spint2 Search Results


gene exp spint2 hs01070442 m1  (Thermo Fisher)
86
Thermo Fisher gene exp spint2 hs01070442 m1
Gene Exp Spint2 Hs01070442 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spint2/Gene+Exp%2E+spint2+hs01070442+m1/pmc10394170__mmc5-753-56--1
Average 86 stars, based on 1 article reviews
gene exp spint2 hs01070442 m1 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
spint2  (Sino Biological)
92
Sino Biological spint2
Spint2, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spint2/Human+SPINT2+Protein/pm39746545-163-21-22
Average 92 stars, based on 1 article reviews
spint2 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier
rc202044  (OriGene)
92
OriGene rc202044
Rc202044, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spint2/SPINT2+(NM_021102)+Human+Tagged+ORF+Clone/pm34089062-375-0-11
Average 92 stars, based on 1 article reviews
rc202044 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier
murine hai 2 nm 001082548 orf  (OriGene)
90
OriGene murine hai 2 nm 001082548 orf
Murine Hai 2 Nm 001082548 Orf, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spint2/Spint2+(NM_001082548)+Mouse+Tagged+ORF+Clone+Lentiviral+Particle/10__1074_slash_jbc__ra118__006468-271-0-15
Average 90 stars, based on 1 article reviews
murine hai 2 nm 001082548 orf - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
ggacagaagagtcggctccatt  (OriGene)
91
OriGene ggacagaagagtcggctccatt
Ggacagaagagtcggctccatt, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spint2/Spint2+Mouse+qPCR+Primer+Pair/pm37830556-71-59-60
Average 91 stars, based on 1 article reviews
ggacagaagagtcggctccatt - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier
spint2  (Boster Bio)
90
Boster Bio spint2
Cellular origin of upregulated proteins. (A) Transcriptome analysis of the top 30 proteins increased in OC-plasma (from ). (B) Proteome analysis as in (A) . Due to the lower sensitivity of MS-based proteomics, especially for secreted proteins , data were not available for a number of proteins. Boxplots show medians (horizontal line in boxes), upper and lower quartiles (box) and range (whiskers). Arrows point out MUC16, <t>SPINT2,</t> and WFDC2. TU, tumor cells; TAM, tumor-associated macrophage; TAT, tumor-associated T-cells.
Spint2, supplied by Boster Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spint2/Human+HAI-2%2FSPINT2+ELISA+Kit+PicoKine/pmc06839336-89-72-74
Average 90 stars, based on 1 article reviews
spint2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
amino acids 264 283  (ProSci Incorporated)
86
ProSci Incorporated amino acids 264 283
Cellular origin of upregulated proteins. (A) Transcriptome analysis of the top 30 proteins increased in OC-plasma (from ). (B) Proteome analysis as in (A) . Due to the lower sensitivity of MS-based proteomics, especially for secreted proteins , data were not available for a number of proteins. Boxplots show medians (horizontal line in boxes), upper and lower quartiles (box) and range (whiskers). Arrows point out MUC16, <t>SPINT2,</t> and WFDC2. TU, tumor cells; TAM, tumor-associated macrophage; TAT, tumor-associated T-cells.
Amino Acids 264 283, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spint2/SPINT2+Antibody/pmc05626530-261-10-14
Average 86 stars, based on 1 article reviews
amino acids 264 283 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
recombinant ssx gst-tagged proteins (ssx1-5)  (Abnova)
90
Abnova recombinant ssx gst-tagged proteins (ssx1-5)
Cellular origin of upregulated proteins. (A) Transcriptome analysis of the top 30 proteins increased in OC-plasma (from ). (B) Proteome analysis as in (A) . Due to the lower sensitivity of MS-based proteomics, especially for secreted proteins , data were not available for a number of proteins. Boxplots show medians (horizontal line in boxes), upper and lower quartiles (box) and range (whiskers). Arrows point out MUC16, <t>SPINT2,</t> and WFDC2. TU, tumor cells; TAM, tumor-associated macrophage; TAT, tumor-associated T-cells.
Recombinant Ssx Gst Tagged Proteins (Ssx1 5), supplied by Abnova, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spint2/antibodies+to+gnpat++spint2++fli1++ssx1/pm21880588-64-3-5
Average 90 stars, based on 1 article reviews
recombinant ssx gst-tagged proteins (ssx1-5) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
spint2 knockdown cells  (MedChemExpress)
93
MedChemExpress spint2 knockdown cells
Cellular origin of upregulated proteins. (A) Transcriptome analysis of the top 30 proteins increased in OC-plasma (from ). (B) Proteome analysis as in (A) . Due to the lower sensitivity of MS-based proteomics, especially for secreted proteins , data were not available for a number of proteins. Boxplots show medians (horizontal line in boxes), upper and lower quartiles (box) and range (whiskers). Arrows point out MUC16, <t>SPINT2,</t> and WFDC2. TU, tumor cells; TAM, tumor-associated macrophage; TAT, tumor-associated T-cells.
Spint2 Knockdown Cells, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spint2/HAI-2%2C+Human/pm41067336-110-10-15
Average 93 stars, based on 1 article reviews
spint2 knockdown cells - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
hai-2/spint2 antibody  (Bio-Techne corporation)
90
Bio-Techne corporation hai-2/spint2 antibody
Cellular origin of upregulated proteins. (A) Transcriptome analysis of the top 30 proteins increased in OC-plasma (from ). (B) Proteome analysis as in (A) . Due to the lower sensitivity of MS-based proteomics, especially for secreted proteins , data were not available for a number of proteins. Boxplots show medians (horizontal line in boxes), upper and lower quartiles (box) and range (whiskers). Arrows point out MUC16, <t>SPINT2,</t> and WFDC2. TU, tumor cells; TAM, tumor-associated macrophage; TAT, tumor-associated T-cells.
Hai 2/Spint2 Antibody, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spint2/HAI-2%2FSPINT2+Antibody/bio-techne+corporation___nbp1-83299
Average 90 stars, based on 1 article reviews
hai-2/spint2 antibody - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
placental bikunin bay 39-9437/aer002  (Aerovance Inc)
90
Aerovance Inc placental bikunin bay 39-9437/aer002
Cellular origin of upregulated proteins. (A) Transcriptome analysis of the top 30 proteins increased in OC-plasma (from ). (B) Proteome analysis as in (A) . Due to the lower sensitivity of MS-based proteomics, especially for secreted proteins , data were not available for a number of proteins. Boxplots show medians (horizontal line in boxes), upper and lower quartiles (box) and range (whiskers). Arrows point out MUC16, <t>SPINT2,</t> and WFDC2. TU, tumor cells; TAM, tumor-associated macrophage; TAT, tumor-associated T-cells.
Placental Bikunin Bay 39 9437/Aer002, supplied by Aerovance Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spint2/aer002++bikunin++truncated+form+of+human+protease+inhibitor+spint2+/pm22111616-169-0-11
Average 90 stars, based on 1 article reviews
placental bikunin bay 39-9437/aer002 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Cellular origin of upregulated proteins. (A) Transcriptome analysis of the top 30 proteins increased in OC-plasma (from ). (B) Proteome analysis as in (A) . Due to the lower sensitivity of MS-based proteomics, especially for secreted proteins , data were not available for a number of proteins. Boxplots show medians (horizontal line in boxes), upper and lower quartiles (box) and range (whiskers). Arrows point out MUC16, SPINT2, and WFDC2. TU, tumor cells; TAM, tumor-associated macrophage; TAT, tumor-associated T-cells.

Journal: Frontiers in Oncology

Article Title: Multi-platform Affinity Proteomics Identify Proteins Linked to Metastasis and Immune Suppression in Ovarian Cancer Plasma

doi: 10.3389/fonc.2019.01150

Figure Lengend Snippet: Cellular origin of upregulated proteins. (A) Transcriptome analysis of the top 30 proteins increased in OC-plasma (from ). (B) Proteome analysis as in (A) . Due to the lower sensitivity of MS-based proteomics, especially for secreted proteins , data were not available for a number of proteins. Boxplots show medians (horizontal line in boxes), upper and lower quartiles (box) and range (whiskers). Arrows point out MUC16, SPINT2, and WFDC2. TU, tumor cells; TAM, tumor-associated macrophage; TAT, tumor-associated T-cells.

Article Snippet: Other proteins were quantified by ELISA according to the instructions of the respective manufacturer: BCAM (ELH-BCAM-2; BioCat GmbH, Heidelberg, Germany); EPHA2 (ELH-EPHA2-1; RayBiotech Life, Peachtree Corners, GA, USA); GDF15 (DGD150; R&D Systems, Wiesbaden, Germany); IL-6 (Invitrogen-88-7066-22; Thermo Fisher Scientific, Schwerte, Germany); IL-18BP (DBP180; R&D Systems, Wiesbaden, Germany); OPN/SPP1 (DOST00; R&D Systems, Wiesbaden, Germany); SPON1 (CSB-EL022599HU-96; Cusabio, Houston, TX, USA); VEGFA (BMS277-2; Thermo Fisher Scientific, Schwerte, Germany); WFDC2/HE4 (DHE400; R&D Systems, Wiesbaden, Germany); SPINT2 (EK0773-CAP; Boster, Pleasanton, USA); PVRL4/NECTIN4 (DNEC40; R&D Systems, Wiesbaden, Germany).

Techniques: Clinical Proteomics

Association of SPINT2 mRNA expression with survival of OC patients. (A) Kaplan-Meier plot for 1074 HGSC patients in the Kaplan–Meier Plotter database (updated version at http://kmplot.com ) analyzing the association of SPINT2 with RFS. HR, hazard ratio. (B) Kaplan-Meier plot for 1074 HGSC patients in the same database analyzing the association of SPINT2 with OS. (C) z-scores (PRECOG data) for the association of SPINT2 with the overall survival (OS) of the indicated tumor entities . Red: association with a short OS (z-score above +1.5;). Blue: association with a short OS (z-score below −1.5).

Journal: Frontiers in Oncology

Article Title: Multi-platform Affinity Proteomics Identify Proteins Linked to Metastasis and Immune Suppression in Ovarian Cancer Plasma

doi: 10.3389/fonc.2019.01150

Figure Lengend Snippet: Association of SPINT2 mRNA expression with survival of OC patients. (A) Kaplan-Meier plot for 1074 HGSC patients in the Kaplan–Meier Plotter database (updated version at http://kmplot.com ) analyzing the association of SPINT2 with RFS. HR, hazard ratio. (B) Kaplan-Meier plot for 1074 HGSC patients in the same database analyzing the association of SPINT2 with OS. (C) z-scores (PRECOG data) for the association of SPINT2 with the overall survival (OS) of the indicated tumor entities . Red: association with a short OS (z-score above +1.5;). Blue: association with a short OS (z-score below −1.5).

Article Snippet: Other proteins were quantified by ELISA according to the instructions of the respective manufacturer: BCAM (ELH-BCAM-2; BioCat GmbH, Heidelberg, Germany); EPHA2 (ELH-EPHA2-1; RayBiotech Life, Peachtree Corners, GA, USA); GDF15 (DGD150; R&D Systems, Wiesbaden, Germany); IL-6 (Invitrogen-88-7066-22; Thermo Fisher Scientific, Schwerte, Germany); IL-18BP (DBP180; R&D Systems, Wiesbaden, Germany); OPN/SPP1 (DOST00; R&D Systems, Wiesbaden, Germany); SPON1 (CSB-EL022599HU-96; Cusabio, Houston, TX, USA); VEGFA (BMS277-2; Thermo Fisher Scientific, Schwerte, Germany); WFDC2/HE4 (DHE400; R&D Systems, Wiesbaden, Germany); SPINT2 (EK0773-CAP; Boster, Pleasanton, USA); PVRL4/NECTIN4 (DNEC40; R&D Systems, Wiesbaden, Germany).

Techniques: Expressing