Journal: Frontiers in Plant Science

Article Title: Optimizing a tomato crocin biofactory by fine-tuning plant architecture

doi: 10.3389/fpls.2025.1730399

Figure Lengend Snippet: Targeted genes and constructs. (A) Representation of the exon regions of SP and SP5G genes, and the transcriptional unit of the hygromycin resistance gene ( HygR ). The positions of the designed guide RNAs (gRNAs) are indicated with arrows. (B) Schematic representation of the T-DNA of the constructs used to target SP , SP5G , and HygR with CRISPR/Cas9. nptII , kanamycin resistance gene; SP , self-pruning.

Article Snippet: The guide RNAs (gRNAs) targeting the tomato genes were designed for Streptococcus pyogenes Cas9 using Benchling CRISPR Tool [Biology Software] (2022) with SL3.0 as the reference genome.

Techniques: Construct, CRISPR

Journal: Frontiers in Plant Science

Article Title: Optimizing a tomato crocin biofactory by fine-tuning plant architecture

doi: 10.3389/fpls.2025.1730399

Figure Lengend Snippet: CRISPR/Cas9 editing results. (A) Chromatograms of the selected sp # 4 and sp5g #6 edited lines. The gRNA sequences are underlined, and the PAM sequences are highlighted in red. The mismatches between the wild-type and mutated sequences are indicated in red in the mutated sequence. (B) Agarose gel of the PCR for HygR gene amplification. (C) Results of in vitro germination of hygr #6B seeds with and without hygromycin in the media. (D) Representation of the large deletion in hygr #6B line. TF, Tomaffron; SP , self-pruning.

Article Snippet: The guide RNAs (gRNAs) targeting the tomato genes were designed for Streptococcus pyogenes Cas9 using Benchling CRISPR Tool [Biology Software] (2022) with SL3.0 as the reference genome.

Techniques: CRISPR, Sequencing, Agarose Gel Electrophoresis, Amplification, In Vitro

Journal: Scientific Reports

Article Title: Impaired myogenesis in limb girdle muscular dystrophy type 2B

doi: 10.1038/s41598-025-10205-9

Figure Lengend Snippet: Silencing of the DYSF gene by CRISPR/Cas9 successfully reduces the synthesis of the dysferlin protein in myotubes from the control cell line. ( A ) Immunofluorescence staining indicating the absence of DYSF in the edited cell line, and the presence of myosin, showing that the cells maintain their capacity to differentiate. ( B ) Protein detection by western blotting highlights the reduction of the dysferlin protein to the levels of the LGMD2B myotubes and shows a secondary reduction of the calpain-3 protein, a finding already observed in other LGMD2B patients. Internal WB control for protein content in each sample can be observed with labelling to dystrophin (DMD), dysferlin (DYSF) and calpain3 (CAPN3).

Article Snippet: Sanger sequencing was performed to identify possible mutations and estimate the efficiency of gene editing, and we analyzed the .abi resulting files in the online software ICE CRISPR Analysis Tool (Synthego, www.synthego.com/products/bioinformatics/crispr-analysis ).

Techniques: CRISPR, Control, Immunofluorescence, Staining, Western Blot

Journal: Cell

Article Title: Quiescent cancer cells resist T cell attack by forming an immunosuppressive niche.

doi: 10.1016/j.cell.2022.03.033

Figure Lengend Snippet: Figure 6. HIF1a in tumor cells modulates T cell infiltration and exhaustion, controlling killing of tumor cells (A) Percentage of CD8+ T cells in WT or Hif1aSTBL 4T07 tumors (n = 5 mice). (B and C) T cell exhaustion in CD8+ T cells from (A). (B) Representative plot. (C) Mean ± SEM of PD1+ TIM3 CD8+ T cells (n = 6 mice). (legend continued on next page)

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072533 Hif1a gRNA: AGTGCACCCTAACAAGCCGG IDT Alt-R CRISPR-Cas9 crRNA Ifnar1 gRNA: GCTCGCTGTCGTGGGCGCGG IDT Alt-R CRISPR-Cas9 crRNA Recombinant DNA 3rd Generation Lentiviral packaging vectors Dr. Brian Brown, Mount Sinai N/A PGK:eGFP Lentiviral vector Dr. Brian Brown, Mount Sinai N/A mVenus:p27k reporter Dr. Toshio Kitamura, University of Tokyo N/A PGK:mCherry Lentiviral vector Dr. Brian Brown, Mount Sinai N/A H2B-mCherry Addgene Cat#51007 H2B-tdTomato Addgene Cat#58101 rtTA Addgene Cat#104543 TetON lentiviral expression vector Addgene Cat#131687 Hif1a STBL: mHif-1a MYC (P402A/P577A/N813A) Addgene Cat#44028 Software and algorithms FlowJo 10 BD https://www.flowjo.com Prism 9 GraphPad https://www.graphpad.com/scientific- software/prism/ FiJi (v2.0.0-rc-69/1.52i) ImageJ https://imagej.net/software/fiji/ Seurat Satija Lab https://satijalab.org/seurat/articles/ pbmc3k_tutorial.html DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Akoya CODEX Processor Akoya https://www.akoyabio.com/phenocycler/ software/ clusterProfiler Bioconductor https://bioconductor.org/packages/ release/bioc/html/clusterProfiler.html bigSCale2 Iacono et al. (2019) https://github.com/iaconogi/bigSCale2 Benchling Benchling ttps://www.benchling.com Biorender Biorender https://biorender.com/ Other Compresstome Precisionary VF-310-0Z ll Article

Techniques: