|
Addgene inc
insect cell expression Insect Cell Expression, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/insect cell expression/product/Addgene inc Average 93 stars, based on 1 article reviews
insect cell expression - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
cd8α egfp ![]() Cd8α Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cd8α egfp/product/Addgene inc Average 92 stars, based on 1 article reviews
cd8α egfp - by Bioz Stars,
2026-05
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pentr4 snap f ![]() Pentr4 Snap F, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pentr4 snap f/product/Addgene inc Average 92 stars, based on 1 article reviews
pentr4 snap f - by Bioz Stars,
2026-05
92/100 stars
|
Buy from Supplier |
|
Addgene inc
catcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat sequence right ![]() Catcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat Sequence Right, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/catcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat sequence right/product/Addgene inc Average 93 stars, based on 1 article reviews
catcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat sequence right - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
glutamate transporter eaat1 ![]() Glutamate Transporter Eaat1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/glutamate transporter eaat1/product/Addgene inc Average 93 stars, based on 1 article reviews
glutamate transporter eaat1 - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
phis10 pssnapf79 ![]() Phis10 Pssnapf79, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phis10 pssnapf79/product/Addgene inc Average 91 stars, based on 1 article reviews
phis10 pssnapf79 - by Bioz Stars,
2026-05
91/100 stars
|
Buy from Supplier |
|
Addgene inc
snapf tag ![]() Snapf Tag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/snapf tag/product/Addgene inc Average 93 stars, based on 1 article reviews
snapf tag - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
hook3 snapf ![]() Hook3 Snapf, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hook3 snapf/product/Addgene inc Average 93 stars, based on 1 article reviews
hook3 snapf - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pfastbac m13 ![]() Pfastbac M13, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pfastbac m13/product/Addgene inc Average 93 stars, based on 1 article reviews
pfastbac m13 - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Molecular Biosciences Inc
lsfgfp::snapf (lp566) ![]() Lsfgfp/Snapf (Lp566), supplied by Molecular Biosciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lsfgfp::snapf (lp566)/product/Molecular Biosciences Inc Average 90 stars, based on 1 article reviews
lsfgfp::snapf (lp566) - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
snapf-tag dna sequence ![]() Snapf Tag Dna Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/snapf-tag dna sequence/product/GenScript corporation Average 90 stars, based on 1 article reviews
snapf-tag dna sequence - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
IDEXX
wild-type and double flag-halo-mctcf / mrad21-snapf-v5 knock-in mouse es cell line clone 59 ![]() Wild Type And Double Flag Halo Mctcf / Mrad21 Snapf V5 Knock In Mouse Es Cell Line Clone 59, supplied by IDEXX, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/wild-type and double flag-halo-mctcf / mrad21-snapf-v5 knock-in mouse es cell line clone 59/product/IDEXX Average 90 stars, based on 1 article reviews
wild-type and double flag-halo-mctcf / mrad21-snapf-v5 knock-in mouse es cell line clone 59 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Proceedings of the National Academy of Sciences of the United States of America
Article Title: Development of a highly sensitive platform for protein-protein interaction detection and regulation of T cell function.
doi: 10.1073/pnas.2318190121
Figure Lengend Snippet: Fig. 5. IFNARRS compared with ELISpot assay. (A) Indicated numbers of Jurkat-CD8/anti-ESO-TCR cells were stimulated with 100 ng/mL PMA and 300 ng/mL calcium ionophore (PMA/Ca), with 100 ng/mL anti-CD3ε antibody, or medium only (−) for 13 h in a 96-well plate for ELISpot assay to measure the secreted IFN-γ from the T cells. The positive spots are visualized. (B) The numbers of positive spots in each well were determined and shown in logarithmic scale (mean ± SD of three wells). (C) Simultaneously, the same numbers of Jurkat-CD8/anti-ESO-TCR cells were added to the GRkS-974 cells seeded in a 96-well plate in advance (2 × 104 cells/well). After the same treatments as in A, Nluc assay was performed, taking the count of medium only with 1 × 101 Jurkat cells as 1 in the logarithmic scale (mean ± SD of four independent experiments), and shown. Asterisks indicate a significant difference from the control (medium only) (*P < 0.01, **P < 0.0001).
Article Snippet: The expression vectors for HER2 (#16257),
Techniques: Enzyme-linked Immunospot, Control
Journal: Proceedings of the National Academy of Sciences of the United States of America
Article Title: Development of a highly sensitive platform for protein-protein interaction detection and regulation of T cell function.
doi: 10.1073/pnas.2318190121
Figure Lengend Snippet: Fig. 6. Interactions of GRkS-974 cells and Jurkat cells were enhanced by the anti-CD3ε antibody, B7-1, and antigen peptide stimulation. (A) GRkS-974 cells (1 × 105 cells/well) were transfected with a B7-1-expressing vector or empty vector. Jurkat T cells (1 × 105 cells/well) stably expressing CD8α and anti-NY-ESO-1 TCR were added to cells 24 h after transfection and stimulated with 100 ng/mL anti-CD3ε antibody for 12 h. Nluc assay was performed by taking the empty vector transfection without anti-CD3ε antibody stimulation as 1 (mean ± SD of three independent experiments). (B) As indicated, GRkS-974 cells were transfected with vectors expressing B7-1 or secretory anti-CD3ε scFv-Sc. Jurkat cells stably expressing CD8α and anti-NY-ESO-1 TCR were added to the cells 24 h after transfection. After 12 h of coculture, Nluc assay was performed by taking the empty vector transfection as 1 (mean ± SD of three independent experiments). (C) GRkS-974 cells were transfected with the B7-1-expressing or empty vector. The cells were further incubated for 12 h with the indicated concentrations of NY-ESO-1 peptide to load on the surface MHC class I 24 h after transfection. After that, Jurkat cells stably expressing CD8α and anti-NY-ESO-1 TCR were added to the cells. After 12 h of coculture, Nluc assay was performed, taking the vector transfection without NY-ESO-1 peptide as 1 (mean ± SD of three independent experiments). Asterisks indicate a significant difference from the vector transfection without stimulation or between the indicated pairs (*P < 0.01, **P < 0.001). TCR, T cell receptor; and scFv-Sc, secretory single-chain variable fragment.
Article Snippet: The expression vectors for HER2 (#16257),
Techniques: Transfection, Expressing, Plasmid Preparation, Stable Transfection, Incubation
Journal: Nature structural & molecular biology
Article Title: KIF1C activates and extends dynein movement through the FHF cargo adapter.
doi: 10.1038/s41594-024-01418-z
Figure Lengend Snippet: Fig. 1 | Dynein and KIF1C form coordinated cocomplexes scaffolded by HOOK3. a, Left: the schematics of proteins used in reconstitution of cocomplexes. Dynein and HOOK3 are labeled via N-terminal SNAP tags with TMR and Alexa-647, respectively. KIF1C is fused to a C-terminal eGFP. Right: representation of single-molecule motility assay used in this study. The microtubules are immobilized by sandwiching streptavidin between tubulin- biotin and PLL-PEG-biotin on the glass coverslip. The labeled motor proteins and adapters are then added and their motility imaged. b, Kymographs from TIRF images showing colocalized movement of dynein, HOOK3 and KIF1C.
Article Snippet: This was cut with AscI and NotI and then inserted into pFastBac-M13-8xHis-ZZ-LTLT-HOOK3-SNAPf, replacing HOOK3-SNAPf with HOOK3 followed by a stop codon and creating
Techniques: Labeling, Motility Assay
Journal: Nature structural & molecular biology
Article Title: KIF1C activates and extends dynein movement through the FHF cargo adapter.
doi: 10.1038/s41594-024-01418-z
Figure Lengend Snippet: Fig. 2 | Dynein and KIF1C are codependent in vitro. a, Schematics (top) and representative kymographs (bottom) from TIRF imaging of TMR-labeled DDH; DDHKFL; or dynein, dynactin, HOOK3 and GST–KIF1C stalk–GFP (DDHKS). All experiments were performed in the presence of Lis1. b, A superplot of the TMR– dynein landing rate on microtubules for different cocomplex combinations (as in a). The small dots indicate single microtubules and the large dots indicate experimental averages. n = 165 for DDH, n = 150 for DDHK and n = 171 for DDHKS, where n is number of microtubules over which the landing rate was measured. The boxes show quartiles with whiskers spanning 10–90% of the data, and the median is highlighted by the orange line. The exact P values shown above the graphs were calculated using the Kruskal–Wallis H test followed by a Conover’s post hoc test to evaluate pairwise interactions with a multiple comparison correction applied using Holm–Bonferroni. c, Schematics (top)
Article Snippet: This was cut with AscI and NotI and then inserted into pFastBac-M13-8xHis-ZZ-LTLT-HOOK3-SNAPf, replacing HOOK3-SNAPf with HOOK3 followed by a stop codon and creating
Techniques: In Vitro, Imaging, Labeling, Comparison
Journal: Nature structural & molecular biology
Article Title: KIF1C activates and extends dynein movement through the FHF cargo adapter.
doi: 10.1038/s41594-024-01418-z
Figure Lengend Snippet: Fig. 4 | FHF is an autoinhibited cargo adapter. a, Representative kymographs of TMR–dynein and dynactin in presence of either HOOK31–522 (left), full-length FHF (middle left), no other factor (DD, middle right) or full-length FHF + KIF1C stalk (right). All the samples also included Lis1. b,c, Quantification of processive events (b) and run lengths (c) from eight technical replicates (apart from DD condition, which had four technical replicates). The bars indicate the mean ± s.d., the small dots indicate data for each microtubule and the large dots indicate experimental averages. Statistics were performed on total microtubules, which is n = 120 microtubules for all conditions apart from the DD condition, where n = 60. A total of 15 microtubules were counted per replicate for all conditions. The exact P values shown above the graphs were calculated using the Kruskal– Wallis nonparametric test with Dunn’s multiple comparison. d, Full-length FHF composite model derived from stitched AF predictions and the cryo-EM structure of HOOK3 624–718, FTS and FHIP1B showing DSSO crosslinks (yellow dashes) between HOOK3 N-terminal residues (salmon orange) and HOOK3 C-terminal residues (red) identified using crosslinking mass spectrometry (XL-MS).
Article Snippet: This was cut with AscI and NotI and then inserted into pFastBac-M13-8xHis-ZZ-LTLT-HOOK3-SNAPf, replacing HOOK3-SNAPf with HOOK3 followed by a stop codon and creating
Techniques: Comparison, Derivative Assay, Cryo-EM Sample Prep, Mass Spectrometry, Structural Proteomics
Journal: Nature structural & molecular biology
Article Title: KIF1C activates and extends dynein movement through the FHF cargo adapter.
doi: 10.1038/s41594-024-01418-z
Figure Lengend Snippet: Fig. 5 | KIF1C stalk binds HOOK3 away from the FTS–FHIP1B site and relieves adapter autoinhibition. a, A stitched structural model of the AF-predicted KFL molecule. NL, neck linker; NC, neck coil; NCL, neck coil linker; FHA, forkhead- associated domain; P-Rich, proline-rich region. b, Domain architecture of KIF1C with the KIF1C stalk region highlighted below the main bar. c, The segmented cryo-EM density of FHF bound to a shorter KIF1C stalk (674–922, the dashed blue region), shown at a low-threshold contour level. d, AF model of HOOK3 residues 571–718 bound to KIF1C residues 722–840 (KS 722–840). Note that FTS, FHIP1B and HOOK3 (627–705) models from the cryo-EM structure are superposed on the HOOK3571–718–KS 722–840 prediction to give a composite structure. e, Expansion of AF model in d showing one copy of HOOK3 at the CC3–CC4 junction bound
Article Snippet: This was cut with AscI and NotI and then inserted into pFastBac-M13-8xHis-ZZ-LTLT-HOOK3-SNAPf, replacing HOOK3-SNAPf with HOOK3 followed by a stop codon and creating
Techniques: Cryo-EM Sample Prep