promoter reporter clone for human ss18l1 (Genecopoeia)

N/A

Using a secreted and robust Gaussia Luciferase (GLuc) as the reporter, GeneCopoeia GLuc-ON promoter clones are designed for promoter analysis by detecting the real-time activities of about 39,500 human, 28,700 mouse and 17,500 rat promoters

Buy from Supplier

a crest (Novus Biologicals)

Novus Biologicals a crest
A Crest, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ss18l1/SS18L1+Antibody/10__4161_slash_cc__6__12__4305-42-18-28
Average 90 stars, based on 1 article reviews

a crest - by Bioz Stars, 2026-09

90/100 stars

Buy from Supplier

anti ss18l1 (Atlas Antibodies)

Atlas Antibodies anti ss18l1
Anti Ss18l1, supplied by Atlas Antibodies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ss18l1/Anti-SS18L1/10__7554_slash_elife__73523-470-94-114
Average 90 stars, based on 1 article reviews

anti ss18l1 - by Bioz Stars, 2026-09

90/100 stars

Buy from Supplier

crest (Proteintech)

Proteintech crest
$Characterisation of the aggregation capacity of <t>CREST.</t> (A) In cells with diffuse distribution of CREST, it re-localizes to nucleolar caps (arrowheads) in response to transcriptional inhibition. (B) The pool of CREST in nuclear dot-like aggregates fails to redistribute to nucleolar caps upon inhibition of transcription, and the aggregates persist under these conditions, although weakly CREST-positive nuclear caps can be observed (arrowheads). In A and B SH-SY5Y cells were exposed to actinomycin D for 1 hour. (C) CREST is recovered in detergent-insoluble fractions. HEK293 cells expressing untagged CREST were subjected to sequential protein extraction as described in Materials and methods. For total lysate (L) and high-salt (HS) fraction 10% of the amount relative to other fractions was loaded. Bar chart shows relative protein amounts (±s.e.m.) in each fraction quantified by densitometry. (D) Untagged CREST, Flag-CREST and GFP-CREST do not form SDS-resistant oligomeric forms. Cleared lysates of CREST-expressing SH-SY5Y cells were run in SDS-containing agarose gel; all variants were visualized using anti-CREST antibody. Mutant tau protein from spinal cord lysate of a transgenic P301S mouse (detected by phospho-tau-specific antibody) was used to demonstrate typical behavior of amyloid species in this assay. (E) Schematic representation of CREST deletion constructs used in the study. All variants were expressed as GFP-fusion proteins. (F, G) Distribution of CREST deletion mutants in SH-SY5Y cells. CR_dNT and CR_dNT-Met were shifted to the cytoplasm and formed nuclear dot-like aggregates less frequently than full-length protein (G). Bar chart in G shows the fraction of cells (mean ± s.e.m.) with nuclear aggregates for each variant (*** - p < 0.001; at least 150 cells counted per variant in each of the three independent experiments). CREST was expressed for 24 hours prior to actinomycin D exposure, cell lysis or fixation. Scale bars, 10 μm.$
Crest, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ss18l1/CREST+Antibody/pmc04428507-287-10-14
Average 93 stars, based on 1 article reviews

crest - by Bioz Stars, 2026-09

93/100 stars

Buy from Supplier

ss18l1 protein (OriGene)

OriGene ss18l1 protein
$Characterisation of the aggregation capacity of <t>CREST.</t> (A) In cells with diffuse distribution of CREST, it re-localizes to nucleolar caps (arrowheads) in response to transcriptional inhibition. (B) The pool of CREST in nuclear dot-like aggregates fails to redistribute to nucleolar caps upon inhibition of transcription, and the aggregates persist under these conditions, although weakly CREST-positive nuclear caps can be observed (arrowheads). In A and B SH-SY5Y cells were exposed to actinomycin D for 1 hour. (C) CREST is recovered in detergent-insoluble fractions. HEK293 cells expressing untagged CREST were subjected to sequential protein extraction as described in Materials and methods. For total lysate (L) and high-salt (HS) fraction 10% of the amount relative to other fractions was loaded. Bar chart shows relative protein amounts (±s.e.m.) in each fraction quantified by densitometry. (D) Untagged CREST, Flag-CREST and GFP-CREST do not form SDS-resistant oligomeric forms. Cleared lysates of CREST-expressing SH-SY5Y cells were run in SDS-containing agarose gel; all variants were visualized using anti-CREST antibody. Mutant tau protein from spinal cord lysate of a transgenic P301S mouse (detected by phospho-tau-specific antibody) was used to demonstrate typical behavior of amyloid species in this assay. (E) Schematic representation of CREST deletion constructs used in the study. All variants were expressed as GFP-fusion proteins. (F, G) Distribution of CREST deletion mutants in SH-SY5Y cells. CR_dNT and CR_dNT-Met were shifted to the cytoplasm and formed nuclear dot-like aggregates less frequently than full-length protein (G). Bar chart in G shows the fraction of cells (mean ± s.e.m.) with nuclear aggregates for each variant (*** - p < 0.001; at least 150 cells counted per variant in each of the three independent experiments). CREST was expressed for 24 hours prior to actinomycin D exposure, cell lysis or fixation. Scale bars, 10 μm.$
Ss18l1 Protein, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ss18l1/SYT+homolog+1+(SS18L1)+Rabbit+Polyclonal+Antibody/us12473334-1219-5-18
Average 93 stars, based on 1 article reviews

ss18l1 protein - by Bioz Stars, 2026-09

93/100 stars

Buy from Supplier

rnai products sr308680 (OriGene)

OriGene rnai products sr308680
$Characterisation of the aggregation capacity of <t>CREST.</t> (A) In cells with diffuse distribution of CREST, it re-localizes to nucleolar caps (arrowheads) in response to transcriptional inhibition. (B) The pool of CREST in nuclear dot-like aggregates fails to redistribute to nucleolar caps upon inhibition of transcription, and the aggregates persist under these conditions, although weakly CREST-positive nuclear caps can be observed (arrowheads). In A and B SH-SY5Y cells were exposed to actinomycin D for 1 hour. (C) CREST is recovered in detergent-insoluble fractions. HEK293 cells expressing untagged CREST were subjected to sequential protein extraction as described in Materials and methods. For total lysate (L) and high-salt (HS) fraction 10% of the amount relative to other fractions was loaded. Bar chart shows relative protein amounts (±s.e.m.) in each fraction quantified by densitometry. (D) Untagged CREST, Flag-CREST and GFP-CREST do not form SDS-resistant oligomeric forms. Cleared lysates of CREST-expressing SH-SY5Y cells were run in SDS-containing agarose gel; all variants were visualized using anti-CREST antibody. Mutant tau protein from spinal cord lysate of a transgenic P301S mouse (detected by phospho-tau-specific antibody) was used to demonstrate typical behavior of amyloid species in this assay. (E) Schematic representation of CREST deletion constructs used in the study. All variants were expressed as GFP-fusion proteins. (F, G) Distribution of CREST deletion mutants in SH-SY5Y cells. CR_dNT and CR_dNT-Met were shifted to the cytoplasm and formed nuclear dot-like aggregates less frequently than full-length protein (G). Bar chart in G shows the fraction of cells (mean ± s.e.m.) with nuclear aggregates for each variant (*** - p < 0.001; at least 150 cells counted per variant in each of the three independent experiments). CREST was expressed for 24 hours prior to actinomycin D exposure, cell lysis or fixation. Scale bars, 10 μm.$
Rnai Products Sr308680, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ss18l1/SYT+homolog+1+(SS18L1)+Human+siRNA+Oligo+Duplex/us12473334-1222-37-46
Average 93 stars, based on 1 article reviews

rnai products sr308680 - by Bioz Stars, 2026-09

93/100 stars

Buy from Supplier

gene exp ss18l1 hs00988005 m1 (Thermo Fisher)

Thermo Fisher gene exp ss18l1 hs00988005 m1
$Characterisation of the aggregation capacity of <t>CREST.</t> (A) In cells with diffuse distribution of CREST, it re-localizes to nucleolar caps (arrowheads) in response to transcriptional inhibition. (B) The pool of CREST in nuclear dot-like aggregates fails to redistribute to nucleolar caps upon inhibition of transcription, and the aggregates persist under these conditions, although weakly CREST-positive nuclear caps can be observed (arrowheads). In A and B SH-SY5Y cells were exposed to actinomycin D for 1 hour. (C) CREST is recovered in detergent-insoluble fractions. HEK293 cells expressing untagged CREST were subjected to sequential protein extraction as described in Materials and methods. For total lysate (L) and high-salt (HS) fraction 10% of the amount relative to other fractions was loaded. Bar chart shows relative protein amounts (±s.e.m.) in each fraction quantified by densitometry. (D) Untagged CREST, Flag-CREST and GFP-CREST do not form SDS-resistant oligomeric forms. Cleared lysates of CREST-expressing SH-SY5Y cells were run in SDS-containing agarose gel; all variants were visualized using anti-CREST antibody. Mutant tau protein from spinal cord lysate of a transgenic P301S mouse (detected by phospho-tau-specific antibody) was used to demonstrate typical behavior of amyloid species in this assay. (E) Schematic representation of CREST deletion constructs used in the study. All variants were expressed as GFP-fusion proteins. (F, G) Distribution of CREST deletion mutants in SH-SY5Y cells. CR_dNT and CR_dNT-Met were shifted to the cytoplasm and formed nuclear dot-like aggregates less frequently than full-length protein (G). Bar chart in G shows the fraction of cells (mean ± s.e.m.) with nuclear aggregates for each variant (*** - p < 0.001; at least 150 cells counted per variant in each of the three independent experiments). CREST was expressed for 24 hours prior to actinomycin D exposure, cell lysis or fixation. Scale bars, 10 μm.$
Gene Exp Ss18l1 Hs00988005 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ss18l1/Gene+Exp%2E+SS18L1%2C+Hs00988005_m1/pmc06987738-69-45-12
Average 88 stars, based on 1 article reviews

gene exp ss18l1 hs00988005 m1 - by Bioz Stars, 2026-09

88/100 stars

Buy from Supplier

sirnas against ss18l1 (Ribobio co)

Ribobio co sirnas against ss18l1

Expression of <t>SS18L1</t> in rat sciatic nerve stumps after peripheral nerve injury. (A) The relative mRNA expression of SS18L1 at 0, 1, 4, 7, and 14 days after sciatic nerve crush injury. * P < 0.05, vs. 0 day. (B) Immunostaining of SS18L1 (in red) and S100β (in green) at 0, 1, 4, 7, and 14 days after sciatic nerve crush injury. DAPI (in blue) was used to stain nuclei. Scale bars indicated 1,000 μm (main image), 20 μm (magnification). (C) Quantification of the fluorescence intensity of SS18L1 staining in rat sciatic nerves at 0, 1, 4, 7, and 14 days after nerve injury. ** P < 0.01, vs. 0 day.

Sirnas Against Ss18l1, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ss18l1/sirnas+against+ss18l1/pmc09420995-58-8-25
Average 90 stars, based on 1 article reviews

sirnas against ss18l1 - by Bioz Stars, 2026-09

90/100 stars

Buy from Supplier

ss18l1 nm 138918 rat tagged orf clone (OriGene)

N/A

Lenti ORF clone of Ss18l1 Myc DDK tagged ORF Rat synovial sarcoma translocation gene on chromosome 18 like 1 Ss18l1 10 ug

Buy from Supplier

aav-m-ss18l1-shrna (Vector Biolabs)

N/A

Buy from Supplier

syt homolog 1 ss18l1 nm 001301778 human tagged orf clone (OriGene)

N/A

SS18L1 GFP tagged Human synovial sarcoma translocation gene on chromosome 18 like 1 SS18L1 transcript variant 2

Buy from Supplier

human ss18l1 knockout cell line (AcceGen Biotechnology)

N/A

Human SS18L1 knockout cell line is edited by CRISPR/Cas9 technology.

Buy from Supplier

Image Search Results

$Characterisation of the aggregation capacity of CREST. (A) In cells with diffuse distribution of CREST, it re-localizes to nucleolar caps (arrowheads) in response to transcriptional inhibition. (B) The pool of CREST in nuclear dot-like aggregates fails to redistribute to nucleolar caps upon inhibition of transcription, and the aggregates persist under these conditions, although weakly CREST-positive nuclear caps can be observed (arrowheads). In A and B SH-SY5Y cells were exposed to actinomycin D for 1 hour. (C) CREST is recovered in detergent-insoluble fractions. HEK293 cells expressing untagged CREST were subjected to sequential protein extraction as described in Materials and methods. For total lysate (L) and high-salt (HS) fraction 10% of the amount relative to other fractions was loaded. Bar chart shows relative protein amounts (±s.e.m.) in each fraction quantified by densitometry. (D) Untagged CREST, Flag-CREST and GFP-CREST do not form SDS-resistant oligomeric forms. Cleared lysates of CREST-expressing SH-SY5Y cells were run in SDS-containing agarose gel; all variants were visualized using anti-CREST antibody. Mutant tau protein from spinal cord lysate of a transgenic P301S mouse (detected by phospho-tau-specific antibody) was used to demonstrate typical behavior of amyloid species in this assay. (E) Schematic representation of CREST deletion constructs used in the study. All variants were expressed as GFP-fusion proteins. (F, G) Distribution of CREST deletion mutants in SH-SY5Y cells. CR_dNT and CR_dNT-Met were shifted to the cytoplasm and formed nuclear dot-like aggregates less frequently than full-length protein (G). Bar chart in G shows the fraction of cells (mean ± s.e.m.) with nuclear aggregates for each variant (*** - p < 0.001; at least 150 cells counted per variant in each of the three independent experiments). CREST was expressed for 24 hours prior to actinomycin D exposure, cell lysis or fixation. Scale bars, 10 μm.$

Journal: Molecular Neurodegeneration

Article Title: Calcium-responsive transactivator (CREST) protein shares a set of structural and functional traits with other proteins associated with amyotrophic lateral sclerosis

doi: 10.1186/s13024-015-0014-y

Figure Lengend Snippet: Characterisation of the aggregation capacity of CREST. (A) In cells with diffuse distribution of CREST, it re-localizes to nucleolar caps (arrowheads) in response to transcriptional inhibition. (B) The pool of CREST in nuclear dot-like aggregates fails to redistribute to nucleolar caps upon inhibition of transcription, and the aggregates persist under these conditions, although weakly CREST-positive nuclear caps can be observed (arrowheads). In A and B SH-SY5Y cells were exposed to actinomycin D for 1 hour. (C) CREST is recovered in detergent-insoluble fractions. HEK293 cells expressing untagged CREST were subjected to sequential protein extraction as described in Materials and methods. For total lysate (L) and high-salt (HS) fraction 10% of the amount relative to other fractions was loaded. Bar chart shows relative protein amounts (±s.e.m.) in each fraction quantified by densitometry. (D) Untagged CREST, Flag-CREST and GFP-CREST do not form SDS-resistant oligomeric forms. Cleared lysates of CREST-expressing SH-SY5Y cells were run in SDS-containing agarose gel; all variants were visualized using anti-CREST antibody. Mutant tau protein from spinal cord lysate of a transgenic P301S mouse (detected by phospho-tau-specific antibody) was used to demonstrate typical behavior of amyloid species in this assay. (E) Schematic representation of CREST deletion constructs used in the study. All variants were expressed as GFP-fusion proteins. (F, G) Distribution of CREST deletion mutants in SH-SY5Y cells. CR_dNT and CR_dNT-Met were shifted to the cytoplasm and formed nuclear dot-like aggregates less frequently than full-length protein (G). Bar chart in G shows the fraction of cells (mean ± s.e.m.) with nuclear aggregates for each variant (*** - p < 0.001; at least 150 cells counted per variant in each of the three independent experiments). CREST was expressed for 24 hours prior to actinomycin D exposure, cell lysis or fixation. Scale bars, 10 μm.

Article Snippet: Commercially available primary antibodies against the following antigens were used: CREST (rabbit polyclonal, 12439-1-AP, Proteintech); FUS (mouse monoclonal against C-terminus, Santa Cruz, sc-47711; rabbit polyclonal, ab84078, Abcam); p54nrb (rabbit polyclonal C-terminal, Sigma); TIAR (mouse monoclonal, BD Biosciences); G3BP1 (mouse monoclonal, BD Biosciences); Dcp1a (rabbit polyclonal C-terminal, Sigma); anti-Flag M2 (mouse monoclonal, Sigma); PSPC1 (rabbit polyclonal C-terminal, Sigma); GFP (Living Colours® rabbit polyclonal, Clontech, #632593); SMN (mouse monoclonal, BD Biosciences); cyclin A (rabbit polyclonal, Santa Cruz, sc-751); p80 coilin (mouse monoclonal, BD Biosciences); PML (chicken polyclonal, a kind gift from Prof. Ronald Hay, Dundee); phosphorylated tau (mouse monoclonal, clone AT8, Thermo Scientific); beta-actin (mouse monoclonal, clone AC15, Sigma); alpha-tubulin (mouse monoclonal, clone DM1A, Sigma).

Techniques: Inhibition, Expressing, Protein Extraction, Agarose Gel Electrophoresis, Mutagenesis, Transgenic Assay, Construct, Variant Assay, Lysis

CREST is targeted to stress granules by various stresses. (A) CREST-Flag (top panel) and CREST-GFP (three bottom panels) are detected in stress granules induced by oxidative stress (sodium arsenite, SA), ER stress (thapsigargin, thaps) or inhibition of eIF4E (15d-PGJ2) and visualized with stress granule markers TIAR, FMRP and G3BP1. SA and 15d-PGJ2 were applied to SH-SY5Y cells for 1 hour and thapsigargin – for 4 hours. (B) In SH-SY5Y cells subjected to oxidative stress (SA for 1 hour) CREST-GFP undergoes significant shift to the cytoplasm. (C, D) CREST deletion mutant lacking autoregulatory domain (CR_dNT) is readily recruited to stress granules (C) and shows higher enrichment in these structures compared to full-length protein ( D , left graph). This phenomenon is related to higher cytoplasmic levels of CR_dNT since the fluorescence intensity ratio stress granules/cytoplasm is similar for full-length and truncated protein (D) . (E) Cytoplasmic aggregates of CREST-GFP do not overlap with SA-induced stress granules but are found in their immediate vicinity. (F) Cytoplasmic aggregates of CREST-GFP do not overlap with P-bodies (visualized by anti-Dcp1a staining, arrowheads in the enlarged panel). (G) Aggresomes formed by GFP-tagged CREST lacking MFD domain are negative for a SG marker G3BP1. In B and D , fluorescence was measured in stress granules and/or cytoplasm of GFP-positive cells as described in Materials and methods, and cytoplasmic intensity for non-stressed cells (B) or full-length CREST-GFP (D) (mean ± s.e.m.) was taken as equal 1 (***p < 0.001). Scale bars, 10 μm.

Journal: Molecular Neurodegeneration

Article Title: Calcium-responsive transactivator (CREST) protein shares a set of structural and functional traits with other proteins associated with amyotrophic lateral sclerosis

doi: 10.1186/s13024-015-0014-y

Figure Lengend Snippet: CREST is targeted to stress granules by various stresses. (A) CREST-Flag (top panel) and CREST-GFP (three bottom panels) are detected in stress granules induced by oxidative stress (sodium arsenite, SA), ER stress (thapsigargin, thaps) or inhibition of eIF4E (15d-PGJ2) and visualized with stress granule markers TIAR, FMRP and G3BP1. SA and 15d-PGJ2 were applied to SH-SY5Y cells for 1 hour and thapsigargin – for 4 hours. (B) In SH-SY5Y cells subjected to oxidative stress (SA for 1 hour) CREST-GFP undergoes significant shift to the cytoplasm. (C, D) CREST deletion mutant lacking autoregulatory domain (CR_dNT) is readily recruited to stress granules (C) and shows higher enrichment in these structures compared to full-length protein ( D , left graph). This phenomenon is related to higher cytoplasmic levels of CR_dNT since the fluorescence intensity ratio stress granules/cytoplasm is similar for full-length and truncated protein (D) . (E) Cytoplasmic aggregates of CREST-GFP do not overlap with SA-induced stress granules but are found in their immediate vicinity. (F) Cytoplasmic aggregates of CREST-GFP do not overlap with P-bodies (visualized by anti-Dcp1a staining, arrowheads in the enlarged panel). (G) Aggresomes formed by GFP-tagged CREST lacking MFD domain are negative for a SG marker G3BP1. In B and D , fluorescence was measured in stress granules and/or cytoplasm of GFP-positive cells as described in Materials and methods, and cytoplasmic intensity for non-stressed cells (B) or full-length CREST-GFP (D) (mean ± s.e.m.) was taken as equal 1 (***p < 0.001). Scale bars, 10 μm.

Techniques: Inhibition, Mutagenesis, Fluorescence, Staining, Marker

$CREST aggregation disrupts paraspeckles. (A) CREST aggregates might originate from the sites of paraspeckle formation. Paraspeckles (anti-NONO/p54nrb staining, arrowheads) and CREST nuclear aggregates exist as distinct structures in COS7 cells (top panel). In a fraction of cells CREST aggregates are found in close apposition to/partially overlapping with paraspeckles (bottom panel). (B) In response to transcriptional inhibition CREST redistributes to the same nucleolar caps as a typical paraspeckle protein FUS but not to the caps formed by coilin p80. (C) CREST lacking autoregulatory domain is efficiently recruited in paraspeckles (top panel) and redistributes to nucleolar caps (bottom panel). (D) Endogenous FUS is not essential for nuclear aggregation of CREST. Cells were co-transfected with FUS siRNA and a plasmid to express CREST-Flag and were analysed 48 hours post-transfection. (E-G) CREST efficiently sequesters endogenous FUS into dot-like nuclear aggregates in COS7 cells. In contrast, two other paraspeckle components, p54nrb and PSPC1, are not recruited to small and medium-sized CREST aggregates (F and G, top panels), and are detected in aggregates only in nuclei with extensive CREST aggregation (F and G, bottom panels). (H, I) Presence of CREST aggregates in the nucleus negatively affects paraspeckles. The fraction of cells with paraspeckles among COS7 cells expressing CREST-Flag (anti-p54nrb staining) or CREST-GFP (FISH with NEAT1 probe) was quantified separately for cells with diffuse CREST distribution and with nuclear CREST aggregates (mean ± s.e.m, *p < 0.05, **p < 0.01; 150-250 cells counted from each of the four or three independent experiments). (J) NEAT1 levels are decreased in CREST-expressing cells. Untagged CREST or GFP (vector) were expressed in SH-SY5Y cells for 24 hours; NEAT1 levels were measured by qPCR (**p < 0.01; results from four independent experiments run in duplicates). Scale bars, A – 5 μm; B-G – 10 μm.$

Journal: Molecular Neurodegeneration

Article Title: Calcium-responsive transactivator (CREST) protein shares a set of structural and functional traits with other proteins associated with amyotrophic lateral sclerosis

doi: 10.1186/s13024-015-0014-y

Figure Lengend Snippet: CREST aggregation disrupts paraspeckles. (A) CREST aggregates might originate from the sites of paraspeckle formation. Paraspeckles (anti-NONO/p54nrb staining, arrowheads) and CREST nuclear aggregates exist as distinct structures in COS7 cells (top panel). In a fraction of cells CREST aggregates are found in close apposition to/partially overlapping with paraspeckles (bottom panel). (B) In response to transcriptional inhibition CREST redistributes to the same nucleolar caps as a typical paraspeckle protein FUS but not to the caps formed by coilin p80. (C) CREST lacking autoregulatory domain is efficiently recruited in paraspeckles (top panel) and redistributes to nucleolar caps (bottom panel). (D) Endogenous FUS is not essential for nuclear aggregation of CREST. Cells were co-transfected with FUS siRNA and a plasmid to express CREST-Flag and were analysed 48 hours post-transfection. (E-G) CREST efficiently sequesters endogenous FUS into dot-like nuclear aggregates in COS7 cells. In contrast, two other paraspeckle components, p54nrb and PSPC1, are not recruited to small and medium-sized CREST aggregates (F and G, top panels), and are detected in aggregates only in nuclei with extensive CREST aggregation (F and G, bottom panels). (H, I) Presence of CREST aggregates in the nucleus negatively affects paraspeckles. The fraction of cells with paraspeckles among COS7 cells expressing CREST-Flag (anti-p54nrb staining) or CREST-GFP (FISH with NEAT1 probe) was quantified separately for cells with diffuse CREST distribution and with nuclear CREST aggregates (mean ± s.e.m, *p < 0.05, **p < 0.01; 150-250 cells counted from each of the four or three independent experiments). (J) NEAT1 levels are decreased in CREST-expressing cells. Untagged CREST or GFP (vector) were expressed in SH-SY5Y cells for 24 hours; NEAT1 levels were measured by qPCR (**p < 0.01; results from four independent experiments run in duplicates). Scale bars, A – 5 μm; B-G – 10 μm.

Techniques: Staining, Inhibition, Transfection, Plasmid Preparation, Expressing

$CREST co-aggregates with FUS but not with TDP-43 or TAF15. (A) Endogenous FUS co-immunoprecipitates with CREST-GFP. Pull-down of GFP-tagged CREST from transfected cells was performed with GFP-Trap beads as described in Material and methods, endogenous FUS was detected in the immunoprecipitate (IP) by Western blotting (WB). (B) CREST-Flag recruits GFP-tagged FUS (top panel) and its cytoplasmically mislocalised variant bearing R522 substitution (FUS R522G, middle panel) into nuclear aggregates upon co-expression in SH-SY5Y cells. In a small fraction of co-expressing cells the latter variant also co-aggregates with CREST in the cytoplasm (middle, arrowheads, border of the nucleus is indicated by a dashed line in the inset) but in the majority of such cells it is trapped in the nucleus leading to its lowered cytoplasmic levels and significant decrease in the proportion of cells bearing cytoplasmic FUS aggregates (FAs, bottom panel). The number of cells with aggregates was quantified for cells expressing GFP-tagged FUS R522G only (FUS-GFP) and those co-expressing GFP-tagged FUS R522G and CREST-Flag (FUS + CREST). The bar chart shows the fraction of cells (mean ± s.e.m.) bearing FAs (***p < 0.001; at least 100 cells counted per variant from three independent experiments). (C) CREST-GFP and FUS-Flag with R522G substitution co-aggregate. (D) N-terminally truncated protein (FUS-GFP CT, aa. 360-526) cannot be recruited to CREST-Flag aggregates (top panel), while C-terminally truncated FUS (FUS-GFP NT, aa.1-359) retains the ability to co-aggregate with CREST (bottom panel). (E) CREST does not sequester wild-type TDP-43 into nuclear aggregates and is not recruited to cytoplasmic (arrow) or nuclear (arrowheads) aggregates formed by mislocalised TDP-43 (TDP-43-GFP dNLS) or C-terminal TDP-43 fragment (TDP-43-GFP CT, aa.193-414). NLS of TDP-43 was deleted to achieve cytoplasmic re-distribution and aggregation of the protein. (F) Nuclear aggregates of Flag-tagged CREST and GFP-tagged TAF15 do not overlap. Scale bars, 10 μm.$

Journal: Molecular Neurodegeneration

Article Title: Calcium-responsive transactivator (CREST) protein shares a set of structural and functional traits with other proteins associated with amyotrophic lateral sclerosis

doi: 10.1186/s13024-015-0014-y

Figure Lengend Snippet: CREST co-aggregates with FUS but not with TDP-43 or TAF15. (A) Endogenous FUS co-immunoprecipitates with CREST-GFP. Pull-down of GFP-tagged CREST from transfected cells was performed with GFP-Trap beads as described in Material and methods, endogenous FUS was detected in the immunoprecipitate (IP) by Western blotting (WB). (B) CREST-Flag recruits GFP-tagged FUS (top panel) and its cytoplasmically mislocalised variant bearing R522 substitution (FUS R522G, middle panel) into nuclear aggregates upon co-expression in SH-SY5Y cells. In a small fraction of co-expressing cells the latter variant also co-aggregates with CREST in the cytoplasm (middle, arrowheads, border of the nucleus is indicated by a dashed line in the inset) but in the majority of such cells it is trapped in the nucleus leading to its lowered cytoplasmic levels and significant decrease in the proportion of cells bearing cytoplasmic FUS aggregates (FAs, bottom panel). The number of cells with aggregates was quantified for cells expressing GFP-tagged FUS R522G only (FUS-GFP) and those co-expressing GFP-tagged FUS R522G and CREST-Flag (FUS + CREST). The bar chart shows the fraction of cells (mean ± s.e.m.) bearing FAs (***p < 0.001; at least 100 cells counted per variant from three independent experiments). (C) CREST-GFP and FUS-Flag with R522G substitution co-aggregate. (D) N-terminally truncated protein (FUS-GFP CT, aa. 360-526) cannot be recruited to CREST-Flag aggregates (top panel), while C-terminally truncated FUS (FUS-GFP NT, aa.1-359) retains the ability to co-aggregate with CREST (bottom panel). (E) CREST does not sequester wild-type TDP-43 into nuclear aggregates and is not recruited to cytoplasmic (arrow) or nuclear (arrowheads) aggregates formed by mislocalised TDP-43 (TDP-43-GFP dNLS) or C-terminal TDP-43 fragment (TDP-43-GFP CT, aa.193-414). NLS of TDP-43 was deleted to achieve cytoplasmic re-distribution and aggregation of the protein. (F) Nuclear aggregates of Flag-tagged CREST and GFP-tagged TAF15 do not overlap. Scale bars, 10 μm.

Techniques: Transfection, Western Blot, Variant Assay, Expressing

Expression of SS18L1 in rat sciatic nerve stumps after peripheral nerve injury. (A) The relative mRNA expression of SS18L1 at 0, 1, 4, 7, and 14 days after sciatic nerve crush injury. * P < 0.05, vs. 0 day. (B) Immunostaining of SS18L1 (in red) and S100β (in green) at 0, 1, 4, 7, and 14 days after sciatic nerve crush injury. DAPI (in blue) was used to stain nuclei. Scale bars indicated 1,000 μm (main image), 20 μm (magnification). (C) Quantification of the fluorescence intensity of SS18L1 staining in rat sciatic nerves at 0, 1, 4, 7, and 14 days after nerve injury. ** P < 0.01, vs. 0 day.

Journal: Frontiers in Veterinary Science

Article Title: Transcription factor SS18L1 regulates the proliferation, migration and differentiation of Schwann cells in peripheral nerve injury

doi: 10.3389/fvets.2022.936620

Figure Lengend Snippet: Expression of SS18L1 in rat sciatic nerve stumps after peripheral nerve injury. (A) The relative mRNA expression of SS18L1 at 0, 1, 4, 7, and 14 days after sciatic nerve crush injury. * P < 0.05, vs. 0 day. (B) Immunostaining of SS18L1 (in red) and S100β (in green) at 0, 1, 4, 7, and 14 days after sciatic nerve crush injury. DAPI (in blue) was used to stain nuclei. Scale bars indicated 1,000 μm (main image), 20 μm (magnification). (C) Quantification of the fluorescence intensity of SS18L1 staining in rat sciatic nerves at 0, 1, 4, 7, and 14 days after nerve injury. ** P < 0.01, vs. 0 day.

Article Snippet: Cultured primary Schwann cells were transfected with 3 siRNAs against SS18L1 (SS18L1-siRNA-1: CCAGAGCAAGGGCAAGACA, SS18L1-siRNA-2: CCATAGCAGATTCCAACCA, and SS18L1-siRNA-3: CAACCCAGAACATGAACCT) or a non-targeting negative control (NC-siRNA: GGCTCTAGAAAAGCCTATGC) (RiboBio, Guangzhou, Guangdong, China) for 48 h using Lipofectamine RNAiMAX reagent (Invitrogen, Thermo Fisher Scientific, Inc.) according to the manufacturer's instruction.

Techniques: Expressing, Immunostaining, Staining, Fluorescence

Localization of SS18L1 in cultured Schwann cells. Red color indicates SS18L1, green color indicates S100β, and blue color indicates nucleus. Scale bars indicated 20 μm.

Journal: Frontiers in Veterinary Science

Article Title: Transcription factor SS18L1 regulates the proliferation, migration and differentiation of Schwann cells in peripheral nerve injury

doi: 10.3389/fvets.2022.936620

Figure Lengend Snippet: Localization of SS18L1 in cultured Schwann cells. Red color indicates SS18L1, green color indicates S100β, and blue color indicates nucleus. Scale bars indicated 20 μm.

Techniques: Cell Culture

The effect of SS18L1 on Schwann cell proliferation. (A) Relative mRNA expression of SS18L1 in Schwann cells transfected with SS18L1 siRNAs or siRNA control (NC-siRNA). * P < 0.05, vs. siRNA control, *** P < 0.001, vs. siRNA control. (B) Representative images and histogram of the proliferation of Schwann cells transfected with SS18L1 siRNA or siRNA control. Red color indicates Schwann cells stained with EdU and blue color indicates Schwann cells stained with Hoechst 33342. Scale bars indicated 100 μm. (C) Summarized histogram of the proliferation of Schwann cells transfected with SS18L1 siRNA or siRNA control. ** P < 0.01, vs. siRNA control.

Journal: Frontiers in Veterinary Science

Article Title: Transcription factor SS18L1 regulates the proliferation, migration and differentiation of Schwann cells in peripheral nerve injury

doi: 10.3389/fvets.2022.936620

Figure Lengend Snippet: The effect of SS18L1 on Schwann cell proliferation. (A) Relative mRNA expression of SS18L1 in Schwann cells transfected with SS18L1 siRNAs or siRNA control (NC-siRNA). * P < 0.05, vs. siRNA control, *** P < 0.001, vs. siRNA control. (B) Representative images and histogram of the proliferation of Schwann cells transfected with SS18L1 siRNA or siRNA control. Red color indicates Schwann cells stained with EdU and blue color indicates Schwann cells stained with Hoechst 33342. Scale bars indicated 100 μm. (C) Summarized histogram of the proliferation of Schwann cells transfected with SS18L1 siRNA or siRNA control. ** P < 0.01, vs. siRNA control.

Techniques: Expressing, Transfection, Control, Staining

The effect of SS18L1 on Schwann cell migration. (A) The schematic diagram of cell migration assay. (B) Representative images of the migration of Schwann cells transfected with SS18L1 siRNA or siRNA control. Violet color indicated Schwann cells migrated toward the bottom surface. Scale bars indicated 50 μm. (C) Summarized histogram of the migration of Schwann cells transfected with SS18L1 siRNA or siRNA control. * P < 0.05, vs. siRNA control.

Journal: Frontiers in Veterinary Science

Article Title: Transcription factor SS18L1 regulates the proliferation, migration and differentiation of Schwann cells in peripheral nerve injury

doi: 10.3389/fvets.2022.936620

Figure Lengend Snippet: The effect of SS18L1 on Schwann cell migration. (A) The schematic diagram of cell migration assay. (B) Representative images of the migration of Schwann cells transfected with SS18L1 siRNA or siRNA control. Violet color indicated Schwann cells migrated toward the bottom surface. Scale bars indicated 50 μm. (C) Summarized histogram of the migration of Schwann cells transfected with SS18L1 siRNA or siRNA control. * P < 0.05, vs. siRNA control.

Techniques: Migration, Cell Migration Assay, Transfection, Control

The effect of SS18L1 on Schwann cell differentiation. (A) The mRNA levels of P0 and MBP were higher in Schwann cells cultured in differentiation culture medium (db-cAMP + HRG) than those cultured in control medium. (B) The mRNA levels of P0 and MBP were higher in siRNA control transfected Schwann cells cultured in differentiation culture medium than SS18L1 siRNA transfected Schwann cells cultured in differentiation culture medium. * P < 0.05, vs. siRNA control.

Journal: Frontiers in Veterinary Science

Article Title: Transcription factor SS18L1 regulates the proliferation, migration and differentiation of Schwann cells in peripheral nerve injury

doi: 10.3389/fvets.2022.936620

Figure Lengend Snippet: The effect of SS18L1 on Schwann cell differentiation. (A) The mRNA levels of P0 and MBP were higher in Schwann cells cultured in differentiation culture medium (db-cAMP + HRG) than those cultured in control medium. (B) The mRNA levels of P0 and MBP were higher in siRNA control transfected Schwann cells cultured in differentiation culture medium than SS18L1 siRNA transfected Schwann cells cultured in differentiation culture medium. * P < 0.05, vs. siRNA control.

Techniques: Cell Differentiation, Cell Culture, Control, Transfection

Bioinformatics analysis showing SS18L1-centered genetic network. (A) Cytoscape software predicted the associated genes and biological functions of SS18L1. Different colors of network nodes, respectively, represent various biological functions, while node sizes reflect the enrichment of biological functions. (B) STRING was used to analyze the interaction network among the selected differentially expressed genes. (C) The heatmap of the expression patterns of interacted genes in sciatic nerve stumps after nerve injury. Red color indicates up-regulation and blue color indicates down-regulation. (D) The interaction network of SS18L1 and associated proteins DF2, SMARCD1, SMARCA4, SMARCE1.

Journal: Frontiers in Veterinary Science

Article Title: Transcription factor SS18L1 regulates the proliferation, migration and differentiation of Schwann cells in peripheral nerve injury

doi: 10.3389/fvets.2022.936620

Figure Lengend Snippet: Bioinformatics analysis showing SS18L1-centered genetic network. (A) Cytoscape software predicted the associated genes and biological functions of SS18L1. Different colors of network nodes, respectively, represent various biological functions, while node sizes reflect the enrichment of biological functions. (B) STRING was used to analyze the interaction network among the selected differentially expressed genes. (C) The heatmap of the expression patterns of interacted genes in sciatic nerve stumps after nerve injury. Red color indicates up-regulation and blue color indicates down-regulation. (D) The interaction network of SS18L1 and associated proteins DF2, SMARCD1, SMARCA4, SMARCE1.

Techniques: Software, Expressing

ss18l1 Search Results

Image Search Results