snps Search Results


snps rs17680137  (Thermo Fisher)
86
Thermo Fisher snps rs17680137
Snps Rs17680137, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/snps/pmc02701337-128-2-39?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
snps rs17680137 - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
mir 196a c t single nucleotide polymorphism rs11614913  (Thermo Fisher)
93
Thermo Fisher mir 196a c t single nucleotide polymorphism rs11614913
Mir 196a C T Single Nucleotide Polymorphism Rs11614913, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/snps/pm39811383-70-1-17?v=Thermo+Fisher
Average 93 stars, based on 1 article reviews
mir 196a c t single nucleotide polymorphism rs11614913 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier
snps rs12329305  (Thermo Fisher)
91
Thermo Fisher snps rs12329305
Allelic association of HOXA1 rs10951154, OSR1 <t> rs12329305, </t> and near FOXF1 rs9936833 single nucleotide polymorphisms (SNPs) with stillborn/neonatal death due to malformations/genetic disorders. (No of cases: 140; No of controls: 200).
Snps Rs12329305, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/snps/pmc04156340-93-4-33?v=Thermo+Fisher
Average 91 stars, based on 1 article reviews
snps rs12329305 - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier
rs12979860 single nucleotide polymorphism  (Thermo Fisher)
88
Thermo Fisher rs12979860 single nucleotide polymorphism
Allelic association of HOXA1 rs10951154, OSR1 <t> rs12329305, </t> and near FOXF1 rs9936833 single nucleotide polymorphisms (SNPs) with stillborn/neonatal death due to malformations/genetic disorders. (No of cases: 140; No of controls: 200).
Rs12979860 Single Nucleotide Polymorphism, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/snps/pmc07231429-146-16-25?v=Thermo+Fisher
Average 88 stars, based on 1 article reviews
rs12979860 single nucleotide polymorphism - by Bioz Stars, 2026-07
88/100 stars
  Buy from Supplier
mbl2 rs10824792 snps  (Thermo Fisher)
86
Thermo Fisher mbl2 rs10824792 snps
Allelic association of HOXA1 rs10951154, OSR1 <t> rs12329305, </t> and near FOXF1 rs9936833 single nucleotide polymorphisms (SNPs) with stillborn/neonatal death due to malformations/genetic disorders. (No of cases: 140; No of controls: 200).
Mbl2 Rs10824792 Snps, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/snps/pm20056178-43-3-47?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
mbl2 rs10824792 snps - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
rs10455872 snps  (Thermo Fisher)
86
Thermo Fisher rs10455872 snps
Allelic association of HOXA1 rs10951154, OSR1 <t> rs12329305, </t> and near FOXF1 rs9936833 single nucleotide polymorphisms (SNPs) with stillborn/neonatal death due to malformations/genetic disorders. (No of cases: 140; No of controls: 200).
Rs10455872 Snps, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/snps/pm24161338-60-5-11?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
rs10455872 snps - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
rs10757278 single nucleotide polymorphisms snps  (Thermo Fisher)
86
Thermo Fisher rs10757278 single nucleotide polymorphisms snps
Allelic association of HOXA1 rs10951154, OSR1 <t> rs12329305, </t> and near FOXF1 rs9936833 single nucleotide polymorphisms (SNPs) with stillborn/neonatal death due to malformations/genetic disorders. (No of cases: 140; No of controls: 200).
Rs10757278 Single Nucleotide Polymorphisms Snps, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/snps/pmc02745117-68-9-23?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
rs10757278 single nucleotide polymorphisms snps - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
snps rs11209026  (Thermo Fisher)
86
Thermo Fisher snps rs11209026
Allelic association of HOXA1 rs10951154, OSR1 <t> rs12329305, </t> and near FOXF1 rs9936833 single nucleotide polymorphisms (SNPs) with stillborn/neonatal death due to malformations/genetic disorders. (No of cases: 140; No of controls: 200).
Snps Rs11209026, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/snps/pmc02266952-4-0-12?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
snps rs11209026 - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
snps rs10494961  (Thermo Fisher)
86
Thermo Fisher snps rs10494961
Allelic association of HOXA1 rs10951154, OSR1 <t> rs12329305, </t> and near FOXF1 rs9936833 single nucleotide polymorphisms (SNPs) with stillborn/neonatal death due to malformations/genetic disorders. (No of cases: 140; No of controls: 200).
Snps Rs10494961, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/snps/pmc02978959-323-26-17?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
snps rs10494961 - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
apol1 snps rs73885319  (Thermo Fisher)
86
Thermo Fisher apol1 snps rs73885319
Allelic association of HOXA1 rs10951154, OSR1 <t> rs12329305, </t> and near FOXF1 rs9936833 single nucleotide polymorphisms (SNPs) with stillborn/neonatal death due to malformations/genetic disorders. (No of cases: 140; No of controls: 200).
Apol1 Snps Rs73885319, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/snps/pmc04615696-132-5-17?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
apol1 snps rs73885319 - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
snps rs17595731  (Thermo Fisher)
86
Thermo Fisher snps rs17595731
Allelic association of HOXA1 rs10951154, OSR1 <t> rs12329305, </t> and near FOXF1 rs9936833 single nucleotide polymorphisms (SNPs) with stillborn/neonatal death due to malformations/genetic disorders. (No of cases: 140; No of controls: 200).
Snps Rs17595731, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/snps/pmc05678327-26-23-16?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
snps rs17595731 - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
il28b rs12979860 single nucleotide polymorphisms  (Thermo Fisher)
86
Thermo Fisher il28b rs12979860 single nucleotide polymorphisms
Allelic association of HOXA1 rs10951154, OSR1 <t> rs12329305, </t> and near FOXF1 rs9936833 single nucleotide polymorphisms (SNPs) with stillborn/neonatal death due to malformations/genetic disorders. (No of cases: 140; No of controls: 200).
Il28b Rs12979860 Single Nucleotide Polymorphisms, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/snps/pm27003037-43-0-12?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
il28b rs12979860 single nucleotide polymorphisms - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

Image Search Results


Allelic association of HOXA1 rs10951154, OSR1 rs12329305, and near FOXF1 rs9936833 single nucleotide polymorphisms (SNPs) with stillborn/neonatal death due to malformations/genetic disorders. (No of cases: 140; No of controls: 200).

Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

Article Title: The OSR1 rs12329305 Polymorphism Contributes to the Development of Congenital Malformations in Cases of Stillborn/Neonatal Death

doi: 10.12659/MSM.890916

Figure Lengend Snippet: Allelic association of HOXA1 rs10951154, OSR1 rs12329305, and near FOXF1 rs9936833 single nucleotide polymorphisms (SNPs) with stillborn/neonatal death due to malformations/genetic disorders. (No of cases: 140; No of controls: 200).

Article Snippet: Genotyping of the 3 SNPs – rs12329305, rs9936833, and rs10951154 – within OSR1 , near FOXF1, and within HOXA1 , respectively, was performed with real-time PCR using the ABIPRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, USA) and pre-developed TaqMan assay reagents, C_25994108_20 VIC/FAM, CCGCAGTGCCGCACCTGTGGTCTCG [C/T] AGGTGGTCTTGCCTCCGGAAGGCTT for rs12329305 SNP, C_1937647_20 VIC/FAM, TTTAACAAAACAGAAGTCAAAAGCA [C/T] TGCCACTCTCTACCACCCTCCTAGA for rs9936833 SNP and C_27262818_10 VIC/FAM, and CTGGTAGGTAGCCGGCTGGGGGTGG [C/T] GATGGTGGTGGTGGTGGTGGTGGTG for rs10951154 SNP.

Techniques:

Genotype association of HOXA1 rs10951154, OSR1 rs12329305, and FOXF1 rs9936833 single-nucleotide polymorphisms (SNPs) with stillborn/neonatal death due to malformations/genetic disorders (140 cases, 200 controls) (*p=0.0013).

Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

Article Title: The OSR1 rs12329305 Polymorphism Contributes to the Development of Congenital Malformations in Cases of Stillborn/Neonatal Death

doi: 10.12659/MSM.890916

Figure Lengend Snippet: Genotype association of HOXA1 rs10951154, OSR1 rs12329305, and FOXF1 rs9936833 single-nucleotide polymorphisms (SNPs) with stillborn/neonatal death due to malformations/genetic disorders (140 cases, 200 controls) (*p=0.0013).

Article Snippet: Genotyping of the 3 SNPs – rs12329305, rs9936833, and rs10951154 – within OSR1 , near FOXF1, and within HOXA1 , respectively, was performed with real-time PCR using the ABIPRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, USA) and pre-developed TaqMan assay reagents, C_25994108_20 VIC/FAM, CCGCAGTGCCGCACCTGTGGTCTCG [C/T] AGGTGGTCTTGCCTCCGGAAGGCTT for rs12329305 SNP, C_1937647_20 VIC/FAM, TTTAACAAAACAGAAGTCAAAAGCA [C/T] TGCCACTCTCTACCACCCTCCTAGA for rs9936833 SNP and C_27262818_10 VIC/FAM, and CTGGTAGGTAGCCGGCTGGGGGTGG [C/T] GATGGTGGTGGTGGTGGTGGTGGTG for rs10951154 SNP.

Techniques:

Allelic association of OSR1 rs12329305 polymorphism and specific subgroups of stillborn/neonatal death malformations/genetic disorders according to autopsy examinations.

Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

Article Title: The OSR1 rs12329305 Polymorphism Contributes to the Development of Congenital Malformations in Cases of Stillborn/Neonatal Death

doi: 10.12659/MSM.890916

Figure Lengend Snippet: Allelic association of OSR1 rs12329305 polymorphism and specific subgroups of stillborn/neonatal death malformations/genetic disorders according to autopsy examinations.

Article Snippet: Genotyping of the 3 SNPs – rs12329305, rs9936833, and rs10951154 – within OSR1 , near FOXF1, and within HOXA1 , respectively, was performed with real-time PCR using the ABIPRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, USA) and pre-developed TaqMan assay reagents, C_25994108_20 VIC/FAM, CCGCAGTGCCGCACCTGTGGTCTCG [C/T] AGGTGGTCTTGCCTCCGGAAGGCTT for rs12329305 SNP, C_1937647_20 VIC/FAM, TTTAACAAAACAGAAGTCAAAAGCA [C/T] TGCCACTCTCTACCACCCTCCTAGA for rs9936833 SNP and C_27262818_10 VIC/FAM, and CTGGTAGGTAGCCGGCTGGGGGTGG [C/T] GATGGTGGTGGTGGTGGTGGTGGTG for rs10951154 SNP.

Techniques: Isolation