strains Search Results


95
ATCC mr s aureus atcc baa 41
Mr S Aureus Atcc Baa 41, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mr s aureus atcc baa 41/product/ATCC
Average 95 stars, based on 1 article reviews
mr s aureus atcc baa 41 - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

95
ATCC sars cov 2 grna
Spearman rank correlation coefficient between wastewater abundances and clinical <t>abundances</t> <t>of</t> <t>SARS-CoV-2</t> lineages. All correlations were positive and significant after a Bonferroni correction, indicating clear agreement. Lower correlation coefficients are thought to be a result of either limited data points (BA) or ongoing epidemiological dynamics (LF, KP) for more recent lineages.
Sars Cov 2 Grna, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sars cov 2 grna/product/ATCC
Average 95 stars, based on 1 article reviews
sars cov 2 grna - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

86
Jackson Laboratory organisms
Spearman rank correlation coefficient between wastewater abundances and clinical <t>abundances</t> <t>of</t> <t>SARS-CoV-2</t> lineages. All correlations were positive and significant after a Bonferroni correction, indicating clear agreement. Lower correlation coefficients are thought to be a result of either limited data points (BA) or ongoing epidemiological dynamics (LF, KP) for more recent lineages.
Organisms, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/organisms/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
organisms - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Jackson Laboratory mouse strains
Spearman rank correlation coefficient between wastewater abundances and clinical <t>abundances</t> <t>of</t> <t>SARS-CoV-2</t> lineages. All correlations were positive and significant after a Bonferroni correction, indicating clear agreement. Lower correlation coefficients are thought to be a result of either limited data points (BA) or ongoing epidemiological dynamics (LF, KP) for more recent lineages.
Mouse Strains, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse strains/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
mouse strains - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

90
Addgene inc 270 gcaattgttgttgttaaattccgttttgcgacgatgc
Spearman rank correlation coefficient between wastewater abundances and clinical <t>abundances</t> <t>of</t> <t>SARS-CoV-2</t> lineages. All correlations were positive and significant after a Bonferroni correction, indicating clear agreement. Lower correlation coefficients are thought to be a result of either limited data points (BA) or ongoing epidemiological dynamics (LF, KP) for more recent lineages.
270 Gcaattgttgttgttaaattccgttttgcgacgatgc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/270 gcaattgttgttgttaaattccgttttgcgacgatgc/product/Addgene inc
Average 90 stars, based on 1 article reviews
270 gcaattgttgttgttaaattccgttttgcgacgatgc - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

93
OriGene polyclonal rabbit anti vacv le antibody
A . Conservation of immunogenic epitopes of recombinant proteins was verified through the recognition of immobilized surface proteins by vaccinia immunoglobulin (VIG) employing an indirect ELISA. Lysates from vaccinia virus infected <t>(VACV</t> NYCBOH ) or non-infected HEp-2 cells were used as the positive or negative control. B . The reactivity of anti-A27, -L1, -D8 and -H3 antibodies (1:1000) against VACV-infected (strain NYCBOH) or non-infected (n-) HEp-2 cells (40 μg lysate per lane) by western immunoblotting. HRP-labelled goat anti-rabbit or rabbit anti-goat IgG antibodies (1:5000) were used for detection. C . Percentage of plaque reduction (PRNT; ranging from 0% to 100%) for two-fold serial dilutions of anti-A27, -L1, -D8 and -H3 antibodies. VIG was included as the positive control. D . IFA of VACV LE infected Hep-2 cells with different combinations of <t>polyclonal</t> antibodies targeting surface proteins (A27, L1, D8 and H3) or vaccinia virus (VACV). Compared to the other antibodies, for the analysis of anti-H3 stained infected cells, the detector gain had to be increased due to the lower signal intensity. Antibodies were either stained with species-specific FITC-labelled secondary antibodies (green) or labeled directly with DyLight 649 (red). Cell nuclei were counterstained with DAPI (blue). Scale bar = 100 μm.
Polyclonal Rabbit Anti Vacv Le Antibody, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polyclonal rabbit anti vacv le antibody/product/OriGene
Average 93 stars, based on 1 article reviews
polyclonal rabbit anti vacv le antibody - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
Addgene inc dennd3 coding sequence
A . Conservation of immunogenic epitopes of recombinant proteins was verified through the recognition of immobilized surface proteins by vaccinia immunoglobulin (VIG) employing an indirect ELISA. Lysates from vaccinia virus infected <t>(VACV</t> NYCBOH ) or non-infected HEp-2 cells were used as the positive or negative control. B . The reactivity of anti-A27, -L1, -D8 and -H3 antibodies (1:1000) against VACV-infected (strain NYCBOH) or non-infected (n-) HEp-2 cells (40 μg lysate per lane) by western immunoblotting. HRP-labelled goat anti-rabbit or rabbit anti-goat IgG antibodies (1:5000) were used for detection. C . Percentage of plaque reduction (PRNT; ranging from 0% to 100%) for two-fold serial dilutions of anti-A27, -L1, -D8 and -H3 antibodies. VIG was included as the positive control. D . IFA of VACV LE infected Hep-2 cells with different combinations of <t>polyclonal</t> antibodies targeting surface proteins (A27, L1, D8 and H3) or vaccinia virus (VACV). Compared to the other antibodies, for the analysis of anti-H3 stained infected cells, the detector gain had to be increased due to the lower signal intensity. Antibodies were either stained with species-specific FITC-labelled secondary antibodies (green) or labeled directly with DyLight 649 (red). Cell nuclei were counterstained with DAPI (blue). Scale bar = 100 μm.
Dennd3 Coding Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dennd3 coding sequence/product/Addgene inc
Average 90 stars, based on 1 article reviews
dennd3 coding sequence - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
ATCC atcc accession numbers 207184
A . Conservation of immunogenic epitopes of recombinant proteins was verified through the recognition of immobilized surface proteins by vaccinia immunoglobulin (VIG) employing an indirect ELISA. Lysates from vaccinia virus infected <t>(VACV</t> NYCBOH ) or non-infected HEp-2 cells were used as the positive or negative control. B . The reactivity of anti-A27, -L1, -D8 and -H3 antibodies (1:1000) against VACV-infected (strain NYCBOH) or non-infected (n-) HEp-2 cells (40 μg lysate per lane) by western immunoblotting. HRP-labelled goat anti-rabbit or rabbit anti-goat IgG antibodies (1:5000) were used for detection. C . Percentage of plaque reduction (PRNT; ranging from 0% to 100%) for two-fold serial dilutions of anti-A27, -L1, -D8 and -H3 antibodies. VIG was included as the positive control. D . IFA of VACV LE infected Hep-2 cells with different combinations of <t>polyclonal</t> antibodies targeting surface proteins (A27, L1, D8 and H3) or vaccinia virus (VACV). Compared to the other antibodies, for the analysis of anti-H3 stained infected cells, the detector gain had to be increased due to the lower signal intensity. Antibodies were either stained with species-specific FITC-labelled secondary antibodies (green) or labeled directly with DyLight 649 (red). Cell nuclei were counterstained with DAPI (blue). Scale bar = 100 μm.
Atcc Accession Numbers 207184, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/atcc accession numbers 207184/product/ATCC
Average 90 stars, based on 1 article reviews
atcc accession numbers 207184 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

93
Addgene inc c321 δa
A . Conservation of immunogenic epitopes of recombinant proteins was verified through the recognition of immobilized surface proteins by vaccinia immunoglobulin (VIG) employing an indirect ELISA. Lysates from vaccinia virus infected <t>(VACV</t> NYCBOH ) or non-infected HEp-2 cells were used as the positive or negative control. B . The reactivity of anti-A27, -L1, -D8 and -H3 antibodies (1:1000) against VACV-infected (strain NYCBOH) or non-infected (n-) HEp-2 cells (40 μg lysate per lane) by western immunoblotting. HRP-labelled goat anti-rabbit or rabbit anti-goat IgG antibodies (1:5000) were used for detection. C . Percentage of plaque reduction (PRNT; ranging from 0% to 100%) for two-fold serial dilutions of anti-A27, -L1, -D8 and -H3 antibodies. VIG was included as the positive control. D . IFA of VACV LE infected Hep-2 cells with different combinations of <t>polyclonal</t> antibodies targeting surface proteins (A27, L1, D8 and H3) or vaccinia virus (VACV). Compared to the other antibodies, for the analysis of anti-H3 stained infected cells, the detector gain had to be increased due to the lower signal intensity. Antibodies were either stained with species-specific FITC-labelled secondary antibodies (green) or labeled directly with DyLight 649 (red). Cell nuclei were counterstained with DAPI (blue). Scale bar = 100 μm.
C321 δa, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c321 δa/product/Addgene inc
Average 93 stars, based on 1 article reviews
c321 δa - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Addgene inc e coli c321 δa exp
A . Conservation of immunogenic epitopes of recombinant proteins was verified through the recognition of immobilized surface proteins by vaccinia immunoglobulin (VIG) employing an indirect ELISA. Lysates from vaccinia virus infected <t>(VACV</t> NYCBOH ) or non-infected HEp-2 cells were used as the positive or negative control. B . The reactivity of anti-A27, -L1, -D8 and -H3 antibodies (1:1000) against VACV-infected (strain NYCBOH) or non-infected (n-) HEp-2 cells (40 μg lysate per lane) by western immunoblotting. HRP-labelled goat anti-rabbit or rabbit anti-goat IgG antibodies (1:5000) were used for detection. C . Percentage of plaque reduction (PRNT; ranging from 0% to 100%) for two-fold serial dilutions of anti-A27, -L1, -D8 and -H3 antibodies. VIG was included as the positive control. D . IFA of VACV LE infected Hep-2 cells with different combinations of <t>polyclonal</t> antibodies targeting surface proteins (A27, L1, D8 and H3) or vaccinia virus (VACV). Compared to the other antibodies, for the analysis of anti-H3 stained infected cells, the detector gain had to be increased due to the lower signal intensity. Antibodies were either stained with species-specific FITC-labelled secondary antibodies (green) or labeled directly with DyLight 649 (red). Cell nuclei were counterstained with DAPI (blue). Scale bar = 100 μm.
E Coli C321 δa Exp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e coli c321 δa exp/product/Addgene inc
Average 93 stars, based on 1 article reviews
e coli c321 δa exp - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Carolina Biological escherichia coli k12 strain
A . Conservation of immunogenic epitopes of recombinant proteins was verified through the recognition of immobilized surface proteins by vaccinia immunoglobulin (VIG) employing an indirect ELISA. Lysates from vaccinia virus infected <t>(VACV</t> NYCBOH ) or non-infected HEp-2 cells were used as the positive or negative control. B . The reactivity of anti-A27, -L1, -D8 and -H3 antibodies (1:1000) against VACV-infected (strain NYCBOH) or non-infected (n-) HEp-2 cells (40 μg lysate per lane) by western immunoblotting. HRP-labelled goat anti-rabbit or rabbit anti-goat IgG antibodies (1:5000) were used for detection. C . Percentage of plaque reduction (PRNT; ranging from 0% to 100%) for two-fold serial dilutions of anti-A27, -L1, -D8 and -H3 antibodies. VIG was included as the positive control. D . IFA of VACV LE infected Hep-2 cells with different combinations of <t>polyclonal</t> antibodies targeting surface proteins (A27, L1, D8 and H3) or vaccinia virus (VACV). Compared to the other antibodies, for the analysis of anti-H3 stained infected cells, the detector gain had to be increased due to the lower signal intensity. Antibodies were either stained with species-specific FITC-labelled secondary antibodies (green) or labeled directly with DyLight 649 (red). Cell nuclei were counterstained with DAPI (blue). Scale bar = 100 μm.
Escherichia Coli K12 Strain, supplied by Carolina Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/escherichia coli k12 strain/product/Carolina Biological
Average 93 stars, based on 1 article reviews
escherichia coli k12 strain - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

99
ATCC p aeruginosa atcc 27853
A . Conservation of immunogenic epitopes of recombinant proteins was verified through the recognition of immobilized surface proteins by vaccinia immunoglobulin (VIG) employing an indirect ELISA. Lysates from vaccinia virus infected <t>(VACV</t> NYCBOH ) or non-infected HEp-2 cells were used as the positive or negative control. B . The reactivity of anti-A27, -L1, -D8 and -H3 antibodies (1:1000) against VACV-infected (strain NYCBOH) or non-infected (n-) HEp-2 cells (40 μg lysate per lane) by western immunoblotting. HRP-labelled goat anti-rabbit or rabbit anti-goat IgG antibodies (1:5000) were used for detection. C . Percentage of plaque reduction (PRNT; ranging from 0% to 100%) for two-fold serial dilutions of anti-A27, -L1, -D8 and -H3 antibodies. VIG was included as the positive control. D . IFA of VACV LE infected Hep-2 cells with different combinations of <t>polyclonal</t> antibodies targeting surface proteins (A27, L1, D8 and H3) or vaccinia virus (VACV). Compared to the other antibodies, for the analysis of anti-H3 stained infected cells, the detector gain had to be increased due to the lower signal intensity. Antibodies were either stained with species-specific FITC-labelled secondary antibodies (green) or labeled directly with DyLight 649 (red). Cell nuclei were counterstained with DAPI (blue). Scale bar = 100 μm.
P Aeruginosa Atcc 27853, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p aeruginosa atcc 27853/product/ATCC
Average 99 stars, based on 1 article reviews
p aeruginosa atcc 27853 - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

Image Search Results


Spearman rank correlation coefficient between wastewater abundances and clinical abundances of SARS-CoV-2 lineages. All correlations were positive and significant after a Bonferroni correction, indicating clear agreement. Lower correlation coefficients are thought to be a result of either limited data points (BA) or ongoing epidemiological dynamics (LF, KP) for more recent lineages.

Journal: PeerJ

Article Title: Nationwide wastewater sequencing surveillance of SARS-CoV-2 lineages: validation against clinical data across 28 U.S. states

doi: 10.7717/peerj.20941

Figure Lengend Snippet: Spearman rank correlation coefficient between wastewater abundances and clinical abundances of SARS-CoV-2 lineages. All correlations were positive and significant after a Bonferroni correction, indicating clear agreement. Lower correlation coefficients are thought to be a result of either limited data points (BA) or ongoing epidemiological dynamics (LF, KP) for more recent lineages.

Article Snippet: For all sequencing runs, SARS-CoV-2 gRNA (ATCC VR-1986D), an early isolate of the original SARS-CoV-2 virus from March of 2020 in Washington, is used as a positive control (GenBank: MT246667.1 ).

Techniques:

Box and whisker plot of days from average emergence (defined as the date in which a lineage represented over 10% of the total abundance of lineages in at least 5 of our sites) for each SARS-CoV-2 lineage lineage. Each dot represents an individual WWTP. A larger spread indicates a slower spread across the country. Negative values represent an earlier emergence. Each of these dates is calculated with respect to each lineage’s average emergence across all sites.

Journal: PeerJ

Article Title: Nationwide wastewater sequencing surveillance of SARS-CoV-2 lineages: validation against clinical data across 28 U.S. states

doi: 10.7717/peerj.20941

Figure Lengend Snippet: Box and whisker plot of days from average emergence (defined as the date in which a lineage represented over 10% of the total abundance of lineages in at least 5 of our sites) for each SARS-CoV-2 lineage lineage. Each dot represents an individual WWTP. A larger spread indicates a slower spread across the country. Negative values represent an earlier emergence. Each of these dates is calculated with respect to each lineage’s average emergence across all sites.

Article Snippet: For all sequencing runs, SARS-CoV-2 gRNA (ATCC VR-1986D), an early isolate of the original SARS-CoV-2 virus from March of 2020 in Washington, is used as a positive control (GenBank: MT246667.1 ).

Techniques: Whisker Assay

A . Conservation of immunogenic epitopes of recombinant proteins was verified through the recognition of immobilized surface proteins by vaccinia immunoglobulin (VIG) employing an indirect ELISA. Lysates from vaccinia virus infected (VACV NYCBOH ) or non-infected HEp-2 cells were used as the positive or negative control. B . The reactivity of anti-A27, -L1, -D8 and -H3 antibodies (1:1000) against VACV-infected (strain NYCBOH) or non-infected (n-) HEp-2 cells (40 μg lysate per lane) by western immunoblotting. HRP-labelled goat anti-rabbit or rabbit anti-goat IgG antibodies (1:5000) were used for detection. C . Percentage of plaque reduction (PRNT; ranging from 0% to 100%) for two-fold serial dilutions of anti-A27, -L1, -D8 and -H3 antibodies. VIG was included as the positive control. D . IFA of VACV LE infected Hep-2 cells with different combinations of polyclonal antibodies targeting surface proteins (A27, L1, D8 and H3) or vaccinia virus (VACV). Compared to the other antibodies, for the analysis of anti-H3 stained infected cells, the detector gain had to be increased due to the lower signal intensity. Antibodies were either stained with species-specific FITC-labelled secondary antibodies (green) or labeled directly with DyLight 649 (red). Cell nuclei were counterstained with DAPI (blue). Scale bar = 100 μm.

Journal: PLoS ONE

Article Title: Development of a Genus-Specific Antigen Capture ELISA for Orthopoxviruses – Target Selection and Optimized Screening

doi: 10.1371/journal.pone.0150110

Figure Lengend Snippet: A . Conservation of immunogenic epitopes of recombinant proteins was verified through the recognition of immobilized surface proteins by vaccinia immunoglobulin (VIG) employing an indirect ELISA. Lysates from vaccinia virus infected (VACV NYCBOH ) or non-infected HEp-2 cells were used as the positive or negative control. B . The reactivity of anti-A27, -L1, -D8 and -H3 antibodies (1:1000) against VACV-infected (strain NYCBOH) or non-infected (n-) HEp-2 cells (40 μg lysate per lane) by western immunoblotting. HRP-labelled goat anti-rabbit or rabbit anti-goat IgG antibodies (1:5000) were used for detection. C . Percentage of plaque reduction (PRNT; ranging from 0% to 100%) for two-fold serial dilutions of anti-A27, -L1, -D8 and -H3 antibodies. VIG was included as the positive control. D . IFA of VACV LE infected Hep-2 cells with different combinations of polyclonal antibodies targeting surface proteins (A27, L1, D8 and H3) or vaccinia virus (VACV). Compared to the other antibodies, for the analysis of anti-H3 stained infected cells, the detector gain had to be increased due to the lower signal intensity. Antibodies were either stained with species-specific FITC-labelled secondary antibodies (green) or labeled directly with DyLight 649 (red). Cell nuclei were counterstained with DAPI (blue). Scale bar = 100 μm.

Article Snippet: A polyclonal rabbit anti-VACV LE antibody was obtained from Acris Antibodies (Herford, Germany).

Techniques: Recombinant, Indirect ELISA, Virus, Infection, Negative Control, Western Blot, Positive Control, Staining, Labeling

A . Immobilized recombinant proteins or purified UV-inactivated VACV NYCBOH particles were incubated with a dilution series of purified biotinylated anti-A27, -D8, -H3 and -L1 antibodies in an indirect ELISA. Detection was done with SA-pHRP (1:5000). B . Representative electron microscopic pictures of anti-A27, -D8, or -H3 antibodies binding to purified VACV NYCBOH . Biotinylated antibodies were detected using 5 nm immunogold labelled streptavidin. Scale bars = 100 nm. C . Box-and-whisker plot for quantification of the number of gold particles per viral particle (whiskers: min to max; A27 n = 111; D8 n = 109 viral particles analyzed).

Journal: PLoS ONE

Article Title: Development of a Genus-Specific Antigen Capture ELISA for Orthopoxviruses – Target Selection and Optimized Screening

doi: 10.1371/journal.pone.0150110

Figure Lengend Snippet: A . Immobilized recombinant proteins or purified UV-inactivated VACV NYCBOH particles were incubated with a dilution series of purified biotinylated anti-A27, -D8, -H3 and -L1 antibodies in an indirect ELISA. Detection was done with SA-pHRP (1:5000). B . Representative electron microscopic pictures of anti-A27, -D8, or -H3 antibodies binding to purified VACV NYCBOH . Biotinylated antibodies were detected using 5 nm immunogold labelled streptavidin. Scale bars = 100 nm. C . Box-and-whisker plot for quantification of the number of gold particles per viral particle (whiskers: min to max; A27 n = 111; D8 n = 109 viral particles analyzed).

Article Snippet: A polyclonal rabbit anti-VACV LE antibody was obtained from Acris Antibodies (Herford, Germany).

Techniques: Recombinant, Purification, Incubation, Indirect ELISA, Binding Assay, Whisker Assay

A . Binding epitopes and multiple sequence alignment (NCBI BLink) of different OPV strains. Identical sequences with the prominent strain are denoted in brackets, followed by the number of identical sequences deposited in GenBank. The binding epitopes for mAb A3/710 from amino acid 13 to 27 (A) and all other anti-A27 mAbs from amino acid 24 to 38 (B) border the heparin binding site (HBS) on A27. Both the VACV NYCBOH strain and E . coli derived A27 based on CPXV calpox DNA show 100% sequence identity with the reference strain VACV WR in this region. B . Compatibility of all eight anti-A27 mAbs for antigen capture ELISA. All possible combinations of coating antibodies (x-axis) and biotinylated detection were paired and tested for the detection of 5×10 6 PFU/ml UV-inactivated VACV NYCBOH . Shown are representative results for the highest virus concentration tested. The results from the titration series are shown in . C . SPR sensorgrams to determine the binding kinetics of anti-A27 mAbs. Measured responses (double referenced resonance units RU; difference between flow cell 2 minus flow cell 1) are shown as red lines whereas black lines represent results from fitting a 1:1 Langmuir interaction.

Journal: PLoS ONE

Article Title: Development of a Genus-Specific Antigen Capture ELISA for Orthopoxviruses – Target Selection and Optimized Screening

doi: 10.1371/journal.pone.0150110

Figure Lengend Snippet: A . Binding epitopes and multiple sequence alignment (NCBI BLink) of different OPV strains. Identical sequences with the prominent strain are denoted in brackets, followed by the number of identical sequences deposited in GenBank. The binding epitopes for mAb A3/710 from amino acid 13 to 27 (A) and all other anti-A27 mAbs from amino acid 24 to 38 (B) border the heparin binding site (HBS) on A27. Both the VACV NYCBOH strain and E . coli derived A27 based on CPXV calpox DNA show 100% sequence identity with the reference strain VACV WR in this region. B . Compatibility of all eight anti-A27 mAbs for antigen capture ELISA. All possible combinations of coating antibodies (x-axis) and biotinylated detection were paired and tested for the detection of 5×10 6 PFU/ml UV-inactivated VACV NYCBOH . Shown are representative results for the highest virus concentration tested. The results from the titration series are shown in . C . SPR sensorgrams to determine the binding kinetics of anti-A27 mAbs. Measured responses (double referenced resonance units RU; difference between flow cell 2 minus flow cell 1) are shown as red lines whereas black lines represent results from fitting a 1:1 Langmuir interaction.

Article Snippet: A polyclonal rabbit anti-VACV LE antibody was obtained from Acris Antibodies (Herford, Germany).

Techniques: Binding Assay, Sequencing, Derivative Assay, Enzyme-linked Immunosorbent Assay, Virus, Concentration Assay, Titration

A . Titration curve of rA27 with the antigen capture ELISA. B . To check for cross-reactivity, PPXV, HSV-1 and tanapox virus were tested. C . Detection of different VACV strains by the newly developed assay. D . Detection of different OPV.

Journal: PLoS ONE

Article Title: Development of a Genus-Specific Antigen Capture ELISA for Orthopoxviruses – Target Selection and Optimized Screening

doi: 10.1371/journal.pone.0150110

Figure Lengend Snippet: A . Titration curve of rA27 with the antigen capture ELISA. B . To check for cross-reactivity, PPXV, HSV-1 and tanapox virus were tested. C . Detection of different VACV strains by the newly developed assay. D . Detection of different OPV.

Article Snippet: A polyclonal rabbit anti-VACV LE antibody was obtained from Acris Antibodies (Herford, Germany).

Techniques: Titration, Enzyme-linked Immunosorbent Assay, Virus

Limits of detection (LOD) of the newly developed A27-specific antigen sandwich ELISA for different OPV strains.

Journal: PLoS ONE

Article Title: Development of a Genus-Specific Antigen Capture ELISA for Orthopoxviruses – Target Selection and Optimized Screening

doi: 10.1371/journal.pone.0150110

Figure Lengend Snippet: Limits of detection (LOD) of the newly developed A27-specific antigen sandwich ELISA for different OPV strains.

Article Snippet: A polyclonal rabbit anti-VACV LE antibody was obtained from Acris Antibodies (Herford, Germany).

Techniques: Sandwich ELISA