Journal: Molecular Neurodegeneration

Article Title: LRP1 is a neuronal receptor for α-synuclein uptake and spread

doi: 10.1186/s13024-022-00560-w

Figure Lengend Snippet: LRP1 regulates α-Syn uptake in iPSNs. a and b , α-Syn uptake in WT and LRP1 -KO iPSNs measured by flow cytometry (100 nM, 3 h of treatment). c Representative images of WT or LRP1 -KO iPSNs after α-Syn uptake. Scale bars, 20 μm. d and e , Transferrin (Tfn) uptake in WT and LRP1 -KO iPSNs measured by flow cytometry (300 nM, 3 h of treatment). f Uptake of α-Syn and Tfn in the presence of increasing concentrations of RAP. g EM images showing the structure of α-Syn oligomers and preformed fibrils (PFFs) used in panel h. Scale bars, 200 nm. h Uptake of α-Syn oligomers and PFFs in WT and LRP1 -KO iPSNs (100 nM monomer equivalent, 3 h of treatment). All experiments in ( a , b , d , e , f and h ) were performed in technical duplicates or triplicates over three independent experiments. All data are expressed as mean ± s.d. with individual data points shown. Data were analyzed by One-way ANOVA with Tukey’s multiple comparisons test. NS, not significant; * P < 0.05, ** P < 0.01, *** P < 0.001

Article Snippet: The morphology of α-Syn species was confirmed by negative stain transmission electron microscopy. α-Syn oligomers (StressMarq, cat# SPR-484) and PFFs (StressMarq, cat# SPR-322-C) were prepared at 25 µM in water.

Techniques: Flow Cytometry

Journal: International Journal of Molecular Sciences

Article Title: Downregulation of Protease Cathepsin D and Upregulation of Pathologic α-Synuclein Mediate Paucity of DNAJC6-Induced Degeneration of Dopaminergic Neurons

doi: 10.3390/ijms25126711

Figure Lengend Snippet: Paucity of DNAJC6 decreases LysoTracker staining intensity of lysosomes and immunofluorescence staining intensity of LAMP2-positive lysosomes in dopaminergic neurons. ( A ) Live cell imaging of lysosomes was conducted by treating differentiated SH-SY5Y dopaminergic neurons with 100 nM LysoTracker Yellow HCK-123, which stains acidic compartments and visualizes lysosomes, for 1 h. A three-day transfection of shRNA1 or shRNA2 targeting DNAJC6 significantly decreased the fluorescence intensity of LysoTracker Yellow staining in dopaminergic neurons. SC shRNA failed to affect lysosomal staining of LysoTracker Yellow HCK-123. Scale bar is 50 μm. ( B ) Immunofluorescence staining of lysosomal marker protein LAMP2 was performed to visualize lysosomes of dopaminergic neurons. Following a 3-day transfection of shRNAs targeting DNAJC6, the fluorescence intensity of LAMP2-positive puncta was significantly decreased in dopaminergic neurons. SC shRNA did not affect the immunofluorescence staining intensity of LAMP2. Scale bar is 60 μm. Each bar shows the mean ± S.E. value of 6 experiments. ** p < 0.01 compared with control dopaminergic neurons.

Article Snippet: The pRS shRNA vector containing shRNA targeting human α-synuclein (shRNA1: 5′TCAGAAGTTGTTAGTGATTTGCTATCATA3′; shRNA2: 5′GGTATCAAGACTACGAACCTGAAGCCTAA3′) was purchased from OriGene (Rockville, MD, USA).

Techniques: Staining, Immunofluorescence, Live Cell Imaging, Transfection, Fluorescence, shRNA, Marker, Control