|
Sino Biological
spint2 Spint2, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/spint2/product/Sino Biological Average 93 stars, based on 1 article reviews
spint2 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp spint2 hs00173936 m1 Gene Exp Spint2 Hs00173936 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp spint2 hs00173936 m1/product/Thermo Fisher Average 88 stars, based on 1 article reviews
gene exp spint2 hs00173936 m1 - by Bioz Stars,
2026-03
88/100 stars
|
Buy from Supplier |
|
OriGene
spint2 hai 2 nm 021102 human myc ddk Spint2 Hai 2 Nm 021102 Human Myc Ddk, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/spint2 hai 2 nm 021102 human myc ddk/product/OriGene Average 93 stars, based on 1 article reviews
spint2 hai 2 nm 021102 human myc ddk - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp spint2 hs01070442 m1 Gene Exp Spint2 Hs01070442 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp spint2 hs01070442 m1/product/Thermo Fisher Average 86 stars, based on 1 article reviews
gene exp spint2 hs01070442 m1 - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
OriGene
ggacagaagagtcggctccatt Ggacagaagagtcggctccatt, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ggacagaagagtcggctccatt/product/OriGene Average 93 stars, based on 1 article reviews
ggacagaagagtcggctccatt - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
ProSci Incorporated
amino acids 264 283 Amino Acids 264 283, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/amino acids 264 283/product/ProSci Incorporated Average 86 stars, based on 1 article reviews
amino acids 264 283 - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Boster Bio
spint2 ![]() Spint2, supplied by Boster Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/spint2/product/Boster Bio Average 90 stars, based on 1 article reviews
spint2 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Abnova
polyclonal abs fli1 antibody ![]() Polyclonal Abs Fli1 Antibody, supplied by Abnova, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/polyclonal abs fli1 antibody/product/Abnova Average 90 stars, based on 1 article reviews
polyclonal abs fli1 antibody - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
homozygous hepatocyte-specific conditional spint2 knockout mice ![]() Homozygous Hepatocyte Specific Conditional Spint2 Knockout Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/homozygous hepatocyte-specific conditional spint2 knockout mice/product/Jackson Laboratory Average 90 stars, based on 1 article reviews
homozygous hepatocyte-specific conditional spint2 knockout mice - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
SAS institute
spint2 −/− subline sas/hai-2ko#2 ![]() Spint2 −/− Subline Sas/Hai 2ko#2, supplied by SAS institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/spint2 −/− subline sas/hai-2ko#2/product/SAS institute Average 90 stars, based on 1 article reviews
spint2 −/− subline sas/hai-2ko#2 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
OriGene
spint2 (nm_001082548) mouse tagged orf clone ![]() Spint2 (Nm 001082548) Mouse Tagged Orf Clone, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/spint2 (nm_001082548) mouse tagged orf clone/product/OriGene Average 90 stars, based on 1 article reviews
spint2 (nm_001082548) mouse tagged orf clone - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Frontiers in Oncology
Article Title: Multi-platform Affinity Proteomics Identify Proteins Linked to Metastasis and Immune Suppression in Ovarian Cancer Plasma
doi: 10.3389/fonc.2019.01150
Figure Lengend Snippet: Cellular origin of upregulated proteins. (A) Transcriptome analysis of the top 30 proteins increased in OC-plasma (from ). (B) Proteome analysis as in (A) . Due to the lower sensitivity of MS-based proteomics, especially for secreted proteins , data were not available for a number of proteins. Boxplots show medians (horizontal line in boxes), upper and lower quartiles (box) and range (whiskers). Arrows point out MUC16, SPINT2, and WFDC2. TU, tumor cells; TAM, tumor-associated macrophage; TAT, tumor-associated T-cells.
Article Snippet: Other proteins were quantified by ELISA according to the instructions of the respective manufacturer: BCAM (ELH-BCAM-2; BioCat GmbH, Heidelberg, Germany); EPHA2 (ELH-EPHA2-1; RayBiotech Life, Peachtree Corners, GA, USA); GDF15 (DGD150; R&D Systems, Wiesbaden, Germany); IL-6 (Invitrogen-88-7066-22; Thermo Fisher Scientific, Schwerte, Germany); IL-18BP (DBP180; R&D Systems, Wiesbaden, Germany); OPN/SPP1 (DOST00; R&D Systems, Wiesbaden, Germany); SPON1 (CSB-EL022599HU-96; Cusabio, Houston, TX, USA); VEGFA (BMS277-2; Thermo Fisher Scientific, Schwerte, Germany); WFDC2/HE4 (DHE400; R&D Systems, Wiesbaden, Germany);
Techniques: Clinical Proteomics
Journal: Frontiers in Oncology
Article Title: Multi-platform Affinity Proteomics Identify Proteins Linked to Metastasis and Immune Suppression in Ovarian Cancer Plasma
doi: 10.3389/fonc.2019.01150
Figure Lengend Snippet: Association of SPINT2 mRNA expression with survival of OC patients. (A) Kaplan-Meier plot for 1074 HGSC patients in the Kaplan–Meier Plotter database (updated version at http://kmplot.com ) analyzing the association of SPINT2 with RFS. HR, hazard ratio. (B) Kaplan-Meier plot for 1074 HGSC patients in the same database analyzing the association of SPINT2 with OS. (C) z-scores (PRECOG data) for the association of SPINT2 with the overall survival (OS) of the indicated tumor entities . Red: association with a short OS (z-score above +1.5;). Blue: association with a short OS (z-score below −1.5).
Article Snippet: Other proteins were quantified by ELISA according to the instructions of the respective manufacturer: BCAM (ELH-BCAM-2; BioCat GmbH, Heidelberg, Germany); EPHA2 (ELH-EPHA2-1; RayBiotech Life, Peachtree Corners, GA, USA); GDF15 (DGD150; R&D Systems, Wiesbaden, Germany); IL-6 (Invitrogen-88-7066-22; Thermo Fisher Scientific, Schwerte, Germany); IL-18BP (DBP180; R&D Systems, Wiesbaden, Germany); OPN/SPP1 (DOST00; R&D Systems, Wiesbaden, Germany); SPON1 (CSB-EL022599HU-96; Cusabio, Houston, TX, USA); VEGFA (BMS277-2; Thermo Fisher Scientific, Schwerte, Germany); WFDC2/HE4 (DHE400; R&D Systems, Wiesbaden, Germany);
Techniques: Expressing
Journal: Oncotarget
Article Title: Hepatocyte growth factor activator inhibitor type-2 (HAI-2)/ SPINT2 contributes to invasive growth of oral squamous cell carcinoma cells
doi: 10.18632/oncotarget.24450
Figure Lengend Snippet: (A) A representative photo of reverse transcription polymerase chain reaction (RT-PCR) (upper panel) and semi-quantification of mRNA by quantitative RT-PCR (qRT-PCR) (lower panel). Data of qRT-PCR are mean ± standard deviation (SD) of four independent experiments. # , p = 0.097; ## , p = 0.129, compared to HaCaT (Student’s t-test). (B) Generation of SPINT2 −/− sublines (HAI-2KO # 1 and # 2) and one SPINT1 −/− sublines (HAI-1KO) in each of HaCaT or SAS cell line, as well as one SPINT2 −/− subline (HAI-2KO) in HSC3. Immunoblots for HAI-2 (mAb 2A6121) and HAI-1 (mAb M19) were performed using cellular extracts. β-actin was used as an internal loading control (actin). Specific HAI-2 bands in parent cells (parent) and mock-transfected cells (mock) were absent in HAI-2KO lines. * , non-specific bands observed in all lanes. (C) Effects of PNGF treatment on HAI-2 of SAS cells. The same blot membrane was reprobed with β-actin antibody. (D) Reversion of HAI-2 in SAS/HAI-2KO#1 subline to generate SAS/HAI-2rev. Immunoblot for HAI-2 using extracts from control cells (control), SAS/HAI-2KO # 1 cells (HAI-2KO), mock-transfected control cells from SAS/HAI-2KO#1 (mock) and SAS/HAI-2rev cells (HAI-2rev) is shown. * , non-specific bands observed in all lanes. The same blot membrane was reprobed with β-actin antibody.
Article Snippet: Two
Techniques: Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Standard Deviation, Western Blot, Control, Transfection, Membrane
Journal: Oncotarget
Article Title: Hepatocyte growth factor activator inhibitor type-2 (HAI-2)/ SPINT2 contributes to invasive growth of oral squamous cell carcinoma cells
doi: 10.18632/oncotarget.24450
Figure Lengend Snippet: (A) Colony-forming efficiency of HaCaT, SAS and HSC3 cell lines and their mutant sublines. * , p < 0.01 compared to mock and HAI-2KO # 1 (HaCaT) or parent and mock (HSC3); ** , p < 0.001 compared to parent or mock; n = 6 in each group, Mann-Whitney U test. Error bars, SD. (B) Effects of HAI mutations on the growth curve of SAS cells. * , p < 0.001; # , p < 0.01; ANOVA with Fisher’s PLSD test. N = 3 in each group. Error bars, SD. (C) Effect of HAI-2 reversion on colony-forming efficiency of SPINT2 −/− cells. * , p < 0.05 Mann-Whitney U test; n = 6. Error bars, SD. (D) Effect of HAI-2-deficiency on anchorage-independent growth of SAS cells of in soft agar. Means ± SD of colony number per ×40 field (left graph) and colony diameter (right graph, μm) are indicated. N = 9 for each group; * , p < 0.01 Mann-Whitney U test. Representative photos are also shown. Bar, 50 μm. (E) Effect of HAI-2 deficiency on in vivo tumor growth. Mock-transfected control SAS cells or SAS/HAI-2KO#1 were injected into the subcutaneous tissue of nude mice with or without MRC5 human fibroblasts. N = 5 for each group; * , p < 0.0001 ANOVA with Fisher’s PLSD test. Error bars, standard error. Representative histology of formed SAS tumors transplanted with MRC5 fibroblasts is also shown (HE section; bar, 500 μm).
Article Snippet: Two
Techniques: Mutagenesis, MANN-WHITNEY, In Vivo, Transfection, Control, Injection
Journal: Oncotarget
Article Title: Hepatocyte growth factor activator inhibitor type-2 (HAI-2)/ SPINT2 contributes to invasive growth of oral squamous cell carcinoma cells
doi: 10.18632/oncotarget.24450
Figure Lengend Snippet: (A) Decreased Matrigel invasiveness by SAS cells after SPINT2 deletion and effect of HAI-2 reversion. Data of both normoxic and hypoxic conditions are shown. * , p < 0.001 Mann-Whitney U test; n = 12; error bar, SD. (B) Decreased Matrigel invasiveness by HSC3 cells after SPINT2 deletion. * , p < 0.01; ** , p < 0.05 Mann-Whitney U test; n = 8; error bar, SD. (C) Increased Matrigel invasiveness after SPINT1 deletion from SAS cells. * , p < 0.0001 Mann-Whitney U test; n = 24; error bar, SD. (D) Effects of HAI mutations on Matrigel invasiveness by HaCaT cells.
Article Snippet: Two
Techniques: MANN-WHITNEY
Journal: Oncotarget
Article Title: Hepatocyte growth factor activator inhibitor type-2 (HAI-2)/ SPINT2 contributes to invasive growth of oral squamous cell carcinoma cells
doi: 10.18632/oncotarget.24450
Figure Lengend Snippet: (A) RT-PCR analyses of nine TTSPs and two GPI-anchored serine proteases in HaCaT, SAS, HSC3 and their mutants. (B) Quantitative RT-PCR for prostasin mRNA in SAS, HSC3 and their mutants. * , p < 0.001 compared to parent and mock; ** , p < 0.05 compared to parent and mock; # , p < 0.05 compared to parent; Student’s t-test, n = 3 for each group. (C) Immunoblot analysis of prostasin. Prostasin proteins in cellular extracts from parental lines of HaCaT, SAS and HSC3 were compared. (D) Immunoblot analysis of prostasin in extracts of SAS, HSC3 and their mutant lines cultured under normoxic or hypoxic conditions. (E) Effect of HAI-2 reversion (HAI-2rev) in SAS/HAI-2KO#1 cells on the prostasin protein level.
Article Snippet: Two
Techniques: Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot, Mutagenesis, Cell Culture
Journal: Oncotarget
Article Title: Hepatocyte growth factor activator inhibitor type-2 (HAI-2)/ SPINT2 contributes to invasive growth of oral squamous cell carcinoma cells
doi: 10.18632/oncotarget.24450
Figure Lengend Snippet: (A, B) Effect of prostasin silencing by prostasin siRNA # 1 (siPro # 1) and # 2 (siPro # 2) on migration in wound healing assays and Matrigel invasiveness by SPINT2 −/− SAS (SAS/HAI-2KO # 1) (A) and SPINT2 −/− HSC3 cells (B) under normoxic condition. Two kinds of prostasin siRNAs were used and the extents of silencing are shown in the top panel. * , p < 0.01; ** , p < 0.05; n = 8, Mann-Whitney U test. Photos are represented images of mock-transfected control and HAI-2KO cells 0 h (control siRNA) and 12 h (control siRNA and prostasin siRNA # 1) after wounding. All images for each set wound healing assay experiments are presented in . (C) Effects of HAI mutations on matriptase activation and shedding in OSCC cell lines. Data under normoxic and hypoxic conditions are shown. Anti-total matriptase mAb (M24) and anti-activated matriptase mAb (M69) were used for detection of matriptase. For supernatants, the same blot was reproved by anti-HAI-1 mAb M19.
Article Snippet: Two
Techniques: Migration, MANN-WHITNEY, Transfection, Control, Wound Healing Assay, Activation Assay
Journal: Oncotarget
Article Title: Hepatocyte growth factor activator inhibitor type-2 (HAI-2)/ SPINT2 contributes to invasive growth of oral squamous cell carcinoma cells
doi: 10.18632/oncotarget.24450
Figure Lengend Snippet: (A) Validation of specificity of the primary antibody (XY9) by immunohistochemistry. Xenotransplanted tumors of control SAS (mock) and SAS/HAI-2KO # 1 (HAI-2KO) were immunostained with XY9 mouse mAb against human HAI-2. Intracytoplasmic HAI-2 immunoreactivity was noted in the control cells. Faint immunoreactivity was observed by omitting the primary antibody (mock NC), suggesting a reaction of the secondary antibody to mouse IgG. Immunostaining of HAI-2KO tumor resulted in a pattern similar to mock NC. (B) Validation of the XY9 mAb by immunocytochemistry. No immunoreactivity was observed in SPINT2 −/− (HAI-2KO) SAS cells. (C) Immunohistochemistry of surgically resected human OSCC tissues by XY9 mAb. Representative results of non-neoplastic stratified epithelium, intraepithelial neoplasia and invasive OSCC in the same specimen from OSCC case No.23 (OSCC23, left column) and OSCC7 (right column). Note that whereas non-neoplastic epithelium shows faint or distinct immunoreactivity depending on the case, neoplastic lesions are consistently positive, indicating higher expression levels compared to the non-neoplastic epithelium. Insets indicate internal positive control (minor salivary gland epithelium). Bars, 200 μm. (D) Comparative immunohistochemistry of HAI-2 and prostasin in serial sections of OSCC and adjacent non-malignant epithelium (OSCC10). Note that HAI-2 is strongly expressed in the overt cancer cells, whereas prostasin is preferentially expressed in differentiated keratinocytes, showing a reciprocal expression pattern. Bar, 200 μm. (E) Comparative immunohistochemistry of HAI-1 (mAb 1N7) and HAI-2 in serial sections of invasive OSCC (OSCC1). The cancer cells at the invasive front are mostly negative for membranous HAI-1, whereas they are strongly positive for HAI-2. Bar, 100 μm.
Article Snippet: Two
Techniques: Biomarker Discovery, Immunohistochemistry, Control, Immunostaining, Immunocytochemistry, Expressing, Positive Control