taq polymerase Search Results


99
Thermo Fisher platinumtm taq dna polymerase kit
Platinumtm Taq Dna Polymerase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase/Taq+DNA+Polymerase+Kit/pm31677416-80-20-25
Average 99 stars, based on 1 article reviews
platinumtm taq dna polymerase kit - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
New England Biolabs taq dna polymerase
Taq Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase/Taq+DNA+Polymerase/us08597923-854-47-46
Average 99 stars, based on 1 article reviews
taq dna polymerase - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

97
New England Biolabs longamp taq dna polymerase
Longamp Taq Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase/LongAmp+Taq+DNA+Polymerase/us10301610-819-34-38
Average 97 stars, based on 1 article reviews
longamp taq dna polymerase - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

91
Dna Polymerase Technology taq polymerase
Comparison of the indicated enzymes in RT-qPCR with EvaGreen intercalating dye (A) and with TaqMan probe (B). The mean quantification cycles (Cq) ± standard deviation of three replicates for the indicated template total RNA amounts (NTC, no template control) are provided. ∆Cq is the difference between the Cq of the RT-qPCR with the indicated <t> polymerase </t> and control OneTube RT-PCR-Mix for each template dilution. (A) The real-time amplifications of GAPDH mRNA fragment with EvaGreen intercalating dye were carried out using 10-fold dilutions of the human total RNA from 1 ng to 0.01 ng as a template, or no template control (NTC). (B) The TaqMan prob RT-qPCR assays of SARS-CoV-2 viral RNA were carried out with 10, 50, and 250 times diluted RNA isolated from SARS-CoV-2-positive nasopharyngeal swabs as a template or no template control (NTC).
Taq Polymerase, supplied by Dna Polymerase Technology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase/Omni+Taq/pmc11858481-47-4-9
Average 91 stars, based on 1 article reviews
taq polymerase - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

96
New England Biolabs neb taq dna polymerase
Comparison of the indicated enzymes in RT-qPCR with EvaGreen intercalating dye (A) and with TaqMan probe (B). The mean quantification cycles (Cq) ± standard deviation of three replicates for the indicated template total RNA amounts (NTC, no template control) are provided. ∆Cq is the difference between the Cq of the RT-qPCR with the indicated <t> polymerase </t> and control OneTube RT-PCR-Mix for each template dilution. (A) The real-time amplifications of GAPDH mRNA fragment with EvaGreen intercalating dye were carried out using 10-fold dilutions of the human total RNA from 1 ng to 0.01 ng as a template, or no template control (NTC). (B) The TaqMan prob RT-qPCR assays of SARS-CoV-2 viral RNA were carried out with 10, 50, and 250 times diluted RNA isolated from SARS-CoV-2-positive nasopharyngeal swabs as a template or no template control (NTC).
Neb Taq Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase/Taq+DNA+Polymerase+with+Standard+Taq+(Mg/bio_rxiv__64898__2026__03__02__709049-74-12-12
Average 96 stars, based on 1 article reviews
neb taq dna polymerase - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

99
tiangen biotech co taq dna polymerase
Comparison of the indicated enzymes in RT-qPCR with EvaGreen intercalating dye (A) and with TaqMan probe (B). The mean quantification cycles (Cq) ± standard deviation of three replicates for the indicated template total RNA amounts (NTC, no template control) are provided. ∆Cq is the difference between the Cq of the RT-qPCR with the indicated <t> polymerase </t> and control OneTube RT-PCR-Mix for each template dilution. (A) The real-time amplifications of GAPDH mRNA fragment with EvaGreen intercalating dye were carried out using 10-fold dilutions of the human total RNA from 1 ng to 0.01 ng as a template, or no template control (NTC). (B) The TaqMan prob RT-qPCR assays of SARS-CoV-2 viral RNA were carried out with 10, 50, and 250 times diluted RNA isolated from SARS-CoV-2-positive nasopharyngeal swabs as a template or no template control (NTC).
Taq Dna Polymerase, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase/Taq+DNA+Polymerase/10__1186_slash_1743___422x___8___550-57-22-25
Average 99 stars, based on 1 article reviews
taq dna polymerase - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

96
tiangen biotech co taq platinum polymerase
Comparison of the indicated enzymes in RT-qPCR with EvaGreen intercalating dye (A) and with TaqMan probe (B). The mean quantification cycles (Cq) ± standard deviation of three replicates for the indicated template total RNA amounts (NTC, no template control) are provided. ∆Cq is the difference between the Cq of the RT-qPCR with the indicated <t> polymerase </t> and control OneTube RT-PCR-Mix for each template dilution. (A) The real-time amplifications of GAPDH mRNA fragment with EvaGreen intercalating dye were carried out using 10-fold dilutions of the human total RNA from 1 ng to 0.01 ng as a template, or no template control (NTC). (B) The TaqMan prob RT-qPCR assays of SARS-CoV-2 viral RNA were carried out with 10, 50, and 250 times diluted RNA isolated from SARS-CoV-2-positive nasopharyngeal swabs as a template or no template control (NTC).
Taq Platinum Polymerase, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase/Taq+Platinum+DNA+Polymerase/pm19246469-43-14-17
Average 96 stars, based on 1 article reviews
taq platinum polymerase - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

99
tiangen biotech co taq polymerase
Figure 6. Expression profile of OsATG6 genes under different abiotic stresses based on semi-quantitative real-time <t>polymerase</t> chain reaction.
Taq Polymerase, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase/Taq+Polymerase/10__4238_slash_2012__august__17__3-55-55-57
Average 99 stars, based on 1 article reviews
taq polymerase - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

91
Cytiva Europe thermus aquaticus dna polymerase
Figure 6. Expression profile of OsATG6 genes under different abiotic stresses based on semi-quantitative real-time <t>polymerase</t> chain reaction.
Thermus Aquaticus Dna Polymerase, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase/Taq+DNA+Polymerase/pmc04342888-275-19-23
Average 91 stars, based on 1 article reviews
thermus aquaticus dna polymerase - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

93
Genesee Scientific primers for ezh2
Primer sequences for RT-PCR.
Primers For Ezh2, supplied by Genesee Scientific, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase/Taq+DNA+Polymerase/pmc05800601-79-16-46
Average 93 stars, based on 1 article reviews
primers for ezh2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

99
tiangen biotech co taq plus dna polymerase
Primer sequences for RT-PCR.
Taq Plus Dna Polymerase, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/taq+polymerase/Taq+Plus+DNA+Polymerase/10__4238_slash_2013__october__15__6-19-27-35
Average 99 stars, based on 1 article reviews
taq plus dna polymerase - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

Image Search Results


Comparison of the indicated enzymes in RT-qPCR with EvaGreen intercalating dye (A) and with TaqMan probe (B). The mean quantification cycles (Cq) ± standard deviation of three replicates for the indicated template total RNA amounts (NTC, no template control) are provided. ∆Cq is the difference between the Cq of the RT-qPCR with the indicated  polymerase  and control OneTube RT-PCR-Mix for each template dilution. (A) The real-time amplifications of GAPDH mRNA fragment with EvaGreen intercalating dye were carried out using 10-fold dilutions of the human total RNA from 1 ng to 0.01 ng as a template, or no template control (NTC). (B) The TaqMan prob RT-qPCR assays of SARS-CoV-2 viral RNA were carried out with 10, 50, and 250 times diluted RNA isolated from SARS-CoV-2-positive nasopharyngeal swabs as a template or no template control (NTC).

Journal: Methods and Protocols

Article Title: Comparison of Commercially Available Thermostable DNA Polymerases with Reverse Transcriptase Activity in Coupled Reverse Transcription Polymerase Chain Reaction Assays

doi: 10.3390/mps8010011

Figure Lengend Snippet: Comparison of the indicated enzymes in RT-qPCR with EvaGreen intercalating dye (A) and with TaqMan probe (B). The mean quantification cycles (Cq) ± standard deviation of three replicates for the indicated template total RNA amounts (NTC, no template control) are provided. ∆Cq is the difference between the Cq of the RT-qPCR with the indicated polymerase and control OneTube RT-PCR-Mix for each template dilution. (A) The real-time amplifications of GAPDH mRNA fragment with EvaGreen intercalating dye were carried out using 10-fold dilutions of the human total RNA from 1 ng to 0.01 ng as a template, or no template control (NTC). (B) The TaqMan prob RT-qPCR assays of SARS-CoV-2 viral RNA were carried out with 10, 50, and 250 times diluted RNA isolated from SARS-CoV-2-positive nasopharyngeal swabs as a template or no template control (NTC).

Article Snippet: The D732N mutant of Taq polymerase was commercialized by DNA Polymerase Technology, Inc. as the OmniTaq2 DNA polymerase.

Techniques: Comparison, Standard Deviation, Control, Isolation

Figure 6. Expression profile of OsATG6 genes under different abiotic stresses based on semi-quantitative real-time polymerase chain reaction.

Journal: Genetics and Molecular Research

Article Title: Regulation of ATG6/Beclin-1 homologs by abiotic stresses and hormones in rice (Oryza sativa L.)

doi: 10.4238/2012.august.17.3

Figure Lengend Snippet: Figure 6. Expression profile of OsATG6 genes under different abiotic stresses based on semi-quantitative real-time polymerase chain reaction.

Article Snippet: PCR was performed with 25 (18S rRNA) or 30 (ATG6 genes) cycles (30 s at 94°C, 30 s at 63°C, and 20 s at 72°C) under the following conditions: 0.5 μL RT product was amplified in a 20-μL volume containing 2 μL 10X PCR buffer with MgCl2, 0.25 μL 10 mM dNTPs, and 0.5 μL Taq polymerase (Tiangen, Beijing).

Techniques: Expressing, Real-time Polymerase Chain Reaction

Primer sequences for RT-PCR.

Journal: PLoS ONE

Article Title: Ezh2 does not mediate retinal ganglion cell homeostasis or their susceptibility to injury

doi: 10.1371/journal.pone.0191853

Figure Lengend Snippet: Primer sequences for RT-PCR.

Article Snippet: To detect the Ezh2 floxed gene, one μl of genomic DNA from a mouse tail and primers for Ezh2 ( F: CTGCTCTGAATGGCAACTCC ; R: TTATTCATAGAGCCACCTGG ) were added to a mixture of solution containing Apex TaqDNA Polymerase (Cat. No. 42–409), Apex buffer, and MgCl 2 from Genesee Scientific (San Diego, CA), and dNTP (Cat. No. 10297–018; Invitrogen).

Techniques:

(A) PCR genotyping of Ezh2 and Cre genes. (B) Representative result of Western blot of Ezh2 expression in RGCs purified from P0 WT and mKO mice. GAPDH was used as a loading control. A strongly reduced level of Ezh2 was found in mKO RGCs as compared to WT RGCs. ( C) Epifluorescence images of retinal sections taken from P0 WT and mKO mice that were immunolabeled for H3K27me3 (red) and nuclear marker 4’,6-Diamidino-2-Phenylindole (DAPI; blue). Note the higher level of H3K27me3 signals in the mKO retina compared to WT retina. Scale bar: 50 μm.

Journal: PLoS ONE

Article Title: Ezh2 does not mediate retinal ganglion cell homeostasis or their susceptibility to injury

doi: 10.1371/journal.pone.0191853

Figure Lengend Snippet: (A) PCR genotyping of Ezh2 and Cre genes. (B) Representative result of Western blot of Ezh2 expression in RGCs purified from P0 WT and mKO mice. GAPDH was used as a loading control. A strongly reduced level of Ezh2 was found in mKO RGCs as compared to WT RGCs. ( C) Epifluorescence images of retinal sections taken from P0 WT and mKO mice that were immunolabeled for H3K27me3 (red) and nuclear marker 4’,6-Diamidino-2-Phenylindole (DAPI; blue). Note the higher level of H3K27me3 signals in the mKO retina compared to WT retina. Scale bar: 50 μm.

Article Snippet: To detect the Ezh2 floxed gene, one μl of genomic DNA from a mouse tail and primers for Ezh2 ( F: CTGCTCTGAATGGCAACTCC ; R: TTATTCATAGAGCCACCTGG ) were added to a mixture of solution containing Apex TaqDNA Polymerase (Cat. No. 42–409), Apex buffer, and MgCl 2 from Genesee Scientific (San Diego, CA), and dNTP (Cat. No. 10297–018; Invitrogen).

Techniques: Western Blot, Expressing, Purification, Control, Immunolabeling, Marker

(A) Volcano plot showing fold changes (fc) of all genes detected from RGCs of mKO mice against control mice. Statistical significance (green dots) was defined as P <0.05 with a fold change ≥ +1.5 or ≤ -1.5 when compared to WT; non-significant changes (orange dots) fulfill either one or none of these two criteria. 997 genes were found with fc ≥ +1.5 and 1,220 genes with fc ≤ -1.5. Arrow points to the Ezh2 site. (B,C ) Pie charts represent depicted GO terms for upregulated (B) and downregulated (C) genes with │fc│ ≥ 1.5. No GO term in either up- or downregulated gene group were found to be specifically related to eye development. ( D) RT-PCR verification of mRNA levels of retinal related genes in RGCs purified from P5 floxed littermate control (white bar; n = 4) and mKO (black bar; n = 7) mouse pups. CRAL: Cellular retinaldehyde binding protein ; Tuj1: βIII-tubulin (Tubb3) ; Brn: Brn3a (Pou4f1) ; Rho: Rhodopsin ; Rec: Recoverin (* P < 0 . 05 by one-way ANOVA ).

Journal: PLoS ONE

Article Title: Ezh2 does not mediate retinal ganglion cell homeostasis or their susceptibility to injury

doi: 10.1371/journal.pone.0191853

Figure Lengend Snippet: (A) Volcano plot showing fold changes (fc) of all genes detected from RGCs of mKO mice against control mice. Statistical significance (green dots) was defined as P <0.05 with a fold change ≥ +1.5 or ≤ -1.5 when compared to WT; non-significant changes (orange dots) fulfill either one or none of these two criteria. 997 genes were found with fc ≥ +1.5 and 1,220 genes with fc ≤ -1.5. Arrow points to the Ezh2 site. (B,C ) Pie charts represent depicted GO terms for upregulated (B) and downregulated (C) genes with │fc│ ≥ 1.5. No GO term in either up- or downregulated gene group were found to be specifically related to eye development. ( D) RT-PCR verification of mRNA levels of retinal related genes in RGCs purified from P5 floxed littermate control (white bar; n = 4) and mKO (black bar; n = 7) mouse pups. CRAL: Cellular retinaldehyde binding protein ; Tuj1: βIII-tubulin (Tubb3) ; Brn: Brn3a (Pou4f1) ; Rho: Rhodopsin ; Rec: Recoverin (* P < 0 . 05 by one-way ANOVA ).

Article Snippet: To detect the Ezh2 floxed gene, one μl of genomic DNA from a mouse tail and primers for Ezh2 ( F: CTGCTCTGAATGGCAACTCC ; R: TTATTCATAGAGCCACCTGG ) were added to a mixture of solution containing Apex TaqDNA Polymerase (Cat. No. 42–409), Apex buffer, and MgCl 2 from Genesee Scientific (San Diego, CA), and dNTP (Cat. No. 10297–018; Invitrogen).

Techniques: Control, Reverse Transcription Polymerase Chain Reaction, Purification, Binding Assay