slc27a2 Search Results


3508 ad utrecht  (ATCC)
93
ATCC 3508 ad utrecht
3508 Ad Utrecht, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/slc27a2/HCT116-SLC27A2-KO-c10/us07625728-137-2-13
Average 93 stars, based on 1 article reviews
3508 ad utrecht - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
fatp2  (Bioss)
90
Bioss fatp2
Placental fatty acid transporter mRNA and protein abundance. Both mRNA levels and protein abundance of FATP1 (a) and (b) and FATP4 (e) and (f) were increased in female, but not male, MTS placenta compared to sex-matched control. Protein abundance, but not mRNA levels, of <t>FATP2</t> (d) and LIPG (j) was increased in female, but not male, MTS placenta compared to sex-matched control. MTS did not affect mRNA or protein of CD36 (g) and (h) in either female or male placenta. A significant interaction effect for sex and MTS was observed for Slc27a1 mRNA and protein. Results are represented as mean ± SD for n = 6 per group. *significant difference to sex-matched control group by ANOVA (p ≤ 0.05), ^ significant difference to female control group by ANOVA (p ≤ 0.05)
Fatp2, supplied by Bioss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/slc27a2/SLC27A2+ACSVL1+Polyclonal+Antibody/pmc07539808-122-19-21
Average 90 stars, based on 1 article reviews
fatp2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
ta350424  (OriGene)
94
OriGene ta350424
Placental fatty acid transporter mRNA and protein abundance. Both mRNA levels and protein abundance of FATP1 (a) and (b) and FATP4 (e) and (f) were increased in female, but not male, MTS placenta compared to sex-matched control. Protein abundance, but not mRNA levels, of <t>FATP2</t> (d) and LIPG (j) was increased in female, but not male, MTS placenta compared to sex-matched control. MTS did not affect mRNA or protein of CD36 (g) and (h) in either female or male placenta. A significant interaction effect for sex and MTS was observed for Slc27a1 mRNA and protein. Results are represented as mean ± SD for n = 6 per group. *significant difference to sex-matched control group by ANOVA (p ≤ 0.05), ^ significant difference to female control group by ANOVA (p ≤ 0.05)
Ta350424, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/slc27a2/FATP2+(SLC27A2)+Rabbit+Polyclonal+Antibody/us12540164-225-12-10
Average 94 stars, based on 1 article reviews
ta350424 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
rabbit polyclonal anti slc27a2  (Atlas Antibodies)
93
Atlas Antibodies rabbit polyclonal anti slc27a2
Placental fatty acid transporter mRNA and protein abundance. Both mRNA levels and protein abundance of FATP1 (a) and (b) and FATP4 (e) and (f) were increased in female, but not male, MTS placenta compared to sex-matched control. Protein abundance, but not mRNA levels, of <t>FATP2</t> (d) and LIPG (j) was increased in female, but not male, MTS placenta compared to sex-matched control. MTS did not affect mRNA or protein of CD36 (g) and (h) in either female or male placenta. A significant interaction effect for sex and MTS was observed for Slc27a1 mRNA and protein. Results are represented as mean ± SD for n = 6 per group. *significant difference to sex-matched control group by ANOVA (p ≤ 0.05), ^ significant difference to female control group by ANOVA (p ≤ 0.05)
Rabbit Polyclonal Anti Slc27a2, supplied by Atlas Antibodies, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/slc27a2/Anti-SLC27A2/pmc12249168-1-0-4
Average 93 stars, based on 1 article reviews
rabbit polyclonal anti slc27a2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
fatp2 for xmai ggtggtcccgggcctatgctgccagtgctctacac  (OriGene)
90
OriGene fatp2 for xmai ggtggtcccgggcctatgctgccagtgctctacac
Placental fatty acid transporter mRNA and protein abundance. Both mRNA levels and protein abundance of FATP1 (a) and (b) and FATP4 (e) and (f) were increased in female, but not male, MTS placenta compared to sex-matched control. Protein abundance, but not mRNA levels, of <t>FATP2</t> (d) and LIPG (j) was increased in female, but not male, MTS placenta compared to sex-matched control. MTS did not affect mRNA or protein of CD36 (g) and (h) in either female or male placenta. A significant interaction effect for sex and MTS was observed for Slc27a1 mRNA and protein. Results are represented as mean ± SD for n = 6 per group. *significant difference to sex-matched control group by ANOVA (p ≤ 0.05), ^ significant difference to female control group by ANOVA (p ≤ 0.05)
Fatp2 For Xmai Ggtggtcccgggcctatgctgccagtgctctacac, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/slc27a2/Slc27a2+(BC024735)+Mouse+Untagged+Clone/pmc06557120-287-16-9
Average 90 stars, based on 1 article reviews
fatp2 for xmai ggtggtcccgggcctatgctgccagtgctctacac - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
slc27a2  (Proteintech)
94
Proteintech slc27a2
Placental fatty acid transporter mRNA and protein abundance. Both mRNA levels and protein abundance of FATP1 (a) and (b) and FATP4 (e) and (f) were increased in female, but not male, MTS placenta compared to sex-matched control. Protein abundance, but not mRNA levels, of <t>FATP2</t> (d) and LIPG (j) was increased in female, but not male, MTS placenta compared to sex-matched control. MTS did not affect mRNA or protein of CD36 (g) and (h) in either female or male placenta. A significant interaction effect for sex and MTS was observed for Slc27a1 mRNA and protein. Results are represented as mean ± SD for n = 6 per group. *significant difference to sex-matched control group by ANOVA (p ≤ 0.05), ^ significant difference to female control group by ANOVA (p ≤ 0.05)
Slc27a2, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/slc27a2/FATP2+Antibody/pmc10449610-171-6-10
Average 94 stars, based on 1 article reviews
slc27a2 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
slc27a2  (Biorbyt)
93
Biorbyt slc27a2
Placental fatty acid transporter mRNA and protein abundance. Both mRNA levels and protein abundance of FATP1 (a) and (b) and FATP4 (e) and (f) were increased in female, but not male, MTS placenta compared to sex-matched control. Protein abundance, but not mRNA levels, of <t>FATP2</t> (d) and LIPG (j) was increased in female, but not male, MTS placenta compared to sex-matched control. MTS did not affect mRNA or protein of CD36 (g) and (h) in either female or male placenta. A significant interaction effect for sex and MTS was observed for Slc27a1 mRNA and protein. Results are represented as mean ± SD for n = 6 per group. *significant difference to sex-matched control group by ANOVA (p ≤ 0.05), ^ significant difference to female control group by ANOVA (p ≤ 0.05)
Slc27a2, supplied by Biorbyt, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/slc27a2/SLC27A2+antibody/pmc08906558-245-26-30
Average 93 stars, based on 1 article reviews
slc27a2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
nbp2  (Novus Biologicals)
91
Novus Biologicals nbp2
KEY RESOURCES TABLE
Nbp2, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/slc27a2/FATP2%2FSLC27A2+Antibody+(6B3A9)+-+BSA+Free/pmc10245960-42-8-4
Average 91 stars, based on 1 article reviews
nbp2 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier
ta333990  (OriGene)
94
OriGene ta333990
KEY RESOURCES TABLE
Ta333990, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/slc27a2/FATP2+(SLC27A2)+Rabbit+Polyclonal+Antibody/us12540164-225-14-10
Average 94 stars, based on 1 article reviews
ta333990 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
gene exp slc27a2 rn00581971 m1  (Thermo Fisher)
87
Thermo Fisher gene exp slc27a2 rn00581971 m1
(a) A significant UPI.sex interaction was observed for <t>Slc27a2</t> mRNA levels (P = .0013; two-way ANOVA) whereby UPI increased Slc27a2 mRNA levels in male placenta. (b) H4K20me was not different between groups at the Slc27a2 promoter. (c) UPI increased H4K20me at Slc27a2 exon 3. Results are shown for individual data points and lines are mean and standard deviation. *significant difference to sex-matched control group (p < 0.05).
Gene Exp Slc27a2 Rn00581971 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/slc27a2/Gene+Exp%2E+Slc27a2%2C+Rn00581971_m1/pmc08215892-95-25-35
Average 87 stars, based on 1 article reviews
gene exp slc27a2 rn00581971 m1 - by Bioz Stars, 2026-09
87/100 stars
  Buy from Supplier
gene exp slc27a2 mm00449517 m1  (Thermo Fisher)
85
Thermo Fisher gene exp slc27a2 mm00449517 m1
(a) A significant UPI.sex interaction was observed for <t>Slc27a2</t> mRNA levels (P = .0013; two-way ANOVA) whereby UPI increased Slc27a2 mRNA levels in male placenta. (b) H4K20me was not different between groups at the Slc27a2 promoter. (c) UPI increased H4K20me at Slc27a2 exon 3. Results are shown for individual data points and lines are mean and standard deviation. *significant difference to sex-matched control group (p < 0.05).
Gene Exp Slc27a2 Mm00449517 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/slc27a2/Gene+Exp%2E+Slc27a2%2C+Mm00449517_m1/pm38549376-379-43-5
Average 85 stars, based on 1 article reviews
gene exp slc27a2 mm00449517 m1 - by Bioz Stars, 2026-09
85/100 stars
  Buy from Supplier
snp slc27a2 c 15950871 20  (Thermo Fisher)
86
Thermo Fisher snp slc27a2 c 15950871 20
(a) A significant UPI.sex interaction was observed for <t>Slc27a2</t> mRNA levels (P = .0013; two-way ANOVA) whereby UPI increased Slc27a2 mRNA levels in male placenta. (b) H4K20me was not different between groups at the Slc27a2 promoter. (c) UPI increased H4K20me at Slc27a2 exon 3. Results are shown for individual data points and lines are mean and standard deviation. *significant difference to sex-matched control group (p < 0.05).
Snp Slc27a2 C 15950871 20, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/slc27a2/SNP+SLC27A2%2C+C__15950871_20/pmc05040715-61-11--1
Average 86 stars, based on 1 article reviews
snp slc27a2 c 15950871 20 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results


Placental fatty acid transporter mRNA and protein abundance. Both mRNA levels and protein abundance of FATP1 (a) and (b) and FATP4 (e) and (f) were increased in female, but not male, MTS placenta compared to sex-matched control. Protein abundance, but not mRNA levels, of FATP2 (d) and LIPG (j) was increased in female, but not male, MTS placenta compared to sex-matched control. MTS did not affect mRNA or protein of CD36 (g) and (h) in either female or male placenta. A significant interaction effect for sex and MTS was observed for Slc27a1 mRNA and protein. Results are represented as mean ± SD for n = 6 per group. *significant difference to sex-matched control group by ANOVA (p ≤ 0.05), ^ significant difference to female control group by ANOVA (p ≤ 0.05)

Journal: Reproductive Sciences

Article Title: Maternal Tobacco Smoke Exposure Causes Sex-Divergent Changes in Placental Lipid Metabolism in the Rat

doi: 10.1007/s43032-019-00065-w

Figure Lengend Snippet: Placental fatty acid transporter mRNA and protein abundance. Both mRNA levels and protein abundance of FATP1 (a) and (b) and FATP4 (e) and (f) were increased in female, but not male, MTS placenta compared to sex-matched control. Protein abundance, but not mRNA levels, of FATP2 (d) and LIPG (j) was increased in female, but not male, MTS placenta compared to sex-matched control. MTS did not affect mRNA or protein of CD36 (g) and (h) in either female or male placenta. A significant interaction effect for sex and MTS was observed for Slc27a1 mRNA and protein. Results are represented as mean ± SD for n = 6 per group. *significant difference to sex-matched control group by ANOVA (p ≤ 0.05), ^ significant difference to female control group by ANOVA (p ≤ 0.05)

Article Snippet: The following primary antibodies were used: PPARγ (sc-7196, Santa Cruz Biotechnology, Santa Cruz, CA); FATP1 (bs-4903R, Bioss, Woburn, MA); FATP2 (bs-3936R, Bioss); FATP4 (bs-11535R, Bioss); CD36 (bs-8873R, Bioss); and LIPG (bs-6762R, Bioss).

Techniques:

KEY RESOURCES TABLE

Journal: bioRxiv

Article Title: Modeling kidney development, disease, and plasticity with clonal expandable nephron progenitor cells and nephron organoids

doi: 10.1101/2023.05.25.542343

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Mouse Monoclonal anti-SLC27A2 , Novus Biologicals , Cat# NBP2-37738.

Techniques: Plasmid Preparation, Recombinant, Reverse Transcription, CyQUANT Assay, Proliferation Assay, Mouse Assay, Genome Wide, CRISPR, Knock-Out, Software, Imaging, Light Microscopy

(a) A significant UPI.sex interaction was observed for Slc27a2 mRNA levels (P = .0013; two-way ANOVA) whereby UPI increased Slc27a2 mRNA levels in male placenta. (b) H4K20me was not different between groups at the Slc27a2 promoter. (c) UPI increased H4K20me at Slc27a2 exon 3. Results are shown for individual data points and lines are mean and standard deviation. *significant difference to sex-matched control group (p < 0.05).

Journal: Reproductive sciences (Thousand Oaks, Calif.)

Article Title: Uteroplacental Insufficiency with Hypoxia Upregulates Placental PPARγ-KMT5A Axis in the Rat

doi: 10.1007/s43032-020-00434-w

Figure Lengend Snippet: (a) A significant UPI.sex interaction was observed for Slc27a2 mRNA levels (P = .0013; two-way ANOVA) whereby UPI increased Slc27a2 mRNA levels in male placenta. (b) H4K20me was not different between groups at the Slc27a2 promoter. (c) UPI increased H4K20me at Slc27a2 exon 3. Results are shown for individual data points and lines are mean and standard deviation. *significant difference to sex-matched control group (p < 0.05).

Article Snippet: Real-time RT PCR was performed as previously described [ 32 – 34 ], with the following Assay-on-demand primer/probe sets: rat Pparγ -Rn01492274_m1, Kmt5a- Rn01477383_g1, Slc27a2 -Rn00581971_m1, and human KMT5A - Hs00360662_s1, human TBP - Hs00427620_m1 (Applied Biosystems, Thermo Fisher Scientific, Foster City, CA).

Techniques: Standard Deviation, Control