|
ATCC
mr s aureus atcc baa 41 Mr S Aureus Atcc Baa 41, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mr s aureus atcc baa 41/product/ATCC Average 95 stars, based on 1 article reviews
mr s aureus atcc baa 41 - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
|
ATCC
sars cov 2 grna ![]() Sars Cov 2 Grna, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sars cov 2 grna/product/ATCC Average 95 stars, based on 1 article reviews
sars cov 2 grna - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
organisms ![]() Organisms, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/organisms/product/Jackson Laboratory Average 86 stars, based on 1 article reviews
organisms - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
mouse strains ![]() Mouse Strains, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse strains/product/Jackson Laboratory Average 86 stars, based on 1 article reviews
mouse strains - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Addgene inc
270 gcaattgttgttgttaaattccgttttgcgacgatgc ![]() 270 Gcaattgttgttgttaaattccgttttgcgacgatgc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/270 gcaattgttgttgttaaattccgttttgcgacgatgc/product/Addgene inc Average 90 stars, based on 1 article reviews
270 gcaattgttgttgttaaattccgttttgcgacgatgc - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
OriGene
polyclonal rabbit anti vacv le antibody ![]() Polyclonal Rabbit Anti Vacv Le Antibody, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/polyclonal rabbit anti vacv le antibody/product/OriGene Average 93 stars, based on 1 article reviews
polyclonal rabbit anti vacv le antibody - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
dennd3 coding sequence ![]() Dennd3 Coding Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dennd3 coding sequence/product/Addgene inc Average 90 stars, based on 1 article reviews
dennd3 coding sequence - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
ATCC
atcc accession numbers 207184 ![]() Atcc Accession Numbers 207184, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/atcc accession numbers 207184/product/ATCC Average 90 stars, based on 1 article reviews
atcc accession numbers 207184 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Addgene inc
c321 δa ![]() C321 δa, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c321 δa/product/Addgene inc Average 93 stars, based on 1 article reviews
c321 δa - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
e coli c321 δa exp ![]() E Coli C321 δa Exp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/e coli c321 δa exp/product/Addgene inc Average 93 stars, based on 1 article reviews
e coli c321 δa exp - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Carolina Biological
escherichia coli k12 strain ![]() Escherichia Coli K12 Strain, supplied by Carolina Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/escherichia coli k12 strain/product/Carolina Biological Average 93 stars, based on 1 article reviews
escherichia coli k12 strain - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
ATCC
p aeruginosa atcc 27853 ![]() P Aeruginosa Atcc 27853, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/p aeruginosa atcc 27853/product/ATCC Average 99 stars, based on 1 article reviews
p aeruginosa atcc 27853 - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
Image Search Results
Journal: PeerJ
Article Title: Nationwide wastewater sequencing surveillance of SARS-CoV-2 lineages: validation against clinical data across 28 U.S. states
doi: 10.7717/peerj.20941
Figure Lengend Snippet: Spearman rank correlation coefficient between wastewater abundances and clinical abundances of SARS-CoV-2 lineages. All correlations were positive and significant after a Bonferroni correction, indicating clear agreement. Lower correlation coefficients are thought to be a result of either limited data points (BA) or ongoing epidemiological dynamics (LF, KP) for more recent lineages.
Article Snippet: For all sequencing runs,
Techniques:
Journal: PeerJ
Article Title: Nationwide wastewater sequencing surveillance of SARS-CoV-2 lineages: validation against clinical data across 28 U.S. states
doi: 10.7717/peerj.20941
Figure Lengend Snippet: Box and whisker plot of days from average emergence (defined as the date in which a lineage represented over 10% of the total abundance of lineages in at least 5 of our sites) for each SARS-CoV-2 lineage lineage. Each dot represents an individual WWTP. A larger spread indicates a slower spread across the country. Negative values represent an earlier emergence. Each of these dates is calculated with respect to each lineage’s average emergence across all sites.
Article Snippet: For all sequencing runs,
Techniques: Whisker Assay
Journal: PLoS ONE
Article Title: Development of a Genus-Specific Antigen Capture ELISA for Orthopoxviruses – Target Selection and Optimized Screening
doi: 10.1371/journal.pone.0150110
Figure Lengend Snippet: A . Conservation of immunogenic epitopes of recombinant proteins was verified through the recognition of immobilized surface proteins by vaccinia immunoglobulin (VIG) employing an indirect ELISA. Lysates from vaccinia virus infected (VACV NYCBOH ) or non-infected HEp-2 cells were used as the positive or negative control. B . The reactivity of anti-A27, -L1, -D8 and -H3 antibodies (1:1000) against VACV-infected (strain NYCBOH) or non-infected (n-) HEp-2 cells (40 μg lysate per lane) by western immunoblotting. HRP-labelled goat anti-rabbit or rabbit anti-goat IgG antibodies (1:5000) were used for detection. C . Percentage of plaque reduction (PRNT; ranging from 0% to 100%) for two-fold serial dilutions of anti-A27, -L1, -D8 and -H3 antibodies. VIG was included as the positive control. D . IFA of VACV LE infected Hep-2 cells with different combinations of polyclonal antibodies targeting surface proteins (A27, L1, D8 and H3) or vaccinia virus (VACV). Compared to the other antibodies, for the analysis of anti-H3 stained infected cells, the detector gain had to be increased due to the lower signal intensity. Antibodies were either stained with species-specific FITC-labelled secondary antibodies (green) or labeled directly with DyLight 649 (red). Cell nuclei were counterstained with DAPI (blue). Scale bar = 100 μm.
Article Snippet: A
Techniques: Recombinant, Indirect ELISA, Virus, Infection, Negative Control, Western Blot, Positive Control, Staining, Labeling
Journal: PLoS ONE
Article Title: Development of a Genus-Specific Antigen Capture ELISA for Orthopoxviruses – Target Selection and Optimized Screening
doi: 10.1371/journal.pone.0150110
Figure Lengend Snippet: A . Immobilized recombinant proteins or purified UV-inactivated VACV NYCBOH particles were incubated with a dilution series of purified biotinylated anti-A27, -D8, -H3 and -L1 antibodies in an indirect ELISA. Detection was done with SA-pHRP (1:5000). B . Representative electron microscopic pictures of anti-A27, -D8, or -H3 antibodies binding to purified VACV NYCBOH . Biotinylated antibodies were detected using 5 nm immunogold labelled streptavidin. Scale bars = 100 nm. C . Box-and-whisker plot for quantification of the number of gold particles per viral particle (whiskers: min to max; A27 n = 111; D8 n = 109 viral particles analyzed).
Article Snippet: A
Techniques: Recombinant, Purification, Incubation, Indirect ELISA, Binding Assay, Whisker Assay
Journal: PLoS ONE
Article Title: Development of a Genus-Specific Antigen Capture ELISA for Orthopoxviruses – Target Selection and Optimized Screening
doi: 10.1371/journal.pone.0150110
Figure Lengend Snippet: A . Binding epitopes and multiple sequence alignment (NCBI BLink) of different OPV strains. Identical sequences with the prominent strain are denoted in brackets, followed by the number of identical sequences deposited in GenBank. The binding epitopes for mAb A3/710 from amino acid 13 to 27 (A) and all other anti-A27 mAbs from amino acid 24 to 38 (B) border the heparin binding site (HBS) on A27. Both the VACV NYCBOH strain and E . coli derived A27 based on CPXV calpox DNA show 100% sequence identity with the reference strain VACV WR in this region. B . Compatibility of all eight anti-A27 mAbs for antigen capture ELISA. All possible combinations of coating antibodies (x-axis) and biotinylated detection were paired and tested for the detection of 5×10 6 PFU/ml UV-inactivated VACV NYCBOH . Shown are representative results for the highest virus concentration tested. The results from the titration series are shown in . C . SPR sensorgrams to determine the binding kinetics of anti-A27 mAbs. Measured responses (double referenced resonance units RU; difference between flow cell 2 minus flow cell 1) are shown as red lines whereas black lines represent results from fitting a 1:1 Langmuir interaction.
Article Snippet: A
Techniques: Binding Assay, Sequencing, Derivative Assay, Enzyme-linked Immunosorbent Assay, Virus, Concentration Assay, Titration
Journal: PLoS ONE
Article Title: Development of a Genus-Specific Antigen Capture ELISA for Orthopoxviruses – Target Selection and Optimized Screening
doi: 10.1371/journal.pone.0150110
Figure Lengend Snippet: A . Titration curve of rA27 with the antigen capture ELISA. B . To check for cross-reactivity, PPXV, HSV-1 and tanapox virus were tested. C . Detection of different VACV strains by the newly developed assay. D . Detection of different OPV.
Article Snippet: A
Techniques: Titration, Enzyme-linked Immunosorbent Assay, Virus
Journal: PLoS ONE
Article Title: Development of a Genus-Specific Antigen Capture ELISA for Orthopoxviruses – Target Selection and Optimized Screening
doi: 10.1371/journal.pone.0150110
Figure Lengend Snippet: Limits of detection (LOD) of the newly developed A27-specific antigen sandwich ELISA for different OPV strains.
Article Snippet: A
Techniques: Sandwich ELISA