target plasmid Search Results


93
Addgene inc paper n a recombinant dna gecko v2 crispr grna library sanjana
Paper N A Recombinant Dna Gecko V2 Crispr Grna Library Sanjana, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+plasmid/pmc09903835__mmc12-761-205-217?v=Addgene+inc
Average 93 stars, based on 1 article reviews
paper n a recombinant dna gecko v2 crispr grna library sanjana - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc luciferase
Luciferase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+plasmid/pm41638907-258-4-8?v=Addgene+inc
Average 93 stars, based on 1 article reviews
luciferase - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

92
Addgene inc f2a gfp
F2a Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+plasmid/pm38442714-262-19-24?v=Addgene+inc
Average 92 stars, based on 1 article reviews
f2a gfp - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

93
Addgene inc andrew scharenberg
Andrew Scharenberg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+plasmid/pm40764600-502-22-24?v=Addgene+inc
Average 93 stars, based on 1 article reviews
andrew scharenberg - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

94
Addgene inc zap tttgtggtgttggagaccgg
Zap Tttgtggtgttggagaccgg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+plasmid/pm41319291-222-16-36?v=Addgene+inc
Average 94 stars, based on 1 article reviews
zap tttgtggtgttggagaccgg - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

90
Addgene inc feng zhang
Feng Zhang, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+plasmid/pmc09430969-172-14-16?v=Addgene+inc
Average 90 stars, based on 1 article reviews
feng zhang - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

93
Addgene inc jacob corn
Jacob Corn, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+plasmid/tomaleri_giovani_pinton__2023__structure_and_mechanism_of_the_human_er_membrane_protein_complex-1032-51-53?v=Addgene+inc
Average 93 stars, based on 1 article reviews
jacob corn - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc pen244 ctcf aid 71 114 egfp frt blast frt
Pen244 Ctcf Aid 71 114 Egfp Frt Blast Frt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+plasmid/pm36482254-312-88-96?v=Addgene+inc
Average 93 stars, based on 1 article reviews
pen244 ctcf aid 71 114 egfp frt blast frt - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc christian frøkjær jensen
Christian Frøkjær Jensen, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+plasmid/pmc12700905-253-9-11?v=Addgene+inc
Average 93 stars, based on 1 article reviews
christian frøkjær jensen - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

91
Addgene inc trafficlight reporter
Trafficlight Reporter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+plasmid/pmc12900515-96-0-6?v=Addgene+inc
Average 91 stars, based on 1 article reviews
trafficlight reporter - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

93
Addgene inc plasmid pac09
( a ) Schematic outline of the in vivo experiment workflow. ( b ) Confocal microscopy images of a honeybee ileum co-colonized by S. alvi ac02 and G. apis ESL169 (left) or G. apicola ESL309 (right). The blue channel depicts DAPI staining of host and bacterial DNA. The green channel shows GFP fluorescence from the engineered S. alvi strain. Red channel shows E2-crimson fluorescence from the Gilliamella strains transformed with the <t>pAC09</t> plasmid. Scale bar represents 100 μm. ( c ) G. apicola ESL309 catabolizes arabinose whereas G. apis ESL169 does not. Box plot shows median value of GFP fluorescence of S. alvi biofilms imaged from the gut of bees fed sugar water (-) or sugar water supplemented with 210 μM arabinose (ara). Each fluorescence value corresponds to the overall mean intensity averaged from 3 sections (anterior, mid-ileum, posterior) of one gut and across the depth of the bacterial biofilm for each section. Different letters indicate significant differences in fluorescence intensities across colonization and diet conditions, with adjusted p-value < 0.05 (Tukey HSD test). (d) Distribution of pollen-derived arabinose is longitudinally uniform along the ileum. Truncated violin plot shows median value of GFP fluorescence quantified from S. alvi biofilms imaged in the gut of bees fed sugar water (-) or sugar water and pollen ad libitum (pollen). Each fluorescence value corresponds to the mean intensity averaged across the depth of the bacterial biofilm for each gut section. (e) Arabinose derived from pollen breakdown distributes with high heterogeneity along a radial gradient across the depth of S. alvi ac02 biofilm when co-colonized with G. apis ESL169 (left) or G. apicola ESL309 (right). Graphs show the mean GFP fluorescence of the biosensor according to the biofilm depth of individual bees. Data corresponding to the anterior ileum region are displayed only for clarity. Complete data are provided in Supplementary Fig. 8.
Plasmid Pac09, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+plasmid/bio_rxiv__2025__11__28__691108-262-4-6?v=Addgene+inc
Average 93 stars, based on 1 article reviews
plasmid pac09 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc pym46 s20 h6 kanmx euroscarf
( a ) Schematic outline of the in vivo experiment workflow. ( b ) Confocal microscopy images of a honeybee ileum co-colonized by S. alvi ac02 and G. apis ESL169 (left) or G. apicola ESL309 (right). The blue channel depicts DAPI staining of host and bacterial DNA. The green channel shows GFP fluorescence from the engineered S. alvi strain. Red channel shows E2-crimson fluorescence from the Gilliamella strains transformed with the <t>pAC09</t> plasmid. Scale bar represents 100 μm. ( c ) G. apicola ESL309 catabolizes arabinose whereas G. apis ESL169 does not. Box plot shows median value of GFP fluorescence of S. alvi biofilms imaged from the gut of bees fed sugar water (-) or sugar water supplemented with 210 μM arabinose (ara). Each fluorescence value corresponds to the overall mean intensity averaged from 3 sections (anterior, mid-ileum, posterior) of one gut and across the depth of the bacterial biofilm for each section. Different letters indicate significant differences in fluorescence intensities across colonization and diet conditions, with adjusted p-value < 0.05 (Tukey HSD test). (d) Distribution of pollen-derived arabinose is longitudinally uniform along the ileum. Truncated violin plot shows median value of GFP fluorescence quantified from S. alvi biofilms imaged in the gut of bees fed sugar water (-) or sugar water and pollen ad libitum (pollen). Each fluorescence value corresponds to the mean intensity averaged across the depth of the bacterial biofilm for each gut section. (e) Arabinose derived from pollen breakdown distributes with high heterogeneity along a radial gradient across the depth of S. alvi ac02 biofilm when co-colonized with G. apis ESL169 (left) or G. apicola ESL309 (right). Graphs show the mean GFP fluorescence of the biosensor according to the biofilm depth of individual bees. Data corresponding to the anterior ileum region are displayed only for clarity. Complete data are provided in Supplementary Fig. 8.
Pym46 S20 H6 Kanmx Euroscarf, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+plasmid/pmc11775340__42003_2025_7569_MOESM1_ESM-62-69-84?v=Addgene+inc
Average 93 stars, based on 1 article reviews
pym46 s20 h6 kanmx euroscarf - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

Image Search Results


( a ) Schematic outline of the in vivo experiment workflow. ( b ) Confocal microscopy images of a honeybee ileum co-colonized by S. alvi ac02 and G. apis ESL169 (left) or G. apicola ESL309 (right). The blue channel depicts DAPI staining of host and bacterial DNA. The green channel shows GFP fluorescence from the engineered S. alvi strain. Red channel shows E2-crimson fluorescence from the Gilliamella strains transformed with the pAC09 plasmid. Scale bar represents 100 μm. ( c ) G. apicola ESL309 catabolizes arabinose whereas G. apis ESL169 does not. Box plot shows median value of GFP fluorescence of S. alvi biofilms imaged from the gut of bees fed sugar water (-) or sugar water supplemented with 210 μM arabinose (ara). Each fluorescence value corresponds to the overall mean intensity averaged from 3 sections (anterior, mid-ileum, posterior) of one gut and across the depth of the bacterial biofilm for each section. Different letters indicate significant differences in fluorescence intensities across colonization and diet conditions, with adjusted p-value < 0.05 (Tukey HSD test). (d) Distribution of pollen-derived arabinose is longitudinally uniform along the ileum. Truncated violin plot shows median value of GFP fluorescence quantified from S. alvi biofilms imaged in the gut of bees fed sugar water (-) or sugar water and pollen ad libitum (pollen). Each fluorescence value corresponds to the mean intensity averaged across the depth of the bacterial biofilm for each gut section. (e) Arabinose derived from pollen breakdown distributes with high heterogeneity along a radial gradient across the depth of S. alvi ac02 biofilm when co-colonized with G. apis ESL169 (left) or G. apicola ESL309 (right). Graphs show the mean GFP fluorescence of the biosensor according to the biofilm depth of individual bees. Data corresponding to the anterior ileum region are displayed only for clarity. Complete data are provided in Supplementary Fig. 8.

Journal: bioRxiv

Article Title: Engineered symbiont biosensor maps micron-scale sugar gradients in the honeybee gut

doi: 10.1101/2025.11.28.691108

Figure Lengend Snippet: ( a ) Schematic outline of the in vivo experiment workflow. ( b ) Confocal microscopy images of a honeybee ileum co-colonized by S. alvi ac02 and G. apis ESL169 (left) or G. apicola ESL309 (right). The blue channel depicts DAPI staining of host and bacterial DNA. The green channel shows GFP fluorescence from the engineered S. alvi strain. Red channel shows E2-crimson fluorescence from the Gilliamella strains transformed with the pAC09 plasmid. Scale bar represents 100 μm. ( c ) G. apicola ESL309 catabolizes arabinose whereas G. apis ESL169 does not. Box plot shows median value of GFP fluorescence of S. alvi biofilms imaged from the gut of bees fed sugar water (-) or sugar water supplemented with 210 μM arabinose (ara). Each fluorescence value corresponds to the overall mean intensity averaged from 3 sections (anterior, mid-ileum, posterior) of one gut and across the depth of the bacterial biofilm for each section. Different letters indicate significant differences in fluorescence intensities across colonization and diet conditions, with adjusted p-value < 0.05 (Tukey HSD test). (d) Distribution of pollen-derived arabinose is longitudinally uniform along the ileum. Truncated violin plot shows median value of GFP fluorescence quantified from S. alvi biofilms imaged in the gut of bees fed sugar water (-) or sugar water and pollen ad libitum (pollen). Each fluorescence value corresponds to the mean intensity averaged across the depth of the bacterial biofilm for each gut section. (e) Arabinose derived from pollen breakdown distributes with high heterogeneity along a radial gradient across the depth of S. alvi ac02 biofilm when co-colonized with G. apis ESL169 (left) or G. apicola ESL309 (right). Graphs show the mean GFP fluorescence of the biosensor according to the biofilm depth of individual bees. Data corresponding to the anterior ileum region are displayed only for clarity. Complete data are provided in Supplementary Fig. 8.

Article Snippet: Gilliamella strains carried the plasmid pAC09 (Addgene plasmid No. 197403) encoding the E2-crimson fluorescent protein to enable in vivo visualization.

Techniques: In Vivo, Confocal Microscopy, Staining, Fluorescence, Transformation Assay, Plasmid Preparation, Derivative Assay