Journal: Nature Communications

Article Title: Loss of Wwox drives metastasis in triple-negative breast cancer by JAK2/STAT3 axis

doi: 10.1038/s41467-018-05852-8

Figure Lengend Snippet: Wwox and p-STAT3 exhibit converse patterns of expression in breast cancer (BC) cells. a Western blotting was performed to detect p-STAT3 and Wwox levels in 12 human BC cell lines. The protein levels of p-STAT3 were detected. b 2D plots of total RNA-seq genes in Group 1 luminal cells (MCF-7, T47D, BT-474) and Group 2 basal cells (SUM159, HBL100, BT-549). Up- and downregulated genes with fold change ≥2.0 are highlighted. c KEGG pathway analysis of up-regulated genes in basal cells compared with luminal cells. d – f Western blot analysis of Wwox and p-STAT3 expression in SUM159 ( d ), HBL100 ( e ), and MDA-MB-231 cells ( f ) stably transfected with control (CT) or Wwox-encoding vectors. g , h IHC determination of Wwox and p-STAT3 expression in 90 human triple-negative BCs. Representative IHC staining images of Wwox and p-STAT3 ( g ); results are tabulated as shown ( h ); *** p < 0.001, χ 2 test, scale bar, 100 μm

Article Snippet: Antibodies and reagents were obtained as follows: anti-Wwox (sc-373846, WB, 1:1000; IHC, 1:100) antibody, STAT3 inhibitor Stattic, and all siRNAs from Santa Cruz Biotechnology; anti-STAT3 (9139S, western blot (WB), 1:1000; IP, 1:400), anti-p-STAT3 (9138S, WB, 1:1000; 9145S, IHC, 1:200), anti-JAK2 (3230S, WB, 1:1000; IP,1:200), anti-p-JAK2 (3771S, WB, 1:1000), anti-Myc (2272S, WB, 1:1000), and anti-HA (3724S, WB, 1:1000) primary antibodies and horseradish peroxidase (HRP)-conjugated secondary antibodies (7074S, 7076S, WB, 1:2000) from Cell Signaling Technology; anti-GAPDH (M2006M, WB, 1:5000) and anti-β-actin (M2011M, WB, 1:5000) antibodies from Abmart Company; anti-FLAG (SAB1306078, WB, 1:5000) antibody from Sigma-Aldrich; human recombinant IL-6 from R&D Systems; and Matrigel from BD Pharmingen.

Techniques: Expressing, Western Blot, RNA Sequencing, Stable Transfection, Transfection, Control, Immunohistochemistry

Journal: Nature Communications

Article Title: Loss of Wwox drives metastasis in triple-negative breast cancer by JAK2/STAT3 axis

doi: 10.1038/s41467-018-05852-8

Figure Lengend Snippet: Wwox inhibits metastasis and tumor proliferation. a , b Transwell migration assays were performed with SUM159 and MDA-MB-231 cells stably transfected with control or Wwox-encoding vectors. Representative images of migrated SUM159 ( a ) and MDA-MB-231 ( b ). Quantitative results are respectively illustrated for migration in a , b . Data represent the mean ± SD ( n = 3) from three independent experiments; ** p < 0.01, Student’s t -test. Scale bar, 100 μm. c – e Wwox inhibits MDA-MB-231 proliferation in vivo. Cells of mock-transfected MDA-MB-231 and Wwox-overexpressing MDA-MB-231(Wwox OE) lines were orthotopically transplanted into the mice mammary fat pad. Tumor sizes were monitored over a period of 21 days ( d ). At necropsy, tumors were harvested, photographed ( c ), and weighed. Results are presented as mean ± SD ( n = 6) of calculated tumor weight ( e ); ** p < 0.01, Student’s t -test. Scale bar, 1 cm. f – h Liver tissues were photographed, fixed, and stained with hematoxylin and eosin (H&E) ( g ); black arrows indicate the liver metastatic lesions ( f ). The number of metastatic lesions in each specimen was counted ( h ). Results are presented as mean ± SD ( n = 6); ** p < 0.01, Student’s t -test. ( f ), Scale bar, 1 cm, ( g ) scale bar: 100 μm. i Expression of STAT3-targeted genes was examined in indicated MDA-MB-231 cells. Results shown are mean ± SD from three repeats; * p < 0.05. j Western blot analysis of the levels of p-STAT3 in MDA-MB-231 Wwox-overexpressing tumors and control tumors from orthotopic xenograft transplantation experiments

Article Snippet: Antibodies and reagents were obtained as follows: anti-Wwox (sc-373846, WB, 1:1000; IHC, 1:100) antibody, STAT3 inhibitor Stattic, and all siRNAs from Santa Cruz Biotechnology; anti-STAT3 (9139S, western blot (WB), 1:1000; IP, 1:400), anti-p-STAT3 (9138S, WB, 1:1000; 9145S, IHC, 1:200), anti-JAK2 (3230S, WB, 1:1000; IP,1:200), anti-p-JAK2 (3771S, WB, 1:1000), anti-Myc (2272S, WB, 1:1000), and anti-HA (3724S, WB, 1:1000) primary antibodies and horseradish peroxidase (HRP)-conjugated secondary antibodies (7074S, 7076S, WB, 1:2000) from Cell Signaling Technology; anti-GAPDH (M2006M, WB, 1:5000) and anti-β-actin (M2011M, WB, 1:5000) antibodies from Abmart Company; anti-FLAG (SAB1306078, WB, 1:5000) antibody from Sigma-Aldrich; human recombinant IL-6 from R&D Systems; and Matrigel from BD Pharmingen.

Techniques: Migration, Stable Transfection, Transfection, Control, In Vivo, Staining, Expressing, Western Blot, Transplantation Assay

Journal: Nature Communications

Article Title: Loss of Wwox drives metastasis in triple-negative breast cancer by JAK2/STAT3 axis

doi: 10.1038/s41467-018-05852-8

Figure Lengend Snippet: Wwox inhibits STAT3 phosphorylation. a Co-immunoprecipitation of Wwox and STAT3 shows Wwox–STAT3 interaction in vivo. 293T cells were transfected with plasmids expressing Myc-tagged full-length Wwox or Flag-tagged full-length STAT3, as indicated. Whole-cell lysates were used in immunoprecipitation (IP) with anti-Myc antibody or anti-Flag M2 antibody. b Endogenous Wwox and STAT3 interact in vivo. Lysates of MCF-10A, MCF-7, and T47D cells were subjected to IP with anti-STAT3 antibodies. c , d Wwox inhibits STAT3 transcriptional activity. MCF-7 cells were co-transfected with APRE-luciferase reporter and Renilla luciferase reporter, in backgrounds providing depletion (via RNAi) of Wwox (Wwoxi) ( c ) or overexpression of Wwox (Wwox). d Relative luciferase activity data are presented as mean ± SD from three independent experiments; ** p < 0.01. e – g Wwox decreases the DNA-binding ability of STAT3. EMSA assays were performed using a biotin-labeled high-affinity binding site for STAT3. SUM159 cells were transfected with empty vector (V) or construct encoding Wwox or Wwox-Y33R mutant; MCF-7 cells were knocked down (KD) with Wwox siRNA ( e ). SUM159 or MCF-7 cells were treated with or without IL-6 for 30 min. Levels of the proteins used in EMSA are shown together with the p-STAT3 level in f , g . h , i Wwox suppresses STAT3 phoshorylation. Cells were treated with IL-6 for the indicated time intervals, using MCF-7 cells in which Wwox was knocked down (Wwox KD) or in SUM159 cells overexpressing Wwox (Wwox OE). Levels of phosphorylated STAT3 (p-STAT3) and total STAT3 were determined

Article Snippet: Antibodies and reagents were obtained as follows: anti-Wwox (sc-373846, WB, 1:1000; IHC, 1:100) antibody, STAT3 inhibitor Stattic, and all siRNAs from Santa Cruz Biotechnology; anti-STAT3 (9139S, western blot (WB), 1:1000; IP, 1:400), anti-p-STAT3 (9138S, WB, 1:1000; 9145S, IHC, 1:200), anti-JAK2 (3230S, WB, 1:1000; IP,1:200), anti-p-JAK2 (3771S, WB, 1:1000), anti-Myc (2272S, WB, 1:1000), and anti-HA (3724S, WB, 1:1000) primary antibodies and horseradish peroxidase (HRP)-conjugated secondary antibodies (7074S, 7076S, WB, 1:2000) from Cell Signaling Technology; anti-GAPDH (M2006M, WB, 1:5000) and anti-β-actin (M2011M, WB, 1:5000) antibodies from Abmart Company; anti-FLAG (SAB1306078, WB, 1:5000) antibody from Sigma-Aldrich; human recombinant IL-6 from R&D Systems; and Matrigel from BD Pharmingen.

Techniques: Phospho-proteomics, Immunoprecipitation, In Vivo, Transfection, Expressing, Activity Assay, Luciferase, Over Expression, Binding Assay, Labeling, Plasmid Preparation, Construct, Mutagenesis

Journal: Nature Communications

Article Title: Loss of Wwox drives metastasis in triple-negative breast cancer by JAK2/STAT3 axis

doi: 10.1038/s41467-018-05852-8

Figure Lengend Snippet: Wwox inhibits the interaction of JAK2 and STAT3. a Co-immunoprecipitation of Wwox and JAK2 shows Wwox–JAK2 interaction. 293T cells were transfected with plasmids expressing Myc-tagged full-length Wwox or HA-tagged full-length JAK2, as indicated. Whole-cell lysates were used in immunoprecipitation (IP) with anti-Myc antibody or anti-HA antibody. b Endogenous Wwox and JAK2 interact in vivo. Lysates of MCF-10A and T47D cells were subjected to IP with anti-JAK2 antibodies. c Wwox interacts with JAK2 mainly through the WW1 domain. IP and immunoblot (IB) of cell lysates from 293T cells expressing HA-tagged STAT3 and Myc-tagged Wwox or Myc-tagged truncated Wwox proteins (illustrated in Supplementary Fig. ). Whole-cell lysates were immunoprecipitated with anti-HA and immunoblotted with anti-Myc antibody. d Wwox reduces p-STAT3 and p-JAK2 levels. MDA-MB-231 cells were transfected with Wwox plasmids and were treated with IL-6 for 30 min. The whole-cell lysates were immunoblotted with the indicated antibodies. e Interaction pattern of Wwox and JAK2 under IL-6 stimulation. IP and IB of cell lysates from 293T cells expressing HA-tagged JAK2 and Myc-tagged Wwox; cells were treated with IL-6 for the indicated time spans. f Wwox inhibits the interaction of JAK2 with STAT3. MCF-7 cells were transfected with Wwox siRNA, along with IL-6 stimulation; cell lysates were subjected to IP and IB analyses

Article Snippet: Antibodies and reagents were obtained as follows: anti-Wwox (sc-373846, WB, 1:1000; IHC, 1:100) antibody, STAT3 inhibitor Stattic, and all siRNAs from Santa Cruz Biotechnology; anti-STAT3 (9139S, western blot (WB), 1:1000; IP, 1:400), anti-p-STAT3 (9138S, WB, 1:1000; 9145S, IHC, 1:200), anti-JAK2 (3230S, WB, 1:1000; IP,1:200), anti-p-JAK2 (3771S, WB, 1:1000), anti-Myc (2272S, WB, 1:1000), and anti-HA (3724S, WB, 1:1000) primary antibodies and horseradish peroxidase (HRP)-conjugated secondary antibodies (7074S, 7076S, WB, 1:2000) from Cell Signaling Technology; anti-GAPDH (M2006M, WB, 1:5000) and anti-β-actin (M2011M, WB, 1:5000) antibodies from Abmart Company; anti-FLAG (SAB1306078, WB, 1:5000) antibody from Sigma-Aldrich; human recombinant IL-6 from R&D Systems; and Matrigel from BD Pharmingen.

Techniques: Immunoprecipitation, Transfection, Expressing, In Vivo, Western Blot

Journal: Nature Communications

Article Title: Loss of Wwox drives metastasis in triple-negative breast cancer by JAK2/STAT3 axis

doi: 10.1038/s41467-018-05852-8

Figure Lengend Snippet: Wwox inhibits IL-6 induction. a Cytokine array analysis of conditioned medium (CM) from SUM159 cell culture. Equal numbers of SUM159 cells transfected with control empty vector (159 control) or with Wwox overexpression construct (159 Wwox) were seeded on culture plates and incubated in DMEM supplemented with 10% FBS for 24 h at 37 °C to allow cell attachment; culture medium was then switched to DMEM without serum. After incubation for 48 h, CM was collected and centrifuged at 2000 × g for 10 min at 4 °C to remove cell debris. The resulting supernatant was used for the experiment. b ELISA quantification of IL-6 production in the same CMs analyzed by the cytokine array in a . c IL-6 production by various luminal breast cancer (BC) cells and basal-like BC cells analyzed by ELISA compared with IL-6 production by MCF-7 cells. d Wild-type (−1000 to +1 bp with respect to the transcription start site) and truncated IL-6 promoter constructs were co-transfected with a vector encoding Wwox, and the luciferase activity was determined. e 293T cells were transfected with Wwox plasmids, and cultures were analyzed for STAT3 binding to the IL-6 promoter. Data represent the mean ± SD ( n = 3) from three independent experiments; * p < 0.05, ** p < 0.01, *** p < 0.001, Student’s t -test

Article Snippet: Antibodies and reagents were obtained as follows: anti-Wwox (sc-373846, WB, 1:1000; IHC, 1:100) antibody, STAT3 inhibitor Stattic, and all siRNAs from Santa Cruz Biotechnology; anti-STAT3 (9139S, western blot (WB), 1:1000; IP, 1:400), anti-p-STAT3 (9138S, WB, 1:1000; 9145S, IHC, 1:200), anti-JAK2 (3230S, WB, 1:1000; IP,1:200), anti-p-JAK2 (3771S, WB, 1:1000), anti-Myc (2272S, WB, 1:1000), and anti-HA (3724S, WB, 1:1000) primary antibodies and horseradish peroxidase (HRP)-conjugated secondary antibodies (7074S, 7076S, WB, 1:2000) from Cell Signaling Technology; anti-GAPDH (M2006M, WB, 1:5000) and anti-β-actin (M2011M, WB, 1:5000) antibodies from Abmart Company; anti-FLAG (SAB1306078, WB, 1:5000) antibody from Sigma-Aldrich; human recombinant IL-6 from R&D Systems; and Matrigel from BD Pharmingen.

Techniques: Cell Culture, Transfection, Control, Plasmid Preparation, Over Expression, Construct, Incubation, Cell Attachment Assay, Enzyme-linked Immunosorbent Assay, Luciferase, Activity Assay, Binding Assay

Journal: Nature Communications

Article Title: Loss of Wwox drives metastasis in triple-negative breast cancer by JAK2/STAT3 axis

doi: 10.1038/s41467-018-05852-8

Figure Lengend Snippet: The levels of Wwox expression in breast cancer (BC) have prognostic implications. a The mRNA expression profiles of Wwox in normal breast tissues and in different molecular subtypes of BC; * p < 0.05, ** p < 0.01, *** p < 0.001. Student’s t -test. b , c IHC staining for Wwox in adjacent normal and paired triple-negative BCs (TNBCs) ( b ). Box plots of Wwox protein expression assessed by blinded IHC analyses of 25 normal and paired TNBC tissues ( c ); *** p < 0.001, Student’s t -test. Scale bar, 100 μm. d Kaplan–Meier curves for overall survival in 150 human BC patients classified by relative (high or low) immune signal for Wwox protein levels. The log-rank (Mantel–Cox) test p value reflects the significance of the correlation between Wwox positivity and longer survival outcomes; *** p < 0.001, log-rank test. e The percentage of Wwox protein levels in different subtypes of 150 human BC samples. The definitions of 'high' and 'low' are given in the Methods section. f A model of the regulation of STAT3 activity by Wwox in BC. Wwox inhibits JAK2 phosphorylation and attenuates the interaction between JAK2 and STAT3, suppressing STAT3 phosphorylation and inhibiting IL-6 production

Article Snippet: Antibodies and reagents were obtained as follows: anti-Wwox (sc-373846, WB, 1:1000; IHC, 1:100) antibody, STAT3 inhibitor Stattic, and all siRNAs from Santa Cruz Biotechnology; anti-STAT3 (9139S, western blot (WB), 1:1000; IP, 1:400), anti-p-STAT3 (9138S, WB, 1:1000; 9145S, IHC, 1:200), anti-JAK2 (3230S, WB, 1:1000; IP,1:200), anti-p-JAK2 (3771S, WB, 1:1000), anti-Myc (2272S, WB, 1:1000), and anti-HA (3724S, WB, 1:1000) primary antibodies and horseradish peroxidase (HRP)-conjugated secondary antibodies (7074S, 7076S, WB, 1:2000) from Cell Signaling Technology; anti-GAPDH (M2006M, WB, 1:5000) and anti-β-actin (M2011M, WB, 1:5000) antibodies from Abmart Company; anti-FLAG (SAB1306078, WB, 1:5000) antibody from Sigma-Aldrich; human recombinant IL-6 from R&D Systems; and Matrigel from BD Pharmingen.

Techniques: Expressing, Immunohistochemistry, Activity Assay, Phospho-proteomics

Journal: The Journal of Clinical Investigation

Article Title: Inhibition of relaxin autocrine signaling confers therapeutic vulnerability in ovarian cancer

doi: 10.1172/JCI142677

Figure Lengend Snippet: (A) Schematic of the genomic region proximal to the RLN2 transcriptional start site (UCSC genome browser-human GRCh37/hg19). Species conservation is indicated. Boundaries of 3 relaxin promoter (RP) constructs, RP-1, RP-2, and RP-3, are mapped. Predicted binding sites for STAT3, NF-κB, and SOX9 are indicated. (B) Luciferase activity of the indicated RP constructs compared with empty vector control (EV) in OVCAR8 and SKOV3. Luciferase activity is normalized to Renila activity. For this and subsequent experiments, error bars indicate mean ± SEM. n = 3. (C) Genomic region of the RLN2 promoter (RP-3) compared with the RLN1 promoter. Peaks indicate species conservation. Red bars in the RP-3 sequence indicate single nucleotide differences in RLN1 compared with RLN2, and the open box indicates a small sequence not present in RLN1. Predicted binding sites for STAT3, NF-κB, and SOX9 are indicated. (D) RP-3 luciferase activity in cells transfected with control siRNA (siCON) or siRNA targeting STAT3 or SOX9. n = 3. (E) RP-3 luciferase activity in cells expressing shGFP or hairpins targeting NFκB1 or NFκB2 subunits (sh-NFκB1 and sh-NFκB2). n = 3. (F) Relaxin expression and STAT3 phosphorylation (pY705) in OVCAR8 treated for 48 hours with small molecule inhibitors of STAT3 (STATTIC, 1 μM) or NF-κB (QNZ, 5 nM) compared with mock-treated (–) cells. (G) RP3-luciferase activity in OVCAR8 and SKOV3 treated with 1%FBS, IL-6 (50 ng/mL), or TNF-α (50 ng/mL) for 24 hours compared with untreated cells. n = 3. (H) Relaxin levels and STAT3 phosphorylation (pY705) in OVCAR8 treated with IL-6 (50 ng/mL) or control (–) 24 hours after treatment with the JAK1/2 inhibitor Ruxolitinib (+Rux) compared with DMSO. (I and J) ChIP analysis of TF occupancy at the RLN1 promoter (I) and RLN2 promoter (J). ChIP signals are shown as fold enrichment over IgG. n = 3.

Article Snippet: For STAT3 and NFKB inhibition, cells were treated with Stattic (1 μM, Selleckchem S7024) or QNZ (5nM, Selleckchem S4902) for 16 to 48 hours.

Techniques: Construct, Binding Assay, Luciferase, Activity Assay, Plasmid Preparation, Sequencing, Transfection, Expressing

Journal: Brain research

Article Title: STAT3 protects dopaminergic neurons against degeneration in animal model of Parkinson's disease.

doi: 10.1016/j.brainres.2023.148691

Figure Lengend Snippet: Fig. 1. STAT3 reduced 6-OHDA neurotoxicity in N27 cell lines. Control N27 cells were examined in the absence (A) or presence (B) of 50 µM 6-OHDA for 24 h. N27 cells expressing caSTAT3 were examined in the absence (C) or presence (D) of 50 µM 6-OHDA for 24 h E) Graphical plot illustrating that caSTAT3 transfected N27 cells reduced percentage of cell deaths under 6-OHDA induced neurotoxicity. Three different batches of cell culture used. Result in mean ± SE. For each sample a minimum of 10,000 cells were recorded. The pink box represents the FVD + population of dead cells. The cells were double stained with FVD eFluor 660 and Annexin V-PE. The FVD-/Annexin V- population is regarded as normal healthy cells, while FVD-/AnnexinV + population is early apoptotic cells, and FVD+/AnnexinV+/- population represents necrotic/late apoptotic like cell death. Expression of caSTAT3 greatly reduced the percentage of dead cells 24 h after 6-OHDA treatment. F) Western blot analysis showed expression of phosphorylated STAT3 (pSTAT3) at Tyr705 (lane 3). An upregulation of pSTAT3 expression was found when compared to non-infected (lane 1) or GFP (lane 2) transfected N27 cell lysates. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: Recombinant adeno-associated virus 2 (AAV2) carrying GFP or caRheb (kindly provided by Zhigang He, Harvard University, Boston, USA) was tagged with HA or caSTAT3 (pMXs-Stat3-C was a gift from Shinya Yamanaka (Addgene plasmid #13373) by helper virus-free system (Ayuso et al., 2010).

Techniques: Control, Expressing, Transfection, Cell Culture, Staining, Western Blot, Infection

Journal: Brain research

Article Title: STAT3 protects dopaminergic neurons against degeneration in animal model of Parkinson's disease.

doi: 10.1016/j.brainres.2023.148691

Figure Lengend Snippet: Fig. 2. caSTAT3 attenuated 6-OHDA-induced mitochondrial dysfunction. Control fluorescence, caSTAT3-expressing, and caRheb-expressing N27 cells were plated on coverslips and treated with indicated concentrations of 6-OHDA (µM) for 24 hrs prior to imaging (A); cells were loaded with 0.05 nM MitoSOX Red. B) The mean fluorescence intensity (F580 nm) of multiple cells (6 – 50 per condition) was quantified and plotted ± S.E.M. Two-way analysis of variance (ANOVA, F (2, 14) = 9.646, p = 0.0023) indicates significantly decreased mitochondrial superoxide production in caRheb or caSTAT3-expressing cells treated with either 6-OHDA dose compared to control. Sidak post hoc values for individual data points ** p < 0.01, *** p < 0.001. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: Recombinant adeno-associated virus 2 (AAV2) carrying GFP or caRheb (kindly provided by Zhigang He, Harvard University, Boston, USA) was tagged with HA or caSTAT3 (pMXs-Stat3-C was a gift from Shinya Yamanaka (Addgene plasmid #13373) by helper virus-free system (Ayuso et al., 2010).

Techniques: Control, Fluorescence, Expressing, Imaging

Journal: Brain research

Article Title: STAT3 protects dopaminergic neurons against degeneration in animal model of Parkinson's disease.

doi: 10.1016/j.brainres.2023.148691

Figure Lengend Snippet: Fig. 4. caSTAT3 protects dopaminergic neurons from 6-OHDA induced neurodegeneration. Data shows dopaminergic neuron survival 4 weeks after unilateral in jections of 6-OHDA in rats pre-injected with AAV/GFP (A,D), AAV/caSTAT3 (B,E,G) and AAV/caRheb (C,F) into the substantia nigra (SN). Coronal brain section (A,B, C) showing the extent of dopaminergic axon terminals with the striatum and the survival of dopaminergic neurons within the substantia nigra (D, E, F). Dramatic protection of striatal terminals and neurons is apparent in animals treated with either caSTAT3 (compare B & E to A & D, respectively) or caRheb (compare C & F to A & D, respectively). High magnification of TH + neurons from panel E shows neurons with a normal morphology (G). Quantitative analysis shows caRheb + caSTAT3, caSTAT3, or caRheb to statistically [ANOVA, F(3, 55) = 7.93, bonferroni post-hoc, p < 0.0001] preserve high density of dopaminergic nerve terminals within the striatum when compared to controls (H). Likewise, caRheb + caSTAT3, caSTAT3, or caRheb resulted in significantly increased survival [ANOVA, F(3, 81) = 21.16 bonferroni post-hoc, p < 0.0001] of dopaminergic neurons within the substantia nigra (I). Scale bar: A-F 500 µm; G 50 µm.

Article Snippet: Recombinant adeno-associated virus 2 (AAV2) carrying GFP or caRheb (kindly provided by Zhigang He, Harvard University, Boston, USA) was tagged with HA or caSTAT3 (pMXs-Stat3-C was a gift from Shinya Yamanaka (Addgene plasmid #13373) by helper virus-free system (Ayuso et al., 2010).

Techniques: Injection

Journal: Brain research

Article Title: STAT3 protects dopaminergic neurons against degeneration in animal model of Parkinson's disease.

doi: 10.1016/j.brainres.2023.148691

Figure Lengend Snippet: Fig. 5. Neuroprotection was observed in caSTAT3 transfected nigral dopami nergic neurons after 6-OHDA insult: A) Neurons are labelled with TH. B) Neurons are labelled with cMyc and C) neurons are merged for TH and cMyc. Data shows dopaminergic neuron survival 4 weeks after unilateral injections of 6-OHDA in rats pre-injected with AAV/caSTAT3. Scale bar = 50 µm.

Article Snippet: Recombinant adeno-associated virus 2 (AAV2) carrying GFP or caRheb (kindly provided by Zhigang He, Harvard University, Boston, USA) was tagged with HA or caSTAT3 (pMXs-Stat3-C was a gift from Shinya Yamanaka (Addgene plasmid #13373) by helper virus-free system (Ayuso et al., 2010).

Techniques: Transfection, Injection

Journal: Brain research

Article Title: STAT3 protects dopaminergic neurons against degeneration in animal model of Parkinson's disease.

doi: 10.1016/j.brainres.2023.148691

Figure Lengend Snippet: Fig. 6. caSTAT3 protects against 6-OHDA motor behavioral impairment: A) Amphetamine-induced rotational behavior was significantly decreased in caRheb + STAT3, caSTAT3, and caRheb expressing rats 4 weeks after 6-OHDA lesioning [ANOVA, F(3, 23) = 9.51, p = 0.0003] when compared to controls. B) After unilateral 6-OHDA lesions GFP treated animals showed a deficit in the use of the right (contralateral) paw, however, those treated with caRheb + caSTAT3, caSTAT3, or caRheb showed significant [ANOVA, F(3,17) = 8.29, p = 0.0013] use of the right paw in glass cylinder searching when compared to controls. Bonferroni post-hoc values for individual data points * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: Recombinant adeno-associated virus 2 (AAV2) carrying GFP or caRheb (kindly provided by Zhigang He, Harvard University, Boston, USA) was tagged with HA or caSTAT3 (pMXs-Stat3-C was a gift from Shinya Yamanaka (Addgene plasmid #13373) by helper virus-free system (Ayuso et al., 2010).

Techniques: Expressing

Journal: Cell reports

Article Title: Activation of STAT3 through combined SRC and EGFR signaling drives resistance to a mitotic kinesin inhibitor in glioblastoma

doi: 10.1016/j.celrep.2022.110991

Figure Lengend Snippet: (A) Immunoblots for pY705 STAT3, pS727 STAT3, and total STAT3 in Trp53/Pten −/− cells that are ispinesib naive and resistant. (B–D) Quantitation of total STAT3/β actin (B), pY705 STAT3/total STAT3 (C), and pS727 STAT3/total STAT3 (D) in ispinesib-naive (blue) and -resistant (red) cells, with three biological replicates of each. Statistical significance assessed with a two-tailed t test. (E and F) Western blot intensity, normalized to β actin, of pY705 STAT3 (E) and pS727 STAT3 (F) in ispinesib-naive (Naive) and -resistant (Res) cells, with the former treated with DMSO vehicle (Veh) and the latter treated with DMSO vehicle (Veh), 500 nM saracatinib (Sara), or 500 nM dasatinib (Dasa). (G) Western blot intensity, normalized to β actin, of total STAT3 in ispinesib-naive (Naive) and -resistant (Res) cells, with the former treated with DMSO vehicle (Veh) and the latter treated with DMSO vehicle (Veh), 500 nM saracatinib (Sara), or 500 nM dasatinib (Dasa). For (E)–(G), please refer to and for the corresponding images of the western blots. Statistical significance determined using a pairwise two-tailed t test. (H–J) Quantitation of pY705 STAT3 (H), pS727 STAT3 (I), and total STAT3 (J), all normalized to β actin for ispinesib-naive cells treated with vehicle (solid blue circles; Naive Veh), ispinesib-resistant cells treated with vehicle (solid red circles; Res Veh), and ispinesib-resistant cells treated with 500 nM erlotinib (open red circles; Res Erlot). Statistical significance was determined by pairwise two-tailed t test. For (H)–(J), please refer to for the corresponding images of the western blots. (K) Dose-response curves for ispinesib-naive (solid blue circles) and -resistant (solid red circles) cells in the absence and presence of 75 nM ispinesib (open red circles) for the STAT3 inhibitor SH5–07. (L and M) Effect of shRNA suppression of STAT3 on ispinesib resistance. Please refer to for the corresponding western blot for STAT3, which shows >90% knockdown with two STAT3-directed shRNAs. Statistical significance determined using a pairwise two-tailed t test. (N) Ispinesib-naive and -resistant cells were treated for 24 h with 1 μM doxorubicin, and cell lysates were probed by western blot for full-length caspase 3 (FL Caspase 3) and cleaved caspase 3 (Cl Caspase 3). (O) Ispinesib-naive and -resistant cells were lysed, and mitochondria (Mito) were separated from the cytoplasm (Cyto) by centrifugation. Western blot shows that ispinesib resistance is associated with a marked increase in mitochondrial STAT3 that is phosphorylated on S727. Loading controls include α tubulin for the cytoplasmic and cytochrome c oxidase ( COX4 ) for the mitochondrial fractions. (P) Ispinesib-naive and -resistant cells were lysed, and nuclei (Nuc) were separated from the cytoplasm (Cyto) by centrifugation. Western blot shows that ispinesib resistance is associated with a marked increase in nuclear STAT3 that is phosphorylated on Y705. Loading controls include a tubulin for the cytoplasmic and histone H3 for the nuclear fractions. (Q) Ispinesib-naive cells were transfected with STAT3 S727A, STAT3 S727D, STAT3-C, or STAT3 S727D + STAT3-C constructs, each fused to the FLAG epitope. After confirmation of expression of the STAT3 mutant , cells were treated with a range of ispinesib concentrations, and cell viability was measured at 72 h. While transfection of either STAT3-S727D or STAT3-C increases the EC 50 of ispinesib by ~20-fold, co-transfection of both of these constructs is required to increase the ispinesib EC 50 to that seen for ispinesib-resistant cells ( ; ).

Article Snippet: STAT3 sequences from adenoviral plasmids encoding Flag-tagged mouse S727A-STAT3 (Addgene, #99262) and S727D-STAT3 (Addgene, #99263) were amplified by PCR (CloneAmp TM HiFi PCR, Takara Bio) using specific primers (CATTGGTAACTGTCAGAC CAAGTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGT AGAGCGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727A-STAT3 and CATTGGTAACTGTCAGACCAA GTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGTAGAG CGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727D-STAT3), and subcloned into the pLenti Lifeact-EGFP BlastR plasmid (Addgene, #84383) to generate S727A and S727D-STAT3 expressing lentiviral plasmids.

Techniques: Western Blot, Quantitation Assay, Two Tailed Test, shRNA, Knockdown, Centrifugation, Transfection, Construct, FLAG-tag, Expressing, Mutagenesis, Cotransfection

Journal: Cell reports

Article Title: Activation of STAT3 through combined SRC and EGFR signaling drives resistance to a mitotic kinesin inhibitor in glioblastoma

doi: 10.1016/j.celrep.2022.110991

Figure Lengend Snippet: (A) Western blots of two human GBM lines (L1 and 120) show no significant upregulation of Kif15 between ispinesib-naive ( N ) and -resistant ( R ) lines. Significance determined by a two-tailed t test. (B) Expression of EGFR is increased 3- to 4-fold in resistant ( R ) L1 and 120 GBM lines compared with the corresponding drug-naive ( N ) lines. Statistical significance determined using a pairwise two-tailed t test. (C–H) Phosphorylation of STAT3 increases in the human GBM cell lines L1 and 120 with development of ispinesib resistance. (C) Western blot for pY705, pS727, and total STAT3 in ispinesib naive ( N ) and resistant ( R ) GBM L1 and 120 cell lines. (D–H) Quantitation of total STAT3/β actin (D), pY705 STAT3/total STAT3 (E), pS727 STAT3/total STAT3 (F), pY705 STAT3/β actin (G), and pS727 STAT3/β actin (H) in ispinesib-naive ( N ) and -resistant ( R ) L1 and 120 cell lines. Statistical significance was determined by a two-tailed t test. Statistical significance determined using a pairwise two-tailed t test. (I–L) Ispinesib resistance in human L1 and 120 GBM cell lines can be reversed with saracatinib and SH5–07 but not with either erlotinib or dasatinib. (I and J) Dose-response curves for dasatinib (I) and erlotinib (J) show no effect of either drug as a single agent on ispinesib-naive (blue) or -resistant (red) cell lines, the latter in the presence of 50 nM ispinesib. (J and K) By contrast, both saracatinib (K) and SH5–07 (L) are active against ispinesib-resistant L1 and 120 cells in the presence of 50 nM ispinesib (red curves) but not against ispinesib-naive (blue curves) L1 and 120 cells. Relevant EC 50 values are listed in .

Article Snippet: STAT3 sequences from adenoviral plasmids encoding Flag-tagged mouse S727A-STAT3 (Addgene, #99262) and S727D-STAT3 (Addgene, #99263) were amplified by PCR (CloneAmp TM HiFi PCR, Takara Bio) using specific primers (CATTGGTAACTGTCAGAC CAAGTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGT AGAGCGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727A-STAT3 and CATTGGTAACTGTCAGACCAA GTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGTAGAG CGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727D-STAT3), and subcloned into the pLenti Lifeact-EGFP BlastR plasmid (Addgene, #84383) to generate S727A and S727D-STAT3 expressing lentiviral plasmids.

Techniques: Western Blot, Two Tailed Test, Expressing, Phospho-proteomics, Quantitation Assay

Journal: Cell reports

Article Title: Activation of STAT3 through combined SRC and EGFR signaling drives resistance to a mitotic kinesin inhibitor in glioblastoma

doi: 10.1016/j.celrep.2022.110991

Figure Lengend Snippet: (A) Uniform manifold approximation and projection (UMAP) of all cells in the dataset, annotated by whether they are part of the naive or resistant populations. (B) Co-expression analysis of EGFR and SRC transcripts on original dataset. Cells were deemed EGFR or SRC positive based on whether they express any transcripts of the respective gene. See for subsample analysis to equalize coverage across conditions before doing co-expression analysis. (C) Cluster-by-cluster gene set enrichment analysis (GSEA) of the Cancer Hallmarks ‘‘IL6_JAK_STAT3_SIGNALING’’ pathway. Each cluster is colored based on its normalized enrichment score (NES) for the pathway. (D) GSEA of same IL-6/JAK/STAT3 pathway comparing all resistant cells with all naive cells. Normalized enrichment score, as well as p value and false discovery rate (FDR) q value, are displayed.

Article Snippet: STAT3 sequences from adenoviral plasmids encoding Flag-tagged mouse S727A-STAT3 (Addgene, #99262) and S727D-STAT3 (Addgene, #99263) were amplified by PCR (CloneAmp TM HiFi PCR, Takara Bio) using specific primers (CATTGGTAACTGTCAGAC CAAGTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGT AGAGCGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727A-STAT3 and CATTGGTAACTGTCAGACCAA GTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGTAGAG CGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727D-STAT3), and subcloned into the pLenti Lifeact-EGFP BlastR plasmid (Addgene, #84383) to generate S727A and S727D-STAT3 expressing lentiviral plasmids.

Techniques: Expressing

Journal: Cell reports

Article Title: Activation of STAT3 through combined SRC and EGFR signaling drives resistance to a mitotic kinesin inhibitor in glioblastoma

doi: 10.1016/j.celrep.2022.110991

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: STAT3 sequences from adenoviral plasmids encoding Flag-tagged mouse S727A-STAT3 (Addgene, #99262) and S727D-STAT3 (Addgene, #99263) were amplified by PCR (CloneAmp TM HiFi PCR, Takara Bio) using specific primers (CATTGGTAACTGTCAGAC CAAGTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGT AGAGCGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727A-STAT3 and CATTGGTAACTGTCAGACCAA GTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGTAGAG CGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727D-STAT3), and subcloned into the pLenti Lifeact-EGFP BlastR plasmid (Addgene, #84383) to generate S727A and S727D-STAT3 expressing lentiviral plasmids.

Techniques: Virus, Plasmid Preparation, Recombinant, Membrane, Protease Inhibitor, Western Blot, Lysis, Transfection, Bicinchoninic Acid Protein Assay, Isolation, Cell Culture, Extraction, Software, Gene Expression, Mass Spectrometry

Journal:

Article Title: Interleukin-6-Specific Activation of the C/EBP? Gene in Hepatocytes Is Mediated by Stat3 and Sp1

doi:

Figure Lengend Snippet: Binding of nuclear proteins to the Sp1(−117) site. (A) Supershift analysis using an antibody (Ab) against Sp1. Nuclear extracts were prepared from control or IL-6-treated HepG2 cells by a method that maximizes the extraction of Sp1 (see Materials and Methods). The extracts were incubated with either NRS or an Sp1-specific antibody and the δAPRE/Sp1 or δAPRE probe. The supershift generated by the Sp1 antibody in lanes 2 and 4 is indicated. (B and C) Binding of recombinant Sp1 to the δAPRE/Sp1 (B) and δAPRE (C) probes. Recombinant human Sp1 (50 ng) was used alone (lanes 5 and 10) or mixed with 8 μg of HepG2 nuclear extract (optimized for Stat protein extraction) from control or IL-6-treated cells. Stat3 antibody was added to the indicated reactions. The lower panel is a longer exposure of the top portion of the gel to emphasize the Stat3 antibody supershift complex.

Article Snippet: The following antibodies were purchased from Santa Cruz Biotechnology, Inc.: Stat1 p84/p91 (E-23), Stat3 (C-20), Sp1 (PEP2), and normal rabbit immunoglobulin G (normal rabbit serum [NRS]).

Techniques: Binding Assay, Incubation, Generated, Recombinant, Protein Extraction

Journal:

Article Title: Interleukin-6-Specific Activation of the C/EBP? Gene in Hepatocytes Is Mediated by Stat3 and Sp1

doi:

Figure Lengend Snippet: Replacement of the C/EBPδ APRE with SBEs from ICAM-1 or C/EBPβ renders the promoter responsive to IFN-γ. (A) The C/EBPβ promoter contains an SBE that binds Stat1 and Stat3. A probe containing the putative SBE from the C/EBPβ promoter and Stat1- or α-Stat3-specific antibody (Ab) (lanes 3 and 4, respectively) were added to nuclear extracts from control (lane 1) or IL-6 treated (lanes 2 to 4) HepG2 cells and the reactions analyzed by EMSA. Antibody supershift species are indicated. (B) Comparison of SBE sequences from the C/EBPδ, C/EBPβ, and ICAM-1 promoters. Bases that differ from the C/EBPδ APRE sequence are underlined. (C) IL-6 and IFN-γ responsiveness of SBE swap mutants. Constructs in which the C/EBPδ APRE was exchanged with SBEs from the C/EBPβ or ICAM-1 genes were generated. These constructs and (−127)-Luc were cotransfected with pRSV β-gal into Hep3B cells and assayed for basal expression and IL-6 or IFN-γ inducibility. The values represent the average of three independent experiments. Relative basal expression was normalized to the (−127)-Luc level.

Article Snippet: The following antibodies were purchased from Santa Cruz Biotechnology, Inc.: Stat1 p84/p91 (E-23), Stat3 (C-20), Sp1 (PEP2), and normal rabbit immunoglobulin G (normal rabbit serum [NRS]).

Techniques: Sequencing, Construct, Generated, Expressing

Journal:

Article Title: Interleukin-6-Specific Activation of the C/EBP? Gene in Hepatocytes Is Mediated by Stat3 and Sp1

doi:

Figure Lengend Snippet: The C/EBPδ APRE competes for binding of Stat3 to the α2-m APRE. (A) EMSA using the rat α2-m APRE, nuclear extracts (6.5 μg) from HepG2 cells, and NRS or Stat3-specific antibody (Ab) as indicated. The HepG2 cells were treated with IL-6 for 15 min. An upper complex (u) and a lower complex (l) appear in the IL-6-treated extracts (lane 3). The Stat3 antibody supershift complex (lane 4) is indicated. (B) Competition for Stat3 binding by the C/EBPδ APRE. Nuclear extracts (10 μg) from IL-6 treated HepG2 cells were incubated with Stat3-specific antibody and 10× (lanes 3 and 6), 30× (lanes 4 and 7), or 100× (lanes 5 and 8) molar excess of unlabeled wild-type (δAPRE) or mutant (δAPREm) binding site, as indicated. The rat α2-m APRE was used as a probe. The film was overexposed to emphasize the supershifted complex.

Article Snippet: The following antibodies were purchased from Santa Cruz Biotechnology, Inc.: Stat1 p84/p91 (E-23), Stat3 (C-20), Sp1 (PEP2), and normal rabbit immunoglobulin G (normal rabbit serum [NRS]).

Techniques: Binding Assay, Incubation, Mutagenesis

Journal:

Article Title: Interleukin-6-Specific Activation of the C/EBP? Gene in Hepatocytes Is Mediated by Stat3 and Sp1

doi:

Figure Lengend Snippet: Selective binding of Stat3 to the C/EBPδ APRE. Nuclear extracts from control or IL-6-treated HepG2 cells were analyzed by EMSA using the wild-type or mutant C/EBPδ APRE probes and control antiserum or Stat1- or Stat3-specific antibody (Ab), as indicated. The film was overexposed to emphasize the supershift signal.

Article Snippet: The following antibodies were purchased from Santa Cruz Biotechnology, Inc.: Stat1 p84/p91 (E-23), Stat3 (C-20), Sp1 (PEP2), and normal rabbit immunoglobulin G (normal rabbit serum [NRS]).

Techniques: Binding Assay, Mutagenesis

Journal:

Article Title: Interleukin-6-Specific Activation of the C/EBP? Gene in Hepatocytes Is Mediated by Stat3 and Sp1

doi:

Figure Lengend Snippet: Stat3 mediates IL-6-induced expression from the C/EBPδ promoter. (A) Stat3 but not Stat1 transactivates the C/EBPδ promoter. The (−127)-Luc construct was cotransfected into Hep3B cells with expression vectors for Stat1 or Stat3 or the parental pCDNA1 vector, together with pRSV β-gal as an internal standard, and tested for basal and IL-6-induced luciferase expression. (B) Stat3 transactivation of C/EBPδ promoter mutants. The indicated deletion and point mutants (Fig. ​(Fig.33 and ​and4)4) were cotransfected with the Stat3 expression vector into Hep3B cells and tested for basal and IL-6-inducible luciferase expression. (C) Stat3 transactivates a heterologous promoter containing the C/EBPδ APRE. The indicated TK promoter-luciferase reporter constructs (Fig. ​(Fig.8)8) were cotransfected with the Stat3 expression plasmid into Hep3B cells and tested for basal and IL-6-inducible expression. The cell extracts were assayed for luciferase and β-galactosidase activities as described in Fig. ​Fig.3.3. The values represent the averages of three to six independent experiments.

Article Snippet: The following antibodies were purchased from Santa Cruz Biotechnology, Inc.: Stat1 p84/p91 (E-23), Stat3 (C-20), Sp1 (PEP2), and normal rabbit immunoglobulin G (normal rabbit serum [NRS]).

Techniques: Expressing, Construct, Plasmid Preparation, Luciferase

Journal:

Article Title: Interleukin-6-Specific Activation of the C/EBP? Gene in Hepatocytes Is Mediated by Stat3 and Sp1

doi:

Figure Lengend Snippet: Sequences and Stat binding properties of the C/EBPδ APRE and several known SBEs

Article Snippet: The following antibodies were purchased from Santa Cruz Biotechnology, Inc.: Stat1 p84/p91 (E-23), Stat3 (C-20), Sp1 (PEP2), and normal rabbit immunoglobulin G (normal rabbit serum [NRS]).

Techniques: Binding Assay

Journal: eLife

Article Title: MicroRNA-122 supports robust innate immunity in hepatocytes by targeting the RTKs/STAT3 signaling pathway

doi: 10.7554/eLife.41159

Figure Lengend Snippet: ( A ) Structure of the two lentiviral transfer vectors used for the expression of miR-122 hairpins (upper) and a Tet3G trans-activator (lower). ( B ) qRT-PCR analysis of miR-122 levels in HepG2, Huh7, miR-122-Tet-On cells with (G2/122-ON) or without (G2/122-OFF) doxycycline treatment (1000 ng/ml, 72 hr). ( C ) Comparison of the effect of transient and stable miR-122 overexpression on p-STAT3. qRT-PCR data are from one experiment that was representative of two independent experiments (mean ± SEM of technical triplicates).

Article Snippet: Antibody , Mouse anti-Phospho-STAT3 (Tyr705), (B-7) mouse mAb , Santa Cruz Biotechnology , Cat. #: sc-8059, RRID: AB_628292 , IP (2 ug/500 ul).

Techniques: Expressing, Quantitative RT-PCR, Comparison, Over Expression

Journal: eLife

Article Title: MicroRNA-122 supports robust innate immunity in hepatocytes by targeting the RTKs/STAT3 signaling pathway

doi: 10.7554/eLife.41159

Figure Lengend Snippet: ( A ) Analysis of p-STAT1 expression in HepG2 cells first transfected with mimics (NC or miR-122) for 2 days and then treated with IFN-β or IL-29 for 5–60 min. ( B ) qRT-PCR analysis of the five SOCS genes in HepG2 cells first treated with mimics for 2 days, and then transfected with JFH1 RNA for 24 hr. ( C ) qRT-PCR analysis of STAT3 mRNA in HepG2 cells, treated as in panel B. ( D ) Analysis of total and phosphorylated STAT3 in HepG2 cells treated with three independent siRNAs (si-1, si-2 and si-3) at a final concentration of 20 nM. ( E ) Analysis of p-STAT1 and MDA5 in HepG2 cells transfected with STAT3 siRNA and then treated with JFH1 RNA or poly(I:C). ( F ) Analysis of the dose-dependent effects of cryptotanshinone (CTS) and S3I-201 on p-STAT3. HepG2 cells were treated with either CST or S3I-201 at the indicated concentrations for 24 hr. qRT-PCR data are from one experiment that was representative of two ( B ) or three ( C ) independent experiments (mean ± SEM of technical triplicates).

Article Snippet: Antibody , Mouse anti-Phospho-STAT3 (Tyr705), (B-7) mouse mAb , Santa Cruz Biotechnology , Cat. #: sc-8059, RRID: AB_628292 , IP (2 ug/500 ul).

Techniques: Expressing, Transfection, Quantitative RT-PCR, Concentration Assay

Journal: eLife

Article Title: MicroRNA-122 supports robust innate immunity in hepatocytes by targeting the RTKs/STAT3 signaling pathway

doi: 10.7554/eLife.41159

Figure Lengend Snippet: ( A ) Luciferase activity of a STAT3-responsible promoter construct in HepG2 cells co-transfected with mimics (NC or miR-122) for 2 days, and then transfected with SGR-JFH1 RNA for the indicated time. ( B ) Western blot analysis of total and phosphorylated STAT3 (p-STAT3, Tyr705) in HepG2 cells first transfected with mimics (NC or miR-122) for 2 days, and then treated with JFH1 RNA or poly(I:C). ( C ) Analysis of STAT3 protein in HepG2 cells treated with mimics (NC or miR-122) or siRNAs (NC or STAT3). ( D, E ) Analysis of the mRNAs ( D ) and proteins ( E ) of IFNs in HepG2 cells treated with siRNAs (NC or STAT3) and then JFH1 RNA. Cells treated with miR-122 or NC mimics were used as controls in panel D. ( F ) Analysis of IFN mRNAs in HepG2 cells treated with siRNAs and then with poly(I:C). ( G, H ) Analysis of p-STAT1 protein and IFN mRNAs in HepG2 cells treated with either S3I-201 or cryptotanshinone (CST) for 24 hr, and then transfected with poly(I:C). Luciferase data are from three experiments (mean +SD). ELISA data are from two experiments (mean +SD). qRT-PCR data are from one experiment that was representative of three experiments (mean ± SEM of technical triplicates). *p < 0.05, **p < 0.01 and ***p < 0.001. 10.7554/eLife.41159.021 Figure 3—source data 1. qRT-PCR analysis of the five SOCS genes in HepG2 cells. 10.7554/eLife.41159.022 Figure 3—source data 2. Luciferase activity of a STAT3-responsible promoter construct in HepG2 cells. 10.7554/eLife.41159.023 Figure 3—source data 3. qRT-PCR analysis of STAT3 mRNA in HepG2 cells. 10.7554/eLife.41159.024 Figure 3—source data 4. qRT-PCR analysis of IFN mRNAs in HepG2 cells treated with siRNAs and then treated with JFH1. 10.7554/eLife.41159.025 Figure 3—source data 5. ELISA analysis of IFN proteins in HepG2 cells treated with siRNAs and then treated with JFH1. 10.7554/eLife.41159.026 Figure 3—source data 6. qRT-PCR analysis of IFN mRNAs in HepG2 cells treated with siRNAs and then treated with poly(I:C). 10.7554/eLife.41159.027 Figure 3—source data 7. qRT-PCR analysis of IFN mRNAs in HepG2 cells treated with either S3I-201 or cryptotanshinone (CST). 10.7554/eLife.41159.028 Figure 3—source data 8. qRT-PCR analysis of IFN mRNAs in Huh7 cells. 10.7554/eLife.41159.029 Figure 3—source data 9. qRT-PCR analysis of IFN mRNAs in Hep3B cells.

Article Snippet: Antibody , Mouse anti-Phospho-STAT3 (Tyr705), (B-7) mouse mAb , Santa Cruz Biotechnology , Cat. #: sc-8059, RRID: AB_628292 , IP (2 ug/500 ul).

Techniques: Luciferase, Activity Assay, Construct, Transfection, Western Blot, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR

Journal: eLife

Article Title: MicroRNA-122 supports robust innate immunity in hepatocytes by targeting the RTKs/STAT3 signaling pathway

doi: 10.7554/eLife.41159

Figure Lengend Snippet: ( A ) Western blot analysis of p-STAT1, p-STAT3 and IRF1 in Huh7 cells first transfected with mimics, siRNAs or inhibitors (for 2 days), and then treated with poly(I:C) for the indicated durations. T1, miR-NC (20nM); T2, miR-122 (20nM); T3, si-NC (20nM); T4, si-STAT3 (20nM); T5, NC inhibitor (40nM); T6, miR-122 inhibitor (40nM). ( B ) qRT-PCR analysis of IFN mRNA Huh7 cells, treated as in panel A. ( C ) Western blot analysis of p-STAT3 expression in cells transfected with mimics (NC or miR-122) for 2 days. ( D ) Analysis of the indicated proteins or IFN mRNAs in Hep3B cells, treated as in panels A and B. qRT-PCR data are one experiment that was representative of three independent experiments (mean ± SEM of technical triplicates).

Article Snippet: Antibody , Mouse anti-Phospho-STAT3 (Tyr705), (B-7) mouse mAb , Santa Cruz Biotechnology , Cat. #: sc-8059, RRID: AB_628292 , IP (2 ug/500 ul).

Techniques: Western Blot, Transfection, Quantitative RT-PCR, Expressing

Journal: eLife

Article Title: MicroRNA-122 supports robust innate immunity in hepatocytes by targeting the RTKs/STAT3 signaling pathway

doi: 10.7554/eLife.41159

Figure Lengend Snippet: ( A ) qRT-PCR analysis of IRF1, IRF3, NFKB1 and RELA in HepG2 cells first treated with mimics or siRNAs, and then transfected with or without JFH1 RNA for 24 hr. ( B ) Analysis of IRF1 and IRF3 protein expression in HepG2 cells treated with siRNAs and then JFH1 RNA. ( C ) qRT-PCR analysis of IRF1 and IFNs in HepG2 cells transfected with vectors expressing IRF1 or RFP (after 2 days). ( D ) Analysis of p-STAT1 and MDA5 in HepG2 cells transfected with IRF1 or RFP plasmids for 2 days, and then treated with poly(I:C) for 3–24 hr. ( E ) Analysis of p-STAT1 and MDA5 in HepG2 cells transfected with the indicated doses of IRF1 plasmids (0.05–1 μg/well in a 24-well-plate) for 2 days. ( F ) Analysis of IRF1, p-STAT1 and MDA5 in HepG2 cells transfected with plasmids expressing 7 HA-tagged transcription factors (after 2 days). HA-GFP was used as a negative control. ( G ) Analysis of IRF1 and p-STAT1 in HepG2 cells first transfected with STAT3 siRNA for 2 days, and then treated with IFN-β or IL-29 for 5–360 min. qRT-PCR data are from one experiment that was representative of three experiments (mean ± SEM of technical triplicates). *p<0.05, **p<0.01 and ***p<0.001. 10.7554/eLife.41159.031 Figure 4—source data 1. qRT-PCR analysis of transcription factors in HepG2 cells. 10.7554/eLife.41159.032 Figure 4—source data 2. qRT-PCR analysis of IRF1 and IFN in HepG2 cells transfected with IRF1 plasmid.

Article Snippet: Antibody , Mouse anti-Phospho-STAT3 (Tyr705), (B-7) mouse mAb , Santa Cruz Biotechnology , Cat. #: sc-8059, RRID: AB_628292 , IP (2 ug/500 ul).

Techniques: Quantitative RT-PCR, Transfection, Expressing, Negative Control, Plasmid Preparation

Journal: eLife

Article Title: MicroRNA-122 supports robust innate immunity in hepatocytes by targeting the RTKs/STAT3 signaling pathway

doi: 10.7554/eLife.41159

Figure Lengend Snippet: ( A ) Schematic representation of STAT3-binding clusters (BS1–BS7) on the human IRF1 gene. The DNA fragments selected for reporter constructs (P1–P11) are also shown. ( B ) ChIP-PCR assays show the binding of STAT3, p-STAT3 and RELA on the selected gene fragments of IRF1 in HepG2 cells. BS1′–BS7′ are short fragments (160–200 bp) corresponding to the BS1–BS7 clusters (290–410 bp), respectively. ( C ) Luciferase activity of different IRF1 promoter or enhancer constructs (P1–P11) in HepG2 cells treated with or without poly(I:C) (for 24 hr). The relative luciferase activities are the ratio of Firefly/Renilla luciferase normalized to the pGL3-basic vector (basic) without poly(I:C) stimulation. ( D ) Luciferase activity of P1, P7 and P4 constructs in HepG2 cells co-transfected with 20 nM STAT3 or control siRNAs for 2 days, and then treated with or without poly(I:C) for 24 hr. The fold changes of P1, P4 and P7 were normalized to the activity of the pGL3-control vector. ( E ) Luciferase activity of P1, P7 and P4 constructs in 293FT cells co-transfected with STAT3 or RFP plasmids (after 2 days). ( F ) The sequences of the STAT3 binding sites in wildtype (P1, P4) and mutant (P1-M, P4-M) constructs. ( G, H ) Luciferase activity of reporter constructs in HepG2 cells ( G ) or in 293FT cells ( H ) treated as in panels C, D and E, respectively. ( I ) ChIP-PCR assays show the binding of STAT3 to the wildtype or mutant reporter constructs in HepG2 cells. The forward primers that were used are the same as those used in panel B (BS1′ and BS4′), but GLprimer2 was used as the reverse primer. ( J ) Luciferase activity of reporter constructs in 293FT cells co-transfected with plasmids expressing the indicated proteins (after 2 days). Luciferase data are from two ( C ) or three ( D, E, G, H and J ) experiments (mean + SD). *p<0.05, **p<0.01 and ***p<0.001. 10.7554/eLife.41159.035 Figure 5—source data 1. Luciferase activity of different IRF1 promoter or enhancer constructs in HepG2 cells. 10.7554/eLife.41159.036 Figure 5—source data 2. Luciferase activity of constructs in HepG2 cells co-transfected with STAT3 or control siRNAs. 10.7554/eLife.41159.037 Figure 5—source data 3. Luciferase activity of constructs in 293FT cells co-transfected with STAT3 or RFP plasmids. 10.7554/eLife.41159.038 Figure 5—source data 4. Luciferase activity of mutant constructs in HepG2 cells. 10.7554/eLife.41159.039 Figure 5—source data 5. Luciferase activity of mutant constructs in 293FT cells. 10.7554/eLife.41159.040 Figure 5—source data 6. ChIP-qPCR assays of BS1′ and BS4′ fragments bound by STAT3. 10.7554/eLife.41159.041 Figure 5—source data 7. Luciferase activity of constructs in 293FT cells co-transfected with the indicated plasmids.

Article Snippet: Antibody , Mouse anti-Phospho-STAT3 (Tyr705), (B-7) mouse mAb , Santa Cruz Biotechnology , Cat. #: sc-8059, RRID: AB_628292 , IP (2 ug/500 ul).

Techniques: Binding Assay, Construct, Luciferase, Activity Assay, Plasmid Preparation, Transfection, Control, Mutagenesis, Expressing, ChIP-qPCR

Journal: eLife

Article Title: MicroRNA-122 supports robust innate immunity in hepatocytes by targeting the RTKs/STAT3 signaling pathway

doi: 10.7554/eLife.41159

Figure Lengend Snippet: ( A ) Screenshot (UCSC genome browser, GRCh37/hg19) showing STAT3-binding clusters from the ENCODE ChIP-seq data. Three conserved STAT-binding sites (in blue boxes) are predicted by the ‘TFBS Conserved’ tract. ( B ) Illustration of the locations of primers on the reporter constructs. ( C ) The sequences and locations of the STAT3- and NFκB-binding motifs within the P1 construct. The sequence and location of the PCR primers used for ChIP (referred to as BS1′) are shown in blue. ( D ) The sequences and locations of the STAT3-, NFκB- and IRF1-binding motifs within the P4 construct. Non-canonical NFκB-binding sites were predicted by AliBaba2.1. ( E ) ChIP-qPCR assays of BS1′ and BS4′ fragments bound by STAT3. HepG2 cells were transfected with the indicated siRNAs (20 nM) for 48 hr, and then harvested for ChIP using a STAT3 antibody or normal rabbit IgG. The amount of ChIP DNAs was first normalized to that of input DNAs and then further normalized to that of IgG groups. Data are from one experiment that was representative of three experiments (mean ± SEM of technical triplicates).

Article Snippet: Antibody , Mouse anti-Phospho-STAT3 (Tyr705), (B-7) mouse mAb , Santa Cruz Biotechnology , Cat. #: sc-8059, RRID: AB_628292 , IP (2 ug/500 ul).

Techniques: Binding Assay, ChIP-sequencing, Construct, Sequencing, ChIP-qPCR, Transfection

Journal: eLife

Article Title: MicroRNA-122 supports robust innate immunity in hepatocytes by targeting the RTKs/STAT3 signaling pathway

doi: 10.7554/eLife.41159

Figure Lengend Snippet: ( A ) Strategy for identifying genes that mediated miR-122 regulation of STAT3. ( B ) qRT-PCR analysis of the 20 genes in HepG2 cells transfected with miR-122 or NC mimics (50 nM). The genes are ranked by the repression ratio. ( C ) Analysis of p-STAT1, p-STAT3 and total STAT3 protein in HepG2 cells first treated with the indicated siRNAs (20 nM) for 2 days, and then transfected with poly(I:C) for 24 hr. ( D ) qRT-PCR analysis of IFNs in HepG2 cells treated with siRNAs and poly(I:C), as in panel C. ( E–G ) Analysis of total and phosphorylated STAT3 in HepG2 ( E ), Huh7 ( F ) and 293FT ( G ) cells transfected with plasmids expressing HA- or Flag (FL)-tagged proteins. HA-JAK1 and FL-EGFR plasmids were employed as positive controls. HA-GFP was used as a negative control. qRT-PCR data are from one experiment that was representative of three experiments (mean ± SEM of technical triplicates). 10.7554/eLife.41159.046 Figure 6—source data 1. qRT-PCR analysis of miR-122 levels in HepG2, Huh7, and miR-122-Tet-On cells. 10.7554/eLife.41159.047 Figure 6—source data 2. RT-PCR analysis of the 20 genes in HepG2 cells transfected with miR-122 or NC mimics. 10.7554/eLife.41159.048 Figure 6—source data 3. qRT-PCR analysis of the effectiveness of siRNAs. 10.7554/eLife.41159.049 Figure 6—source data 4. qRT-PCR analysis of IFNs in HepG2 cells treated with siRNAs and poly(I:C).

Article Snippet: Antibody , Mouse anti-Phospho-STAT3 (Tyr705), (B-7) mouse mAb , Santa Cruz Biotechnology , Cat. #: sc-8059, RRID: AB_628292 , IP (2 ug/500 ul).

Techniques: Quantitative RT-PCR, Transfection, Expressing, Negative Control, Reverse Transcription Polymerase Chain Reaction

Journal: eLife

Article Title: MicroRNA-122 supports robust innate immunity in hepatocytes by targeting the RTKs/STAT3 signaling pathway

doi: 10.7554/eLife.41159

Figure Lengend Snippet: ( A ) Luciferase activity of wildtype (WT) and mutant (Mut) reporter constructs in 293FT cells co-transfected with pcDNA6.2-miR-122 (P-miR-122) or pcDNA6.2-miR-neg (P-miR-neg) plasmids. The relative luciferase activities are the ratio of Renilla/Firefly luciferase normalized to that in P-miR-neg groups. The repression ratios (WT/Mut) of each site are shown and sites that significantly (p<0.05) repressed by miR-122 are shown in red. ( B ) qRT-PCR analysis of the 20 genes in normal human liver, HepG2 and Huh7. The expression of each gene was normalized to its level in normal liver. ( C ) Analysis of total and phosphorylated STAT3 in HepG2 cells transfected with indicated siRNAs (50 nM) for 2 days. ( D ) Analysis of MERTK, FGFR1 and IGF1R expression in HepG2 cells treated with miR-122 mimics or specific siRNAs (for 2 days). ( E ) Illustration of the mechanism by which miR-122 regulates STAT3 phosphorylation and the IFN response. Phosphorylated STAT3 can inhibit IRF1 transcriptional activation and thus represses the induction of IFNs upon viral infection. In normal hepatocytes, miR-122 strongly limits the phosphorylation of STAT3 by targeting three RTKs and other STAT3 activators, enabling a robust IFN response upon infection. qRT-PCR data are from one experiment that was representative of three experiments (mean ± SEM of technical triplicates). Luciferase data are from three experiments (mean +SD). 10.7554/eLife.41159.053 Figure 7—source data 1. Luciferase activity of reporter constructs in 293FT cells co-transfected with miR-122 or negative control plasmids. 10.7554/eLife.41159.054 Figure 7—source data 2. qRT-PCR analysis of the 20 genes in normal human liver, HepG2 and Huh7. 10.7554/eLife.41159.055 Figure 7—source data 3. qRT-PCR analysis of the effects of STAT3 knockdown on the expression of 20 genes in HepG2 cells.

Article Snippet: Antibody , Mouse anti-Phospho-STAT3 (Tyr705), (B-7) mouse mAb , Santa Cruz Biotechnology , Cat. #: sc-8059, RRID: AB_628292 , IP (2 ug/500 ul).

Techniques: Luciferase, Activity Assay, Mutagenesis, Construct, Transfection, Quantitative RT-PCR, Expressing, Phospho-proteomics, Activation Assay, Infection, Negative Control, Knockdown

Journal: eLife

Article Title: MicroRNA-122 supports robust innate immunity in hepatocytes by targeting the RTKs/STAT3 signaling pathway

doi: 10.7554/eLife.41159

Figure Lengend Snippet:

Article Snippet: Antibody , Mouse anti-Phospho-STAT3 (Tyr705), (B-7) mouse mAb , Santa Cruz Biotechnology , Cat. #: sc-8059, RRID: AB_628292 , IP (2 ug/500 ul).

Techniques: Recombinant, Construct

Journal: eLife

Article Title: MicroRNA-122 supports robust innate immunity in hepatocytes by targeting the RTKs/STAT3 signaling pathway

doi: 10.7554/eLife.41159

Figure Lengend Snippet:

Article Snippet: Antibody , Mouse anti-Phospho-STAT3 (Tyr705), (B-7) mouse mAb , Santa Cruz Biotechnology , Cat. #: sc-8059, RRID: AB_628292 , IP (2 ug/500 ul).

Techniques:

Journal: iScience

Article Title: Merkel cell polyomavirus T-antigens regulate DICER1 mRNA stability and translation through HSC70

doi: 10.1016/j.isci.2021.103264

Figure Lengend Snippet: AUF1 is not involved in DICER1 regulation in MCC (A) Western blot analysis of DICER1 expression upon AUF1 silencing in MCPyV+ (WaGa and MKL1) and MCPyV− (MCC26) cell lines. Two different siRNAs targeting AUF1 (siAUF1#1 and siAUF#2) were used. siCTR was applied as a negative control. (B) Quantification of DICER1 expression in Figure 6 A. DICER1 expression was normalized to GAPDH and then siCTR. Error bars, SEM. Each biological replicate is presented as a circle. (C) RT-qPCR analysis of DICER1 expression in WaGa cells transfected with siCTR or siAUF1 after actinomycin D (Act. D) treatment. This experiment was conducted in parallel to the HSC70 silencing experiments described in Figure 2 I. p value was assessed by two-way ANOVA. ns, not significant. (D) Western blot analysis of HSC70 and AUF1 in nuclear and cytoplasmic fractions of MCPyV+ cell lines. α-TUBULIN and HISTONE3 were used as cytoplasmic and nuclear markers, respectively. (E) Western blot analysis of HSC70 and AUF1 in cytosolic and nuclear compartments of MCC26 cells transfected with LT339 or pCTR. Lamin A/C was used as nuclear or nuclear membrane marker, whereas GAPDH was used as cytoplasmic marker. Red arrows indicate trLT of LT339.

Article Snippet: Mouse monoclonal anti-α-TUBULIN antibody (B-7) , Santa Cruz Biotechnology , sc-5286 RRID: AB_628411.

Techniques: Western Blot, Expressing, Negative Control, Quantitative RT-PCR, Transfection, Membrane, Marker

Journal: iScience

Article Title: Merkel cell polyomavirus T-antigens regulate DICER1 mRNA stability and translation through HSC70

doi: 10.1016/j.isci.2021.103264

Figure Lengend Snippet:

Article Snippet: Mouse monoclonal anti-α-TUBULIN antibody (B-7) , Santa Cruz Biotechnology , sc-5286 RRID: AB_628411.

Techniques: Virus, Recombinant, Transfection, Electroporation, Bicinchoninic Acid Protein Assay, Reverse Transcription, Gene Expression, Polymerase Chain Reaction, Luciferase, Mutagenesis, In Vitro, Construct, shRNA, Software