Yfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tdp-43-wt/pDONR+TDP43+WT+YFP+(Plasmid+%2327470)/pmc06502655-76-2-6
Average 93 stars, based on 1 article reviews
entry vector pdonr tdp 43 yfp - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Addgene inc template plasmid
Template Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tdp-43-wt/pDuet+TDP43+WT+(Plasmid+%2327462)/pmc11447847-96-21-23
Average 93 stars, based on 1 article reviews
template plasmid - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

92
Addgene inc addgene plasmid
Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tdp-43-wt/pRS416Gal+TDP43+WT+YFP+(Plasmid+%2327447)/pmc12105045-6-11-11
Average 92 stars, based on 1 article reviews
addgene plasmid - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
Addgene inc human wt tdp43
A-B. The coincubation of eGFP- <t>TDP43</t> with LTRIII-6FAM slows down the aggregation of the protein as measured by dynamic light scattering and turbidity at 395 nm. 50 µM eGFP-TDP43 was co-incubated with 10 µM G4 in 40 mM HEPES pH 7.5, 300 mM NaCl, 1 mM MgCl2, 10% glycerol, 5 mM DTT, for 8.5 h at RT and allowed to aggregate. eGFP-TDP43 protein aggregates and dimer, as separated by SEC. Each time point has three technical and three independent replicates. Error bars indicate standard error. A. Change in turbidity at OD395 over time. B. turbidity of the samples at 0, 300, 500, and 1000 minutes are included to show eGFP- TDP43 aggregate falling out of solution. One-way ANOVA with Tukey’s comparison test were done where applicable. **p = 0.000001, *p = 0.00703. C-E. The treatment of TDP43-DsRED expressing yeast with nucleic acids results in an increase in the percent of cells tolerating and expressing the TDP43- DsRED. These are the normalized percent of yeast cells as quantified using a cell sorter to sort cells by DsRED intensity and DRAQ7 intensity. C. TDP43 and disease point mutants have diminished vitality when expressing TDP43-DsRED, which is rescued by the addition of 10 µM G4. Overexpression of SIS1 and deletion of DBR1 in yeast do not increase the levels of TDP43 in cells. Inset displays the gating and classification for all samples for 10 µM LTRIII-6FAM and TDP43-DsRED expressing yeast after 32 h of growth. D. A time course of the normalized % cells tolerating and expressing TDP43-DsRED co- incubated with 10 µM LTRIII-6FAM. E. A dosage curve of the normalized percent cells tolerating and expressing TDP43-DsRED with LTRIII-6FAM after 32 h. 100,000 cells/replicate used for all cytometry.
Human Wt Tdp43, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tdp-43-wt/pRS416+Gal+TDP43+WT+(Plasmid+%2327458)/bio_rxiv__2024__04__30__591873-97-0-3
Average 90 stars, based on 1 article reviews
human wt tdp43 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Addgene inc petrucelli lab na plvx puro tdp43 wt addgene
A-B. The coincubation of eGFP- <t>TDP43</t> with LTRIII-6FAM slows down the aggregation of the protein as measured by dynamic light scattering and turbidity at 395 nm. 50 µM eGFP-TDP43 was co-incubated with 10 µM G4 in 40 mM HEPES pH 7.5, 300 mM NaCl, 1 mM MgCl2, 10% glycerol, 5 mM DTT, for 8.5 h at RT and allowed to aggregate. eGFP-TDP43 protein aggregates and dimer, as separated by SEC. Each time point has three technical and three independent replicates. Error bars indicate standard error. A. Change in turbidity at OD395 over time. B. turbidity of the samples at 0, 300, 500, and 1000 minutes are included to show eGFP- TDP43 aggregate falling out of solution. One-way ANOVA with Tukey’s comparison test were done where applicable. **p = 0.000001, *p = 0.00703. C-E. The treatment of TDP43-DsRED expressing yeast with nucleic acids results in an increase in the percent of cells tolerating and expressing the TDP43- DsRED. These are the normalized percent of yeast cells as quantified using a cell sorter to sort cells by DsRED intensity and DRAQ7 intensity. C. TDP43 and disease point mutants have diminished vitality when expressing TDP43-DsRED, which is rescued by the addition of 10 µM G4. Overexpression of SIS1 and deletion of DBR1 in yeast do not increase the levels of TDP43 in cells. Inset displays the gating and classification for all samples for 10 µM LTRIII-6FAM and TDP43-DsRED expressing yeast after 32 h of growth. D. A time course of the normalized % cells tolerating and expressing TDP43-DsRED co- incubated with 10 µM LTRIII-6FAM. E. A dosage curve of the normalized percent cells tolerating and expressing TDP43-DsRED with LTRIII-6FAM after 32 h. 100,000 cells/replicate used for all cytometry.
Petrucelli Lab Na Plvx Puro Tdp43 Wt Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tdp-43-wt/pLVX-Puro-TDP-43-WT+(Plasmid+%23133753)/pm36917977-241-17-23
Average 93 stars, based on 1 article reviews
petrucelli lab na plvx puro tdp43 wt addgene - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Addgene inc tdp 43
(A) Position of the helix region in the low complexity domain (LCD) of the full-length ANXA11 or <t>TDP-43.</t> (B,C) Complex structures of UBQLN2 STI1 domain and ANXA11 LCD or TDP-43 LCD generated by AlphaFold, shows the helix in red or green may occupy the same binding pocket on UBQLN2 STI1-I domain. (D) Schematic representation of three modes of UBQLN2 binding governed by competitive interactions among the scaffold TRIM32, UBQLN2, and client proteins ANXA11 or TDP-43 within TRIM32–UBQLN2 condensates. (a) Both binding sites of the UBQLN2 dimer interact with TRIM32, anchoring UBQLN2 within condensates. (b) Client proteins ANXA11 or TDP-43 competitively occupy the same binding site on UBQLN2. (c) Both binding sites of the UBQLN2 dimer are occupied by ANXA11 or TDP-43, allowing UBQLN2–client complexes to diffuse into or out of condensates. (E) Left: fluorescence intensity recovery of ANXA11 (red) in the TRIM32-p62 or TRIM32-UBQLN2-p62 or TRIM32-UBQLN2 (P506S)-p62 condensate formed during the TRIM32 auto-ubiquitination reaction in vitro. Right: Quantification of fluorescence intensity recovery of photobleached ANXA11 in three kinds of condensates. n = 3. Data are presented as mean ± s.e.m. Bar=2 μm. (F) Left: fluorescence intensity recovery of TDP-43 (red) in the TRIM32-p62 or TRIM32-UBQLN2-p62 or TRIM32-UBQLN2 (P506S)-p62 condensate. Right: Quantification of fluorescence intensity recovery of photobleached TDP-43 in three kinds of condensates. n = 3. Data are presented as mean ± s.e.m. Bar=2 μm. (G) Left: Representative images of Amylo-Glo, an amyloid cross-β-sheet binding dye (white) staining at the indicated times, showing strong co-localization with TDP-43 (red) in TRIM32 condensates formed during the TRIM32 auto-ubiquitination reaction in vitro with addition of UBQLN2 (purple) and p62 (green). Right: Quantification of the ratio of Amylo-Glo positive TDP-43 condensates among UBQLN2-p62-TDP-43 colocalized condensates. Number of puncta are quantified from three independent experiments. Data are presented as mean ± s.e.m. p values were determined by one-way analysis of variance (ANOVA). p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), p < 0.0001 (****); ns, not significant.
Tdp 43, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tdp-43-wt/pHBS834+H14-SUMO-TDP43+WT-TEV-mCherry+(Plasmid+%23133320)/bio_rxiv__64898__2026__02__11__705390-208-26-27
Average 93 stars, based on 1 article reviews
tdp 43 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
Addgene inc phbs1501 ibb gfp mcherry3e bfp tdp43
(A) Position of the helix region in the low complexity domain (LCD) of the full-length ANXA11 or <t>TDP-43.</t> (B,C) Complex structures of UBQLN2 STI1 domain and ANXA11 LCD or TDP-43 LCD generated by AlphaFold, shows the helix in red or green may occupy the same binding pocket on UBQLN2 STI1-I domain. (D) Schematic representation of three modes of UBQLN2 binding governed by competitive interactions among the scaffold TRIM32, UBQLN2, and client proteins ANXA11 or TDP-43 within TRIM32–UBQLN2 condensates. (a) Both binding sites of the UBQLN2 dimer interact with TRIM32, anchoring UBQLN2 within condensates. (b) Client proteins ANXA11 or TDP-43 competitively occupy the same binding site on UBQLN2. (c) Both binding sites of the UBQLN2 dimer are occupied by ANXA11 or TDP-43, allowing UBQLN2–client complexes to diffuse into or out of condensates. (E) Left: fluorescence intensity recovery of ANXA11 (red) in the TRIM32-p62 or TRIM32-UBQLN2-p62 or TRIM32-UBQLN2 (P506S)-p62 condensate formed during the TRIM32 auto-ubiquitination reaction in vitro. Right: Quantification of fluorescence intensity recovery of photobleached ANXA11 in three kinds of condensates. n = 3. Data are presented as mean ± s.e.m. Bar=2 μm. (F) Left: fluorescence intensity recovery of TDP-43 (red) in the TRIM32-p62 or TRIM32-UBQLN2-p62 or TRIM32-UBQLN2 (P506S)-p62 condensate. Right: Quantification of fluorescence intensity recovery of photobleached TDP-43 in three kinds of condensates. n = 3. Data are presented as mean ± s.e.m. Bar=2 μm. (G) Left: Representative images of Amylo-Glo, an amyloid cross-β-sheet binding dye (white) staining at the indicated times, showing strong co-localization with TDP-43 (red) in TRIM32 condensates formed during the TRIM32 auto-ubiquitination reaction in vitro with addition of UBQLN2 (purple) and p62 (green). Right: Quantification of the ratio of Amylo-Glo positive TDP-43 condensates among UBQLN2-p62-TDP-43 colocalized condensates. Number of puncta are quantified from three independent experiments. Data are presented as mean ± s.e.m. p values were determined by one-way analysis of variance (ANOVA). p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), p < 0.0001 (****); ns, not significant.
Phbs1501 Ibb Gfp Mcherry3e Bfp Tdp43, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tdp-43-wt/pHBS1503+%5BIBB-GFP-mCherry3E%5D-%5BBFP-TDP43+WT%5D+(Plasmid+%23133327)/pmc07842676-38-202-205
Average 90 stars, based on 1 article reviews
phbs1501 ibb gfp mcherry3e bfp tdp43 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH aav hsyn tdp-43 wt-myc
(A) Position of the helix region in the low complexity domain (LCD) of the full-length ANXA11 or <t>TDP-43.</t> (B,C) Complex structures of UBQLN2 STI1 domain and ANXA11 LCD or TDP-43 LCD generated by AlphaFold, shows the helix in red or green may occupy the same binding pocket on UBQLN2 STI1-I domain. (D) Schematic representation of three modes of UBQLN2 binding governed by competitive interactions among the scaffold TRIM32, UBQLN2, and client proteins ANXA11 or TDP-43 within TRIM32–UBQLN2 condensates. (a) Both binding sites of the UBQLN2 dimer interact with TRIM32, anchoring UBQLN2 within condensates. (b) Client proteins ANXA11 or TDP-43 competitively occupy the same binding site on UBQLN2. (c) Both binding sites of the UBQLN2 dimer are occupied by ANXA11 or TDP-43, allowing UBQLN2–client complexes to diffuse into or out of condensates. (E) Left: fluorescence intensity recovery of ANXA11 (red) in the TRIM32-p62 or TRIM32-UBQLN2-p62 or TRIM32-UBQLN2 (P506S)-p62 condensate formed during the TRIM32 auto-ubiquitination reaction in vitro. Right: Quantification of fluorescence intensity recovery of photobleached ANXA11 in three kinds of condensates. n = 3. Data are presented as mean ± s.e.m. Bar=2 μm. (F) Left: fluorescence intensity recovery of TDP-43 (red) in the TRIM32-p62 or TRIM32-UBQLN2-p62 or TRIM32-UBQLN2 (P506S)-p62 condensate. Right: Quantification of fluorescence intensity recovery of photobleached TDP-43 in three kinds of condensates. n = 3. Data are presented as mean ± s.e.m. Bar=2 μm. (G) Left: Representative images of Amylo-Glo, an amyloid cross-β-sheet binding dye (white) staining at the indicated times, showing strong co-localization with TDP-43 (red) in TRIM32 condensates formed during the TRIM32 auto-ubiquitination reaction in vitro with addition of UBQLN2 (purple) and p62 (green). Right: Quantification of the ratio of Amylo-Glo positive TDP-43 condensates among UBQLN2-p62-TDP-43 colocalized condensates. Number of puncta are quantified from three independent experiments. Data are presented as mean ± s.e.m. p values were determined by one-way analysis of variance (ANOVA). p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), p < 0.0001 (****); ns, not significant.
Aav Hsyn Tdp 43 Wt Myc, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tdp-43-wt/aav+hsyn+tdp+43+wt+myc/pmc09601198-53-6-17
Average 90 stars, based on 1 article reviews
aav hsyn tdp-43 wt-myc - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier


N/A
Standard format: Plasmid sent in bacteria as agar stab
  Buy from Supplier


Image Search Results


A-B. The coincubation of eGFP- TDP43 with LTRIII-6FAM slows down the aggregation of the protein as measured by dynamic light scattering and turbidity at 395 nm. 50 µM eGFP-TDP43 was co-incubated with 10 µM G4 in 40 mM HEPES pH 7.5, 300 mM NaCl, 1 mM MgCl2, 10% glycerol, 5 mM DTT, for 8.5 h at RT and allowed to aggregate. eGFP-TDP43 protein aggregates and dimer, as separated by SEC. Each time point has three technical and three independent replicates. Error bars indicate standard error. A. Change in turbidity at OD395 over time. B. turbidity of the samples at 0, 300, 500, and 1000 minutes are included to show eGFP- TDP43 aggregate falling out of solution. One-way ANOVA with Tukey’s comparison test were done where applicable. **p = 0.000001, *p = 0.00703. C-E. The treatment of TDP43-DsRED expressing yeast with nucleic acids results in an increase in the percent of cells tolerating and expressing the TDP43- DsRED. These are the normalized percent of yeast cells as quantified using a cell sorter to sort cells by DsRED intensity and DRAQ7 intensity. C. TDP43 and disease point mutants have diminished vitality when expressing TDP43-DsRED, which is rescued by the addition of 10 µM G4. Overexpression of SIS1 and deletion of DBR1 in yeast do not increase the levels of TDP43 in cells. Inset displays the gating and classification for all samples for 10 µM LTRIII-6FAM and TDP43-DsRED expressing yeast after 32 h of growth. D. A time course of the normalized % cells tolerating and expressing TDP43-DsRED co- incubated with 10 µM LTRIII-6FAM. E. A dosage curve of the normalized percent cells tolerating and expressing TDP43-DsRED with LTRIII-6FAM after 32 h. 100,000 cells/replicate used for all cytometry.

Journal: bioRxiv

Article Title: Manipulating TDP43 Aggregation via RNA G-quadruplexes

doi: 10.1101/2024.04.30.591873

Figure Lengend Snippet: A-B. The coincubation of eGFP- TDP43 with LTRIII-6FAM slows down the aggregation of the protein as measured by dynamic light scattering and turbidity at 395 nm. 50 µM eGFP-TDP43 was co-incubated with 10 µM G4 in 40 mM HEPES pH 7.5, 300 mM NaCl, 1 mM MgCl2, 10% glycerol, 5 mM DTT, for 8.5 h at RT and allowed to aggregate. eGFP-TDP43 protein aggregates and dimer, as separated by SEC. Each time point has three technical and three independent replicates. Error bars indicate standard error. A. Change in turbidity at OD395 over time. B. turbidity of the samples at 0, 300, 500, and 1000 minutes are included to show eGFP- TDP43 aggregate falling out of solution. One-way ANOVA with Tukey’s comparison test were done where applicable. **p = 0.000001, *p = 0.00703. C-E. The treatment of TDP43-DsRED expressing yeast with nucleic acids results in an increase in the percent of cells tolerating and expressing the TDP43- DsRED. These are the normalized percent of yeast cells as quantified using a cell sorter to sort cells by DsRED intensity and DRAQ7 intensity. C. TDP43 and disease point mutants have diminished vitality when expressing TDP43-DsRED, which is rescued by the addition of 10 µM G4. Overexpression of SIS1 and deletion of DBR1 in yeast do not increase the levels of TDP43 in cells. Inset displays the gating and classification for all samples for 10 µM LTRIII-6FAM and TDP43-DsRED expressing yeast after 32 h of growth. D. A time course of the normalized % cells tolerating and expressing TDP43-DsRED co- incubated with 10 µM LTRIII-6FAM. E. A dosage curve of the normalized percent cells tolerating and expressing TDP43-DsRED with LTRIII-6FAM after 32 h. 100,000 cells/replicate used for all cytometry.

Article Snippet: Human WT TDP43 (AddGene #27458), and RRM mut (5F → L) (AddGene #84914) open reading frames (ORFs) were cloned into the LIC vector pET HisX6 eGFP TEV cloning vector from AddGene (AddGene #29663) using QB Berkley LIC protocol with primers designed using the tool from QB3 MacroLab (Fwd: 5’ TTTAAGAAGGAGATATAGTTCGTGAGCAAGGGCGAGGAG 3’; Rv: 5’ GGATTGGAAGTAGAGGTTCTCCATTCCCCAGCCAGAAGA 3’).

Techniques: Incubation, Comparison, Expressing, Over Expression, Cytometry

Size exclusion chromatography was used to separate the aggregate eGFP- TDP43 and the dimeric eGFP-TDP43 in 40 mM HEPES pH = 7.5, 300 mM NaCl, 1 mM MgCl2, 10% glycerol, in triplicate with BioRad sizing standards.

Journal: bioRxiv

Article Title: Manipulating TDP43 Aggregation via RNA G-quadruplexes

doi: 10.1101/2024.04.30.591873

Figure Lengend Snippet: Size exclusion chromatography was used to separate the aggregate eGFP- TDP43 and the dimeric eGFP-TDP43 in 40 mM HEPES pH = 7.5, 300 mM NaCl, 1 mM MgCl2, 10% glycerol, in triplicate with BioRad sizing standards.

Article Snippet: Human WT TDP43 (AddGene #27458), and RRM mut (5F → L) (AddGene #84914) open reading frames (ORFs) were cloned into the LIC vector pET HisX6 eGFP TEV cloning vector from AddGene (AddGene #29663) using QB Berkley LIC protocol with primers designed using the tool from QB3 MacroLab (Fwd: 5’ TTTAAGAAGGAGATATAGTTCGTGAGCAAGGGCGAGGAG 3’; Rv: 5’ GGATTGGAAGTAGAGGTTCTCCATTCCCCAGCCAGAAGA 3’).

Techniques: Size-exclusion Chromatography

As eGFP-TDP43 aggregate continues to aggregate over time, it begins to precipitate out of solution. Photos of the samples at times 0, 300, 500, and 1000 minutes are included to show eGFP-TDP43 aggregate falling out of solution.

Journal: bioRxiv

Article Title: Manipulating TDP43 Aggregation via RNA G-quadruplexes

doi: 10.1101/2024.04.30.591873

Figure Lengend Snippet: As eGFP-TDP43 aggregate continues to aggregate over time, it begins to precipitate out of solution. Photos of the samples at times 0, 300, 500, and 1000 minutes are included to show eGFP-TDP43 aggregate falling out of solution.

Article Snippet: Human WT TDP43 (AddGene #27458), and RRM mut (5F → L) (AddGene #84914) open reading frames (ORFs) were cloned into the LIC vector pET HisX6 eGFP TEV cloning vector from AddGene (AddGene #29663) using QB Berkley LIC protocol with primers designed using the tool from QB3 MacroLab (Fwd: 5’ TTTAAGAAGGAGATATAGTTCGTGAGCAAGGGCGAGGAG 3’; Rv: 5’ GGATTGGAAGTAGAGGTTCTCCATTCCCCAGCCAGAAGA 3’).

Techniques:

Spotting assay demonstrates the recovery of growth in the cytotoxic TDP43- DsRED expressing yeasts by the over expression of SIS1, and the deletion of DBR1.

Journal: bioRxiv

Article Title: Manipulating TDP43 Aggregation via RNA G-quadruplexes

doi: 10.1101/2024.04.30.591873

Figure Lengend Snippet: Spotting assay demonstrates the recovery of growth in the cytotoxic TDP43- DsRED expressing yeasts by the over expression of SIS1, and the deletion of DBR1.

Article Snippet: Human WT TDP43 (AddGene #27458), and RRM mut (5F → L) (AddGene #84914) open reading frames (ORFs) were cloned into the LIC vector pET HisX6 eGFP TEV cloning vector from AddGene (AddGene #29663) using QB Berkley LIC protocol with primers designed using the tool from QB3 MacroLab (Fwd: 5’ TTTAAGAAGGAGATATAGTTCGTGAGCAAGGGCGAGGAG 3’; Rv: 5’ GGATTGGAAGTAGAGGTTCTCCATTCCCCAGCCAGAAGA 3’).

Techniques: Spotting Assay, Expressing, Over Expression

The fluorescent protein fused to TDP43 can be on the N- or C-terminal end, and more than one type of fluorescent protein can be used and still retain a cytotoxic phenotype in yeast.

Journal: bioRxiv

Article Title: Manipulating TDP43 Aggregation via RNA G-quadruplexes

doi: 10.1101/2024.04.30.591873

Figure Lengend Snippet: The fluorescent protein fused to TDP43 can be on the N- or C-terminal end, and more than one type of fluorescent protein can be used and still retain a cytotoxic phenotype in yeast.

Article Snippet: Human WT TDP43 (AddGene #27458), and RRM mut (5F → L) (AddGene #84914) open reading frames (ORFs) were cloned into the LIC vector pET HisX6 eGFP TEV cloning vector from AddGene (AddGene #29663) using QB Berkley LIC protocol with primers designed using the tool from QB3 MacroLab (Fwd: 5’ TTTAAGAAGGAGATATAGTTCGTGAGCAAGGGCGAGGAG 3’; Rv: 5’ GGATTGGAAGTAGAGGTTCTCCATTCCCCAGCCAGAAGA 3’).

Techniques:

A. ccdB-DsRED expressing yeast, with no added rG4s or fluorophore dyes confocal microscopy. B. ccdB-DsRED yeast with 10 µM fluorescein. c. ccdB-DsRED yeast with 10 µM LTRIII-6FAM. D. TDP43-DsRED expressing yeast, with no added rG4s or fluorophore dyes confocal microscopy. E. TDP43-DsRED yeast with 10 µM fluorescein. F. TDP43-DsRED yeast with 10 µM LTRIII-6FAM.

Journal: bioRxiv

Article Title: Manipulating TDP43 Aggregation via RNA G-quadruplexes

doi: 10.1101/2024.04.30.591873

Figure Lengend Snippet: A. ccdB-DsRED expressing yeast, with no added rG4s or fluorophore dyes confocal microscopy. B. ccdB-DsRED yeast with 10 µM fluorescein. c. ccdB-DsRED yeast with 10 µM LTRIII-6FAM. D. TDP43-DsRED expressing yeast, with no added rG4s or fluorophore dyes confocal microscopy. E. TDP43-DsRED yeast with 10 µM fluorescein. F. TDP43-DsRED yeast with 10 µM LTRIII-6FAM.

Article Snippet: Human WT TDP43 (AddGene #27458), and RRM mut (5F → L) (AddGene #84914) open reading frames (ORFs) were cloned into the LIC vector pET HisX6 eGFP TEV cloning vector from AddGene (AddGene #29663) using QB Berkley LIC protocol with primers designed using the tool from QB3 MacroLab (Fwd: 5’ TTTAAGAAGGAGATATAGTTCGTGAGCAAGGGCGAGGAG 3’; Rv: 5’ GGATTGGAAGTAGAGGTTCTCCATTCCCCAGCCAGAAGA 3’).

Techniques: Expressing, Confocal Microscopy

Oxidative stress induction in over-expressed, stable TDP43 in HEK293T293T cells . A. Immunostaining shows colocalization of stable overexpressing HEK293T- TDP43-YFP (green) and anti-TDP43 Alexa-fluor 647 (red), Hoechst nuclear label (blue), 40x, scale bar = 20 µm. B. Empty vector pcDNA-YFP transfected into HEK293T cells and addition of NaAsO2 showed no aggregation of off target fluorescence. C. Dose-dependent live confocal imaging was taken over 8 h. When treated with 50 µM NaAsO2, nuclear and cytoplasmic TDP43 inclusions are observed in the HEK293T-TDP43-YFP model within 4 h. NaAsO2 concentration was dropped to 15 µM to prolong disease-like aggregation state.

Journal: bioRxiv

Article Title: Manipulating TDP43 Aggregation via RNA G-quadruplexes

doi: 10.1101/2024.04.30.591873

Figure Lengend Snippet: Oxidative stress induction in over-expressed, stable TDP43 in HEK293T293T cells . A. Immunostaining shows colocalization of stable overexpressing HEK293T- TDP43-YFP (green) and anti-TDP43 Alexa-fluor 647 (red), Hoechst nuclear label (blue), 40x, scale bar = 20 µm. B. Empty vector pcDNA-YFP transfected into HEK293T cells and addition of NaAsO2 showed no aggregation of off target fluorescence. C. Dose-dependent live confocal imaging was taken over 8 h. When treated with 50 µM NaAsO2, nuclear and cytoplasmic TDP43 inclusions are observed in the HEK293T-TDP43-YFP model within 4 h. NaAsO2 concentration was dropped to 15 µM to prolong disease-like aggregation state.

Article Snippet: Human WT TDP43 (AddGene #27458), and RRM mut (5F → L) (AddGene #84914) open reading frames (ORFs) were cloned into the LIC vector pET HisX6 eGFP TEV cloning vector from AddGene (AddGene #29663) using QB Berkley LIC protocol with primers designed using the tool from QB3 MacroLab (Fwd: 5’ TTTAAGAAGGAGATATAGTTCGTGAGCAAGGGCGAGGAG 3’; Rv: 5’ GGATTGGAAGTAGAGGTTCTCCATTCCCCAGCCAGAAGA 3’).

Techniques: Immunostaining, Plasmid Preparation, Transfection, Fluorescence, Imaging, Concentration Assay

Nuclear stain Hoechst 33242 (blue) A. Stable overexpression HEK293T- TDP43-YFP (green) cells were treated with 10 µM PDS and cPDS, for 8 h prior to oxidative stress (NaAsO2, 10 µM) Imaging: 60x, scale bar = 20 µm. B. Quantification of aggregated nuclear and cytoplasmic TDP43 were compared to transfected unaggregated nuclei; (Welch’s two sample t-test, unpaired; ##, **, p < 0.01; *, p <0.05), n = 4. C. Oxidative stress and G4 Binders assays were repeated in HEK293T cells with TDP43-tdTomato (red) transient transfection. D-E. HEK293T cells were subject to proteosome inhibitor MG132 (10 µM) for 8 h. Pretreatment with G4 binders (10 µM for 8 h) and proteosome stress were repeated and aggregates were quantified; (Welch’s two sample t-test, unpaired; ##, **, p < 0.01) n=3.

Journal: bioRxiv

Article Title: Manipulating TDP43 Aggregation via RNA G-quadruplexes

doi: 10.1101/2024.04.30.591873

Figure Lengend Snippet: Nuclear stain Hoechst 33242 (blue) A. Stable overexpression HEK293T- TDP43-YFP (green) cells were treated with 10 µM PDS and cPDS, for 8 h prior to oxidative stress (NaAsO2, 10 µM) Imaging: 60x, scale bar = 20 µm. B. Quantification of aggregated nuclear and cytoplasmic TDP43 were compared to transfected unaggregated nuclei; (Welch’s two sample t-test, unpaired; ##, **, p < 0.01; *, p <0.05), n = 4. C. Oxidative stress and G4 Binders assays were repeated in HEK293T cells with TDP43-tdTomato (red) transient transfection. D-E. HEK293T cells were subject to proteosome inhibitor MG132 (10 µM) for 8 h. Pretreatment with G4 binders (10 µM for 8 h) and proteosome stress were repeated and aggregates were quantified; (Welch’s two sample t-test, unpaired; ##, **, p < 0.01) n=3.

Article Snippet: Human WT TDP43 (AddGene #27458), and RRM mut (5F → L) (AddGene #84914) open reading frames (ORFs) were cloned into the LIC vector pET HisX6 eGFP TEV cloning vector from AddGene (AddGene #29663) using QB Berkley LIC protocol with primers designed using the tool from QB3 MacroLab (Fwd: 5’ TTTAAGAAGGAGATATAGTTCGTGAGCAAGGGCGAGGAG 3’; Rv: 5’ GGATTGGAAGTAGAGGTTCTCCATTCCCCAGCCAGAAGA 3’).

Techniques: Staining, Over Expression, Imaging, Transfection

A. NSC-34 cells transfected with TDP43-tdTomato differentiated for 96h in low serum media with 10 µM Retinoic Acid (R.A.). MG132 and NaAsO2 induced cytosolic aggregation of TDP43 within 8h. B. Differentiation was confirmed with immunofluorescent anti-ChAT, ms Alexa- Fluor 647 (green), nuclear labeled Hoechst 33342 (blue), and cytosolic inclusions are formed within 8h of 5 µM NaAsO2 and 5 µM MG132 stress. C. When treated with G4 binders, cytosolic aggregates are lessened in both stress conditions; n = 6. D. MTT data of NSC34-tdTomatoTDP43; in overexpression model, cell viability and survival significantly improved when pretreated with 5 µM cPDS and near significance in 5 µM PDS (Two-way ANOVA, Tukey’s post-hoc test, unpaired; ##, **, p < 0.01) n = 6.

Journal: bioRxiv

Article Title: Manipulating TDP43 Aggregation via RNA G-quadruplexes

doi: 10.1101/2024.04.30.591873

Figure Lengend Snippet: A. NSC-34 cells transfected with TDP43-tdTomato differentiated for 96h in low serum media with 10 µM Retinoic Acid (R.A.). MG132 and NaAsO2 induced cytosolic aggregation of TDP43 within 8h. B. Differentiation was confirmed with immunofluorescent anti-ChAT, ms Alexa- Fluor 647 (green), nuclear labeled Hoechst 33342 (blue), and cytosolic inclusions are formed within 8h of 5 µM NaAsO2 and 5 µM MG132 stress. C. When treated with G4 binders, cytosolic aggregates are lessened in both stress conditions; n = 6. D. MTT data of NSC34-tdTomatoTDP43; in overexpression model, cell viability and survival significantly improved when pretreated with 5 µM cPDS and near significance in 5 µM PDS (Two-way ANOVA, Tukey’s post-hoc test, unpaired; ##, **, p < 0.01) n = 6.

Article Snippet: Human WT TDP43 (AddGene #27458), and RRM mut (5F → L) (AddGene #84914) open reading frames (ORFs) were cloned into the LIC vector pET HisX6 eGFP TEV cloning vector from AddGene (AddGene #29663) using QB Berkley LIC protocol with primers designed using the tool from QB3 MacroLab (Fwd: 5’ TTTAAGAAGGAGATATAGTTCGTGAGCAAGGGCGAGGAG 3’; Rv: 5’ GGATTGGAAGTAGAGGTTCTCCATTCCCCAGCCAGAAGA 3’).

Techniques: Transfection, Labeling, Over Expression

Anti-BG4, rb Alexa-Fluor 647(green), stained for rG4s in NSC34 overexpressing TDP43-tdTomato. Scale bars, anti-BG4/Hoechst = 40 µm; inset = 20 µm.

Journal: bioRxiv

Article Title: Manipulating TDP43 Aggregation via RNA G-quadruplexes

doi: 10.1101/2024.04.30.591873

Figure Lengend Snippet: Anti-BG4, rb Alexa-Fluor 647(green), stained for rG4s in NSC34 overexpressing TDP43-tdTomato. Scale bars, anti-BG4/Hoechst = 40 µm; inset = 20 µm.

Article Snippet: Human WT TDP43 (AddGene #27458), and RRM mut (5F → L) (AddGene #84914) open reading frames (ORFs) were cloned into the LIC vector pET HisX6 eGFP TEV cloning vector from AddGene (AddGene #29663) using QB Berkley LIC protocol with primers designed using the tool from QB3 MacroLab (Fwd: 5’ TTTAAGAAGGAGATATAGTTCGTGAGCAAGGGCGAGGAG 3’; Rv: 5’ GGATTGGAAGTAGAGGTTCTCCATTCCCCAGCCAGAAGA 3’).

Techniques: Staining

A replicate of D, E. A. A time course of the normalized % cells tolerating and expressing TDP43-DsRED per 100,000 yeast cells based on DsRED and DRAQ7 intensity. B. A dosage curve of the normalized % cells tolerating and expressing TDP43-DsRED per 100,000 yeast cells based on DsRED and DRAQ7 intensity.

Journal: bioRxiv

Article Title: Manipulating TDP43 Aggregation via RNA G-quadruplexes

doi: 10.1101/2024.04.30.591873

Figure Lengend Snippet: A replicate of D, E. A. A time course of the normalized % cells tolerating and expressing TDP43-DsRED per 100,000 yeast cells based on DsRED and DRAQ7 intensity. B. A dosage curve of the normalized % cells tolerating and expressing TDP43-DsRED per 100,000 yeast cells based on DsRED and DRAQ7 intensity.

Article Snippet: Human WT TDP43 (AddGene #27458), and RRM mut (5F → L) (AddGene #84914) open reading frames (ORFs) were cloned into the LIC vector pET HisX6 eGFP TEV cloning vector from AddGene (AddGene #29663) using QB Berkley LIC protocol with primers designed using the tool from QB3 MacroLab (Fwd: 5’ TTTAAGAAGGAGATATAGTTCGTGAGCAAGGGCGAGGAG 3’; Rv: 5’ GGATTGGAAGTAGAGGTTCTCCATTCCCCAGCCAGAAGA 3’).

Techniques: Expressing

(A) Position of the helix region in the low complexity domain (LCD) of the full-length ANXA11 or TDP-43. (B,C) Complex structures of UBQLN2 STI1 domain and ANXA11 LCD or TDP-43 LCD generated by AlphaFold, shows the helix in red or green may occupy the same binding pocket on UBQLN2 STI1-I domain. (D) Schematic representation of three modes of UBQLN2 binding governed by competitive interactions among the scaffold TRIM32, UBQLN2, and client proteins ANXA11 or TDP-43 within TRIM32–UBQLN2 condensates. (a) Both binding sites of the UBQLN2 dimer interact with TRIM32, anchoring UBQLN2 within condensates. (b) Client proteins ANXA11 or TDP-43 competitively occupy the same binding site on UBQLN2. (c) Both binding sites of the UBQLN2 dimer are occupied by ANXA11 or TDP-43, allowing UBQLN2–client complexes to diffuse into or out of condensates. (E) Left: fluorescence intensity recovery of ANXA11 (red) in the TRIM32-p62 or TRIM32-UBQLN2-p62 or TRIM32-UBQLN2 (P506S)-p62 condensate formed during the TRIM32 auto-ubiquitination reaction in vitro. Right: Quantification of fluorescence intensity recovery of photobleached ANXA11 in three kinds of condensates. n = 3. Data are presented as mean ± s.e.m. Bar=2 μm. (F) Left: fluorescence intensity recovery of TDP-43 (red) in the TRIM32-p62 or TRIM32-UBQLN2-p62 or TRIM32-UBQLN2 (P506S)-p62 condensate. Right: Quantification of fluorescence intensity recovery of photobleached TDP-43 in three kinds of condensates. n = 3. Data are presented as mean ± s.e.m. Bar=2 μm. (G) Left: Representative images of Amylo-Glo, an amyloid cross-β-sheet binding dye (white) staining at the indicated times, showing strong co-localization with TDP-43 (red) in TRIM32 condensates formed during the TRIM32 auto-ubiquitination reaction in vitro with addition of UBQLN2 (purple) and p62 (green). Right: Quantification of the ratio of Amylo-Glo positive TDP-43 condensates among UBQLN2-p62-TDP-43 colocalized condensates. Number of puncta are quantified from three independent experiments. Data are presented as mean ± s.e.m. p values were determined by one-way analysis of variance (ANOVA). p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), p < 0.0001 (****); ns, not significant.

Journal: bioRxiv

Article Title: TRIM32–UBQLN2–p62 axis promotes TDP-43 inclusion formation and amyloid aggregation through shuttle condensates

doi: 10.64898/2026.02.11.705390

Figure Lengend Snippet: (A) Position of the helix region in the low complexity domain (LCD) of the full-length ANXA11 or TDP-43. (B,C) Complex structures of UBQLN2 STI1 domain and ANXA11 LCD or TDP-43 LCD generated by AlphaFold, shows the helix in red or green may occupy the same binding pocket on UBQLN2 STI1-I domain. (D) Schematic representation of three modes of UBQLN2 binding governed by competitive interactions among the scaffold TRIM32, UBQLN2, and client proteins ANXA11 or TDP-43 within TRIM32–UBQLN2 condensates. (a) Both binding sites of the UBQLN2 dimer interact with TRIM32, anchoring UBQLN2 within condensates. (b) Client proteins ANXA11 or TDP-43 competitively occupy the same binding site on UBQLN2. (c) Both binding sites of the UBQLN2 dimer are occupied by ANXA11 or TDP-43, allowing UBQLN2–client complexes to diffuse into or out of condensates. (E) Left: fluorescence intensity recovery of ANXA11 (red) in the TRIM32-p62 or TRIM32-UBQLN2-p62 or TRIM32-UBQLN2 (P506S)-p62 condensate formed during the TRIM32 auto-ubiquitination reaction in vitro. Right: Quantification of fluorescence intensity recovery of photobleached ANXA11 in three kinds of condensates. n = 3. Data are presented as mean ± s.e.m. Bar=2 μm. (F) Left: fluorescence intensity recovery of TDP-43 (red) in the TRIM32-p62 or TRIM32-UBQLN2-p62 or TRIM32-UBQLN2 (P506S)-p62 condensate. Right: Quantification of fluorescence intensity recovery of photobleached TDP-43 in three kinds of condensates. n = 3. Data are presented as mean ± s.e.m. Bar=2 μm. (G) Left: Representative images of Amylo-Glo, an amyloid cross-β-sheet binding dye (white) staining at the indicated times, showing strong co-localization with TDP-43 (red) in TRIM32 condensates formed during the TRIM32 auto-ubiquitination reaction in vitro with addition of UBQLN2 (purple) and p62 (green). Right: Quantification of the ratio of Amylo-Glo positive TDP-43 condensates among UBQLN2-p62-TDP-43 colocalized condensates. Number of puncta are quantified from three independent experiments. Data are presented as mean ± s.e.m. p values were determined by one-way analysis of variance (ANOVA). p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), p < 0.0001 (****); ns, not significant.

Article Snippet: Bacterial plasmids obtained from Addgene include: UBE1 (Addgene plasmid # 34965), UBE2D3 (Addgene plasmid # 12643), ANXA11 (Addgene plasmid # 164496), p62 (Addgene plasmid # 190929), TDP-43 (Addgene plasmid # 133320 and plasmid # 27462).

Techniques: Generated, Binding Assay, Fluorescence, Ubiquitin Proteomics, In Vitro, Staining

(A) Representative immunofluorescence images of TRIM32 (green) and wt UBQLN2 or UBQLN2 pathogenic mutants (Red) with DAPI (blue) in HEK293T cells. Scale bar, 10 μm. (B, C) Quantification of TRIM32-UBQLN2 condensates with and without Bafilomycin A1 treatment (Figure A and Extended figure 5E). Data are presented as mean ± s.e.m. Statistical significance was determined using one-way ANOVA between mutation groups and WT group, followed by pairwise comparisons using unpaired two-tailed t-tests between Bafilomycin treated and untreated groups. p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), p < 0.0001 (****); ns, not significant. Each spot represents one puncta. Shown are combined data from three independent experiments. (D) Representative western blot images to assess the solubility of TDP-43 NLSmut with or without cotransfection of TRIM32 or UBQLN2 in RIPA (R) and urea (u) buffers using anti-TDP-43 antibody. TDP43 NLSmut -YFP-Ubn indicates ubiquitinated TDP-43 NLSmut -YFP. (E) Quantification of relative levels of TDP-43 NLSmut -YFP and ubiquitinated TDP-43 NLSmut -YFP from three independent experiments showed in (D) . The box indicates the specific band for TDP-43 NLSmut and its ubiquitinated species for quantification. (F) Representative western blot images to assess the solubility of TDP-43 NLSmut with cotransfection of TRIM32 mutation FVL2AAA or UBQLN2 UBA point mutation L619A or pathogenic mutation P506S in RIPA (R) and urea (u) buffers, using anti-TDP-43 antibody. TDP-43 NLSmut -YFP-Ubn indicates ubiquitinated TDP-43 NLSmut -YFP. (G) Quantification of relative levels of TDP-43 NLSmut -YFP and ubiquitinated TDP-43 NLSmut -YFP from three independent experiments showed in (F) . The box indicates the specific band for TDP-43 NLSmut -YFP and its ubiquitinated species for quantification. (H) Representative immunofluorescence images of HEK293T cells with cotransfection of TDP-43 NLSmut (yellow), TRIM32 (purple) and UBQLN2 WT or disease-associated mutant P506S (red) staining with with an amyloid aggregate indicator dye, Amylo-Glo (white) under no stress or arsenite stress (AS) condition. TDP-43 stress granules are indicated with white arrows. Scale bar, 10 μm. (I) Quantification of the ratio of Amylo-Glo positive TDP-43 aggregates among TRIM32-UBQLN2-TDP-43 colocalized puncta showed in (H) . Number of puncta are quantified from three independent experiments. (E,G,I) Data are presented as mean ± s.e.m. p values were determined by one-way analysis of variance (ANOVA). p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), p < 0.0001 (****); ns, not significant.

Journal: bioRxiv

Article Title: TRIM32–UBQLN2–p62 axis promotes TDP-43 inclusion formation and amyloid aggregation through shuttle condensates

doi: 10.64898/2026.02.11.705390

Figure Lengend Snippet: (A) Representative immunofluorescence images of TRIM32 (green) and wt UBQLN2 or UBQLN2 pathogenic mutants (Red) with DAPI (blue) in HEK293T cells. Scale bar, 10 μm. (B, C) Quantification of TRIM32-UBQLN2 condensates with and without Bafilomycin A1 treatment (Figure A and Extended figure 5E). Data are presented as mean ± s.e.m. Statistical significance was determined using one-way ANOVA between mutation groups and WT group, followed by pairwise comparisons using unpaired two-tailed t-tests between Bafilomycin treated and untreated groups. p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), p < 0.0001 (****); ns, not significant. Each spot represents one puncta. Shown are combined data from three independent experiments. (D) Representative western blot images to assess the solubility of TDP-43 NLSmut with or without cotransfection of TRIM32 or UBQLN2 in RIPA (R) and urea (u) buffers using anti-TDP-43 antibody. TDP43 NLSmut -YFP-Ubn indicates ubiquitinated TDP-43 NLSmut -YFP. (E) Quantification of relative levels of TDP-43 NLSmut -YFP and ubiquitinated TDP-43 NLSmut -YFP from three independent experiments showed in (D) . The box indicates the specific band for TDP-43 NLSmut and its ubiquitinated species for quantification. (F) Representative western blot images to assess the solubility of TDP-43 NLSmut with cotransfection of TRIM32 mutation FVL2AAA or UBQLN2 UBA point mutation L619A or pathogenic mutation P506S in RIPA (R) and urea (u) buffers, using anti-TDP-43 antibody. TDP-43 NLSmut -YFP-Ubn indicates ubiquitinated TDP-43 NLSmut -YFP. (G) Quantification of relative levels of TDP-43 NLSmut -YFP and ubiquitinated TDP-43 NLSmut -YFP from three independent experiments showed in (F) . The box indicates the specific band for TDP-43 NLSmut -YFP and its ubiquitinated species for quantification. (H) Representative immunofluorescence images of HEK293T cells with cotransfection of TDP-43 NLSmut (yellow), TRIM32 (purple) and UBQLN2 WT or disease-associated mutant P506S (red) staining with with an amyloid aggregate indicator dye, Amylo-Glo (white) under no stress or arsenite stress (AS) condition. TDP-43 stress granules are indicated with white arrows. Scale bar, 10 μm. (I) Quantification of the ratio of Amylo-Glo positive TDP-43 aggregates among TRIM32-UBQLN2-TDP-43 colocalized puncta showed in (H) . Number of puncta are quantified from three independent experiments. (E,G,I) Data are presented as mean ± s.e.m. p values were determined by one-way analysis of variance (ANOVA). p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), p < 0.0001 (****); ns, not significant.

Article Snippet: Bacterial plasmids obtained from Addgene include: UBE1 (Addgene plasmid # 34965), UBE2D3 (Addgene plasmid # 12643), ANXA11 (Addgene plasmid # 164496), p62 (Addgene plasmid # 190929), TDP-43 (Addgene plasmid # 133320 and plasmid # 27462).

Techniques: Immunofluorescence, Mutagenesis, Two Tailed Test, Western Blot, Solubility, Cotransfection, Staining

(A) Representative images showing TRIM32, UBQLN2 and pTDP-43(Ser409/410) within round-like pTDP-43 inclusions in the amygdala region of non-dementia (control), AD, AD with LATE, and FTD subjects with TDP-43 proteinopathy. Areas outlined by dotted white boxes are magnified to the right. Scale bar, 10 μm. (B) Radial distribution of the fluorescence intensities of TRIM32, UBQLN2 and pTDP-43(Ser409/410) indicated that TRIM32 co-localization with UBQLN2 and pTDP-43. (C) Quantification of the percentage of pTDP-43 positive aggregates co-localizing with/without TRIM32 or UBQLN2 in the basolateral and lateral nucleus (BLA), entorhinal cortex (EC) in the amygdala region, and frontal cortex (FC) from AD, AD with LATE, and FTD subjects with TDP-43 proteinopathy. Numbers above each column indicate the counts of pTDP-43 positive aggregates for the corresponding case. (D) Representative images of TRIM32, UBQLN2, pTDP-43(Ser409/410) and Amylo-Glo in the human amygdala region of non-dementia (control) and AD subjects. Scale bar, 5 μm (E) Schematic of the proteostasis mechanism mediated by TRIM32-UBQLN2-p62 shuttle condensates. The shuttle factor UBQLN2 with clients TDP43 and ANXA11 et al may exchange between various pools like stress granules, TRIM32 condensates and nuclear based on their relative binding avidity to scaffolds, which at last will be confined in p62 condensates for autophagic processing. Disruption of this compartmentalized sorting, either at the level of scaffolds or client proteins by pathogenic mutations or stress induced proteostasis burden or autophagosome-lysosome dysfunction which alter scaffold-client interaction and enhance the retention within TRIM32 condensates, may contribute to ubiquitin-positive p62-positive inclusion formation and TDP-43 aggregation.

Journal: bioRxiv

Article Title: TRIM32–UBQLN2–p62 axis promotes TDP-43 inclusion formation and amyloid aggregation through shuttle condensates

doi: 10.64898/2026.02.11.705390

Figure Lengend Snippet: (A) Representative images showing TRIM32, UBQLN2 and pTDP-43(Ser409/410) within round-like pTDP-43 inclusions in the amygdala region of non-dementia (control), AD, AD with LATE, and FTD subjects with TDP-43 proteinopathy. Areas outlined by dotted white boxes are magnified to the right. Scale bar, 10 μm. (B) Radial distribution of the fluorescence intensities of TRIM32, UBQLN2 and pTDP-43(Ser409/410) indicated that TRIM32 co-localization with UBQLN2 and pTDP-43. (C) Quantification of the percentage of pTDP-43 positive aggregates co-localizing with/without TRIM32 or UBQLN2 in the basolateral and lateral nucleus (BLA), entorhinal cortex (EC) in the amygdala region, and frontal cortex (FC) from AD, AD with LATE, and FTD subjects with TDP-43 proteinopathy. Numbers above each column indicate the counts of pTDP-43 positive aggregates for the corresponding case. (D) Representative images of TRIM32, UBQLN2, pTDP-43(Ser409/410) and Amylo-Glo in the human amygdala region of non-dementia (control) and AD subjects. Scale bar, 5 μm (E) Schematic of the proteostasis mechanism mediated by TRIM32-UBQLN2-p62 shuttle condensates. The shuttle factor UBQLN2 with clients TDP43 and ANXA11 et al may exchange between various pools like stress granules, TRIM32 condensates and nuclear based on their relative binding avidity to scaffolds, which at last will be confined in p62 condensates for autophagic processing. Disruption of this compartmentalized sorting, either at the level of scaffolds or client proteins by pathogenic mutations or stress induced proteostasis burden or autophagosome-lysosome dysfunction which alter scaffold-client interaction and enhance the retention within TRIM32 condensates, may contribute to ubiquitin-positive p62-positive inclusion formation and TDP-43 aggregation.

Article Snippet: Bacterial plasmids obtained from Addgene include: UBE1 (Addgene plasmid # 34965), UBE2D3 (Addgene plasmid # 12643), ANXA11 (Addgene plasmid # 164496), p62 (Addgene plasmid # 190929), TDP-43 (Addgene plasmid # 133320 and plasmid # 27462).

Techniques: Control, Fluorescence, Binding Assay, Disruption, Ubiquitin Proteomics