|
Merck & Co
sirnas ![]() Sirnas, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirnas/sirnas/pmc12405003-374-5-10 Average 86 stars, based on 1 article reviews
sirnas - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
n a sirnas targeting p62 mrna hou ![]() N A Sirnas Targeting P62 Mrna Hou, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirnas/bak1+bak1+mrna+si+sirnas+targeting/pm39280623-151-69-82 Average 86 stars, based on 1 article reviews
n a sirnas targeting p62 mrna hou - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Bioneer Corporation
nox4 sirna ![]() Nox4 Sirna, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirnas/nox4+nox4+sirna+sirnas+specific+specific/pm25915537-152-18-21 Average 86 stars, based on 1 article reviews
nox4 sirna - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Bioneer Corporation
small interfering rnas sirnas ![]() Small Interfering Rnas Sirnas, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirnas/sirnas/pmc12733032-180-0-8 Average 86 stars, based on 1 article reviews
small interfering rnas sirnas - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Bioneer Corporation
sirnas targeting wisp 1 ![]() Sirnas Targeting Wisp 1, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirnas/independent+lgals3bp+sirnas+targeting/pmc12781172-95-8-11 Average 86 stars, based on 1 article reviews
sirnas targeting wisp 1 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Xeragon Inc
sirnas targeting hca66 mrna ![]() Sirnas Targeting Hca66 Mrna, supplied by Xeragon Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirnas/sirnas+targeting+hca66+mrna/pmc02714438-283-1-7 Average 90 stars, based on 1 article reviews
sirnas targeting hca66 mrna - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
sirnas against nono ![]() Sirnas Against Nono, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirnas/sirnas+against+nono/pm40059196-63-5-14 Average 90 stars, based on 1 article reviews
sirnas against nono - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Genchem Inc
sirnas 668 ![]() Sirnas 668, supplied by Genchem Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirnas/sirnas+668/pmc03069058-169-1-14 Average 90 stars, based on 1 article reviews
sirnas 668 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
sirnas for lama3 ![]() Sirnas For Lama3, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirnas/sirnas+for+lama3/pm40004224-198-21-29 Average 90 stars, based on 1 article reviews
sirnas for lama3 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Xeragon Inc
fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg) ![]() Fluorescence Labelled Control, Scrambled And Human P140cap Specific Sirnas (Aagctgtgtctgttgaggctg), supplied by Xeragon Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirnas/fluorescence+labelled+control++scrambled+and+human+p140cap+specific+sirnas++aagctgtgtctgttgaggctg+/pmc01894765-362-7-9 Average 90 stars, based on 1 article reviews
fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Ribobio co
three specific sirnas which were designed targeting the back-splice junction site of circash2l ![]() Three Specific Sirnas Which Were Designed Targeting The Back Splice Junction Site Of Circash2l, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirnas/three+specific+sirnas+which+were+designed+targeting+the+back+splice+junction+site+of+circash2l/ppr0924257-62-16-20 Average 90 stars, based on 1 article reviews
three specific sirnas which were designed targeting the back-splice junction site of circash2l - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
smart double-stranded sirnas clm-1 non-specific sirnas ![]() Smart Double Stranded Sirnas Clm 1 Non Specific Sirnas, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirnas/smart+double+stranded+sirnas+clm+1+non+specific+sirnas/pmc11468308-56-7-11 Average 90 stars, based on 1 article reviews
smart double-stranded sirnas clm-1 non-specific sirnas - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Life Science Alliance
Article Title: Amino acid–dependent TSC2 dephosphorylation by lysosome–PP2A regulates mTORC1 signaling transduction
doi: 10.26508/lsa.202503206
Figure Lengend Snippet: (A) p18Rev and TSC2-KO MEFs (#1 and #2) were exposed to AA deprivation and subsequent AA and Ins treatment. Cell lysates were analyzed for TSC2 and AKT phosphorylation using anti-phospho-TSC2 (P-T1462 and P-S939) and anti-phospho-AKT (P-T308 and P-S473) antibodies, respectively. The expression levels of TSC2 and AKT in the cell lysates are also shown. (B) MEFs and HEK293 cells were transfected with either a control siRNA or siRNAs specific for TSC2, then subjected to AA starvation, followed by treatment with AA and Ins for 20 min. Cell lysates were analyzed by immunoblotting. (C) Immunofluorescence analysis of p18Rev and TSC2-KO (#1 and #2) MEFs and si-Control– or si-TSC2–treated MEFs cultured in growth medium supplemented with AAs. TSC2, green; LAMP1, red. Nuclei were stained with DAPI (blue). Scale bars, 10 μm. Fluorescence signals of TSC2 were abolished in TSC2-KO cells (#1 and #2). (D) Immunofluorescence analysis of si-Control– or si-TSC2–transfected HEK293 cells cultured in growth medium supplemented with AAs. TSC2, green; DAPI, blue. Scale bars, 10 μm. (E, F) Phosphorylation levels of AKT at T308 and S473, TSC2 at T1462, and S6K at T389 monitored in p18Rev cells treated with a combination of Ins and AA for the indicated times (10 min to 24 h) (E) and 3–60 min (F). p18Rev cells were treated with AA and Ins as shown in . Cell lysates were analyzed by Western blotting using the indicated antibodies. Source data are available for this figure.
Article Snippet: HEK293 cells were transfected with
Techniques: Phospho-proteomics, Expressing, Transfection, Control, Western Blot, Immunofluorescence, Cell Culture, Staining, Fluorescence
Journal: Life Science Alliance
Article Title: Amino acid–dependent TSC2 dephosphorylation by lysosome–PP2A regulates mTORC1 signaling transduction
doi: 10.26508/lsa.202503206
Figure Lengend Snippet: (A) Schematic representation of the reactions involved in the mTORC1 pathway with crosstalk. Reactions depicting the AA-sensitive phosphatase (PPase) that dephosphorylates TSC2 at the T1462 residue (from pTSC to TSC) were defined and added to the mTORC1 mathematical model without crosstalk. l13 is defined as a rate constant for feedback strengths. (B) Simulation of phospho-AKT at T308 and S473 and phospho-TSC2 at T1462 in the mTORC1 model with crosstalk. The dots indicate the experimental values. (C) The correlations between the simulation and actual values of P-AKT(T308) (upper) and P-TSC2 (T1462) (lower) were evaluated by the correlation indexes (CI) based on the residual sum of squares (RSS). (C) shows fits for different values of the parameter l13 (feedback strength). A smaller CI (RSS) indicates a higher fitting rate of the model to the actual data. (D) Phosphorylation levels of TSC2 at T1462, AKT at T308 and S473, S6K at T389, S6 at S235 and S236, and GSK3β at S9 monitored in p18Rev cells subjected to AA starvation followed by Ins (left) or Ins plus AA treatment (right) for 20 min, or together with okadaic acids (OA), AKT inhibitor VIII, rapamycin, Torin1, or LY2584702 (an S6K inhibitor). Note that the anti-P-S6 antibodies added during the first immunoblotting cover the antigen S6 protein, and therefore, the newly added anti-S6 antibodies are repelled when the same membrane is reblotted. (E) Phosphorylation levels of TSC2 at T1462, AKT at T308 and S473, S6K at T389, S6 at S235 and S236, and GSK3β at S9 monitored in p18Rev cells subjected to AA starvation followed by treatment with AA, Ins, or Ins plus AA for 15 min, or together with OA. (F) PP2A-Aα/β or PP2A-Cα knockdown enhanced Ins-induced TSC2 (T1462) phosphorylation. HEK293 cells were transfected with a control siRNA or siRNAs specific for PP2A-Aα, PP2A-Aβ, and PP2A-Cα, and subjected to AA starvation, followed by Ins treatment alone for 20 min. Cell lysates were analyzed via immunoblotting. (G) Representative immunofluorescence data for TSC2 in p18Rev cells subjected to AA starvation and subsequently treated, as indicated, with AA, Ins, and OA for 15 min. The area in the small squares is enlarged. TSC2, green; LAMP1, red; DAPI, blue. Scale bars, 10 μm. Line scans of TSC2 (green) and LAMP1 (red) are shown at the bottom of the figure. (G, H) TSC2-LAMP1 colocalization in (G) was measured based on Pearson’s correlation coefficient. The mean values of Pearson’s correlation coefficient from five cells and the SEM are shown. P -values were assessed using one-way ANOVA with Tukey’s multiple comparison test. NS, not significant. Source data are available for this figure.
Article Snippet: HEK293 cells were transfected with
Techniques: Residue, Phospho-proteomics, Western Blot, Membrane, Knockdown, Transfection, Control, Immunofluorescence, Comparison
Journal: Life Science Alliance
Article Title: Amino acid–dependent TSC2 dephosphorylation by lysosome–PP2A regulates mTORC1 signaling transduction
doi: 10.26508/lsa.202503206
Figure Lengend Snippet: (A) Phosphorylation levels of TSC2 at T1462, AKT at T308 and S473, and S6K at T389 were monitored in HEK293 cells subjected to AA starvation and subsequent Ins treatment, alone or in combination with AA or okadaic acids (OA). Cell lysates were analyzed by Western blotting using the indicated antibodies. (B) Interaction of biotinylated TSC2 with each of the Flag-tagged PP2A-A, PP2A-B, and PP2A-C subunits, or TSC2-Flag, GFP-Flag, was analyzed using AlphaScreen (independent experiments, n = 3). Statistical significance was determined using one-way ANOVA with Tukey’s multiple comparison test. Error bars represent the SEM. NS, not significant. (C, D, E) Flag-TSC2 (1740 aa) (C, D) and LAMP1-Flag-TSC2 (1740 aa) (E) were immunoprecipitated from HEK293 cells, and co-precipitated Myc-TSC2 (1740 aa) (C), and endogenous PP2A-Cα and PP2A-Aα/β (D, E) were probed with appropriate antibodies. (D, E) Cell lysates were also probed for phosphorylated TSC2 at T1462 (D, E). (F) Immunofluorescence analysis of TSC2 in HEK293 cells that were AA-starved for 1 h, and subsequently treated with AA and Ins, as indicated, for 15 min. The areas in the small squares are enlarged, as shown in the lower panel. TSC2 (green) and LAMP1 (red) were stained with each of the specific antibodies. Line scans of TSC2 (green) together with those of LAMP1 (red) are shown at the bottom. Scale bars, 10 μm. (G) HEK293 cells were transfected with a control siRNA or siRNAs specific for AKT1 and AKT2. Cell lysates were probed with the indicated antibodies. β-Actin was used as a loading control. (H) Immunofluorescence analysis of si-Control– or si-AKT1/2–treated HEK293 cells cultured in growth medium supplemented with AAs. AKT, green; DAPI, blue. Scale bars, 10 μm. Fluorescence signals of AKT were abolished in AKT1/2-depleted cells. (I, J) Immunofluorescence analysis of AKT (I) and mTOR (J) in HEK293 cells that were AA-starved for 1 h and subsequently treated with AA and Ins, as indicated, for 15 min. The areas in the small squares are enlarged, as shown in the lower panel. AKT (I) and mTOR (J) (green) were stained with each of the specific antibodies. LAMP1, red. Line scans of AKT (I) and mTOR (J) (green) together with those of LAMP1 (red) are shown at the bottom. Scale bars, 10 μm. Colocalization of AKT (I) or mTOR (J) with LAMP1 was measured (right panel of (I, J)). The mean values of Pearson’s correlation coefficient from six cells and the SEM are shown. P -values were assessed using one-way ANOVA with Tukey’s multiple comparison test. NS, not significant. Source data are available for this figure.
Article Snippet: HEK293 cells were transfected with
Techniques: Phospho-proteomics, Western Blot, Amplified Luminescent Proximity Homogenous Assay, Comparison, Immunoprecipitation, Immunofluorescence, Staining, Transfection, Control, Cell Culture, Fluorescence
Journal: Life Science Alliance
Article Title: Amino acid–dependent TSC2 dephosphorylation by lysosome–PP2A regulates mTORC1 signaling transduction
doi: 10.26508/lsa.202503206
Figure Lengend Snippet: (A, B) Immunofluorescence analysis of HEK293 cells transfected with control siRNA or siRNAs specific for PP2A-Aα/β (A) or PP2A-Cα (B). PP2A-Aα/β (A) and PP2A-Cα (B) (green) were stained with each specific antibody. LAMP1, red; DAPI, blue. Scale bars, 10 μm. Line scans of PP2A-Aα/β (A) and PP2A-Cα (B) (green) together with those of LAMP1 (red) are shown at the bottom. (C, D) Representative immunofluorescence images of p18Rev (C) and p18-KO (D) cells treated with AA and Ins, alone or in combination for 15 min. The areas in the small squares are enlarged and shown in the lower panels. TSC2, green; LAMP1, red; and PP2A-Cα, blue. Scale bars, 10 μm. Line scans of TSC2 (green), LAMP1 (red), and PP2A-Cα (blue) are shown at the bottom of the figure. (C, D, E, F) TSC2-LAMP1 (E) and PP2A-Cα-LAMP1 (F) colocalizations in (C, D) were measured based on Pearson’s correlation coefficient. The mean values of Pearson’s correlation coefficient from six cells and the SEM are shown. P -values were assessed using one-way ANOVA with Tukey’s multiple comparison test. NS, not significant. Source data are available for this figure.
Article Snippet: HEK293 cells were transfected with
Techniques: Immunofluorescence, Transfection, Control, Staining, Comparison
Journal: International Journal of Molecular Sciences
Article Title: Cucurbitacin D Induces Apoptotic Cell Death via NOX4 and Overcomes Radioresistance in Colorectal Cancer
doi: 10.3390/ijms262412022
Figure Lengend Snippet: Silencing PERK expression reduces CBD-mediated apoptosis in colorectal cancer cells. ( A – E ) Following transfection with PERK siRNAs, HCT116 and HT29 cells were treated with CBD (0.5 µM) for 24 h. We assessed caspase-3 activity, intracellular Ca 2+ levels, and performed both WST-1 and LDH assays to evaluate cell death and viability; *, p < 0.05, N.S = no significance. Protein expression levels of cleaved caspase-3, CHOP, and PERK, and phosphorylation levels of PERK were determined by Western blot analysis in HCT116 and HT29 cells after 24 h of 0.5 µM CBD treatment. The protein levels were normalized using β-actin. ( F – J ) Following transfection with CHOP siRNAs, HCT116 and HT29 cells were treated with CBD (0.5 µM) for 24 h. We assessed caspase-3 activity, intracellular Ca 2+ levels, and performed both WST-1 and LDH assays to evaluate cell death and viability; *, p < 0.05, N.S = no significance. Protein expression levels of cleaved caspase-3 and CHOP were determined by Western blot analysis in HCT116 and HT29 cells after 24 h of 0.5 µM CBD treatment. The protein levels were normalized using β-actin.
Article Snippet:
Techniques: Expressing, Transfection, Activity Assay, Phospho-proteomics, Western Blot
Journal: International Journal of Molecular Sciences
Article Title: Cucurbitacin D Induces Apoptotic Cell Death via NOX4 and Overcomes Radioresistance in Colorectal Cancer
doi: 10.3390/ijms262412022
Figure Lengend Snippet: Silencing of NOX4 prevents ROS-induced ER stress and apoptosis in CBD-treated colorectal cancer cells. ( A ) Intracellular ROS generation was measured using the DCFDA dye in HCT116 and HT29 cells after treatment with 0.5 μΜ CBD for the indicated durations; *, p < 0.05. ( B – E ) Following treatment with 0.5 μΜ CBD, 1 μM DPI, and 100 μM NAC for 24 h, HCT116 and HT29 cells were subjected to various assays, including those for intracellular ROS release, caspase-3 activity, WST-1, and LDH cytotoxicity; *, p < 0.05, N.S = no significance. ( F – I ) Following transfection of NOX4 siRNAs into HCT116 and HT29 cell lines, cells were treated with CBD (0.5 µM) for 24 h. A variety of assays were performed, including those for intracellular ROS release, LDH cytotoxicity, and WST-1; *, p < 0.05. Protein expression levels of PERK, p-PERK, NOX4, CHOP, and cleaved caspase-3 were identified by Western blot analysis in HCT116 and HT29 cells after 24 h of 0.5 µM CBD treatment. The protein levels were normalized using β-actin.
Article Snippet:
Techniques: Activity Assay, Transfection, Expressing, Western Blot