single-guide rnas Search Results


90
Applied StemCell Inc single guide rnas 5g and 3g
Single Guide Rnas 5g And 3g, supplied by Applied StemCell Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single-guide+rnas/pmc09792899-283-0-26?v=Applied+StemCell+Inc
Average 90 stars, based on 1 article reviews
single guide rnas 5g and 3g - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Spectron Corporation single-guide rnas (sgrnas)
Single Guide Rnas (Sgrnas), supplied by Spectron Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single-guide+rnas/pmc11912690-57-1-33?v=Spectron+Corporation
Average 90 stars, based on 1 article reviews
single-guide rnas (sgrnas) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GenScript corporation single-guide rnas targeting sting1 (sg sting1 -1: gtacccaatgtagtatgacc)
Single Guide Rnas Targeting Sting1 (Sg Sting1 1: Gtacccaatgtagtatgacc), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single-guide+rnas/pmc12046326-225-0-11?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
single-guide rnas targeting sting1 (sg sting1 -1: gtacccaatgtagtatgacc) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GenScript corporation genome-wide lentiviral human crispr knockout guide library with 58 028 single-guide rnas (sgrnas)
Genome Wide Lentiviral Human Crispr Knockout Guide Library With 58 028 Single Guide Rnas (Sgrnas), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single-guide+rnas/pm35903686-58-18-32?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
genome-wide lentiviral human crispr knockout guide library with 58 028 single-guide rnas (sgrnas) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
InterPro Inc single guide rnas targeting the beginning of the largest exon 8
Single Guide Rnas Targeting The Beginning Of The Largest Exon 8, supplied by InterPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single-guide+rnas/pmc07092968-55-14-25?v=InterPro+Inc
Average 90 stars, based on 1 article reviews
single guide rnas targeting the beginning of the largest exon 8 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
ToolGen Incorporated y105c5a.1272 targeting single-guide rnas (sgrnas)
Y105c5a.1272 Targeting Single Guide Rnas (Sgrnas), supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single-guide+rnas/pmc05561207-148-9-22?v=ToolGen+Incorporated
Average 90 stars, based on 1 article reviews
y105c5a.1272 targeting single-guide rnas (sgrnas) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

86
Benchling Inc vero cells single guide rna sgrna sequences targeting dhhc11
Vero Cells Single Guide Rna Sgrna Sequences Targeting Dhhc11, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single-guide+rnas/pm41223056-376-4-21?v=Benchling+Inc
Average 86 stars, based on 1 article reviews
vero cells single guide rna sgrna sequences targeting dhhc11 - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Synthego Inc single guide rnas sgrnas
Single Guide Rnas Sgrnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single-guide+rnas/pm42129160-1135-0-10?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
single guide rnas sgrnas - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Shanghai Genechem Ltd single guide rnas sgrnas
A The TIE1-Cre C57 mice (six-seven weeks old) were intravitreously injected with AAV5-FLEX-GFP viral particles (7 × 10 10 viral particles/0.5 µL/mouse), followed by frozen sections and flat mount staining 21 days later to observe GFP-positive infection area. Scale bar = 100 μm / 50 μm. B – H The TIE1-Cre C57 mice (six-seven weeks old) were intravitreously injected with AAV5-FLEX-sgRAB5IF (RAB5IF-eCKO#1 and RAB5IF-eCKO#2, encoding non-overlapping <t>sgRNAs</t> against murine RAB5IF ) or <t>AAV5-FLEX-sgRNA</t> control viral particles (“sgC), both at 7 × 10 10 viral particles/0.5 µL/mouse; After 21 days RAB5IF protein expression in the primary mRMECs extracted from adult mice was shown (pooled from 4 mice/sample, n = 5 samples/group, 15 μg protein/lane for WB) ( B ); IB4 staining of retinal flat mounts, showing representative images, and quantification of vascular branch numbers. Scale bar = 100 μm ( C ). PAS staining of retinal tissue, showing representative images, and quantification of acellular capillary numbers. Scale bar = 60 μm ( D ). Evans blue (EB) leakage assay assessing retinal vascular leakage, showing representative images, and quantification of EB leakage. Scale bar = 1 mm ( E ). Tubb3/NeuN double staining of retinal flat mounts to label RGCs, showing representative images, and quantification of Tubb3 + /NeuN + cell numbers. Scale bar = 60 μm ( F ). RBPMS staining of retinal sections to label RGCs, showing representative images, and quantification of RBPMS + cell numbers. GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer. Scale bar = 200 μm ( G ). Expression of listed neuronal marker proteins in the retinal tissues was also tested (individual samples, n = 5 mice/group, 15 μg protein/lane) ( H ). I At P1, endothelial-targeted AAV (1 × 10 11 viral particles/7.5 µL/mouse) was injected retro-orbitally for RAB5IF knockdown (RAB5IF-eKD). Subsequently, listed neuronal markers were detected by Western blot at P6. (pooled from 8 mice/sample, n = 8 samples/group, 15 μg protein/lane for WB). Data are presented as means ± S.D; One-way ANOVA with Bonferroni’s post hoc test. n = 5 mice per group. Source data are provided as a Source Data file.
Single Guide Rnas Sgrnas, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single-guide+rnas/pmc12738560-453-10-16?v=Shanghai+Genechem+Ltd
Average 86 stars, based on 1 article reviews
single guide rnas sgrnas - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

90
Beijing SyngenTech Co single-guide rnas (sgrnas) targeting enhancer regions around the foxf2 genomic locus
A The TIE1-Cre C57 mice (six-seven weeks old) were intravitreously injected with AAV5-FLEX-GFP viral particles (7 × 10 10 viral particles/0.5 µL/mouse), followed by frozen sections and flat mount staining 21 days later to observe GFP-positive infection area. Scale bar = 100 μm / 50 μm. B – H The TIE1-Cre C57 mice (six-seven weeks old) were intravitreously injected with AAV5-FLEX-sgRAB5IF (RAB5IF-eCKO#1 and RAB5IF-eCKO#2, encoding non-overlapping <t>sgRNAs</t> against murine RAB5IF ) or <t>AAV5-FLEX-sgRNA</t> control viral particles (“sgC), both at 7 × 10 10 viral particles/0.5 µL/mouse; After 21 days RAB5IF protein expression in the primary mRMECs extracted from adult mice was shown (pooled from 4 mice/sample, n = 5 samples/group, 15 μg protein/lane for WB) ( B ); IB4 staining of retinal flat mounts, showing representative images, and quantification of vascular branch numbers. Scale bar = 100 μm ( C ). PAS staining of retinal tissue, showing representative images, and quantification of acellular capillary numbers. Scale bar = 60 μm ( D ). Evans blue (EB) leakage assay assessing retinal vascular leakage, showing representative images, and quantification of EB leakage. Scale bar = 1 mm ( E ). Tubb3/NeuN double staining of retinal flat mounts to label RGCs, showing representative images, and quantification of Tubb3 + /NeuN + cell numbers. Scale bar = 60 μm ( F ). RBPMS staining of retinal sections to label RGCs, showing representative images, and quantification of RBPMS + cell numbers. GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer. Scale bar = 200 μm ( G ). Expression of listed neuronal marker proteins in the retinal tissues was also tested (individual samples, n = 5 mice/group, 15 μg protein/lane) ( H ). I At P1, endothelial-targeted AAV (1 × 10 11 viral particles/7.5 µL/mouse) was injected retro-orbitally for RAB5IF knockdown (RAB5IF-eKD). Subsequently, listed neuronal markers were detected by Western blot at P6. (pooled from 8 mice/sample, n = 8 samples/group, 15 μg protein/lane for WB). Data are presented as means ± S.D; One-way ANOVA with Bonferroni’s post hoc test. n = 5 mice per group. Source data are provided as a Source Data file.
Single Guide Rnas (Sgrnas) Targeting Enhancer Regions Around The Foxf2 Genomic Locus, supplied by Beijing SyngenTech Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single-guide+rnas/pm39828125-121-8-27?v=Beijing+SyngenTech+Co
Average 90 stars, based on 1 article reviews
single-guide rnas (sgrnas) targeting enhancer regions around the foxf2 genomic locus - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Genomatix gmbh single-guide rnas
A The TIE1-Cre C57 mice (six-seven weeks old) were intravitreously injected with AAV5-FLEX-GFP viral particles (7 × 10 10 viral particles/0.5 µL/mouse), followed by frozen sections and flat mount staining 21 days later to observe GFP-positive infection area. Scale bar = 100 μm / 50 μm. B – H The TIE1-Cre C57 mice (six-seven weeks old) were intravitreously injected with AAV5-FLEX-sgRAB5IF (RAB5IF-eCKO#1 and RAB5IF-eCKO#2, encoding non-overlapping <t>sgRNAs</t> against murine RAB5IF ) or <t>AAV5-FLEX-sgRNA</t> control viral particles (“sgC), both at 7 × 10 10 viral particles/0.5 µL/mouse; After 21 days RAB5IF protein expression in the primary mRMECs extracted from adult mice was shown (pooled from 4 mice/sample, n = 5 samples/group, 15 μg protein/lane for WB) ( B ); IB4 staining of retinal flat mounts, showing representative images, and quantification of vascular branch numbers. Scale bar = 100 μm ( C ). PAS staining of retinal tissue, showing representative images, and quantification of acellular capillary numbers. Scale bar = 60 μm ( D ). Evans blue (EB) leakage assay assessing retinal vascular leakage, showing representative images, and quantification of EB leakage. Scale bar = 1 mm ( E ). Tubb3/NeuN double staining of retinal flat mounts to label RGCs, showing representative images, and quantification of Tubb3 + /NeuN + cell numbers. Scale bar = 60 μm ( F ). RBPMS staining of retinal sections to label RGCs, showing representative images, and quantification of RBPMS + cell numbers. GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer. Scale bar = 200 μm ( G ). Expression of listed neuronal marker proteins in the retinal tissues was also tested (individual samples, n = 5 mice/group, 15 μg protein/lane) ( H ). I At P1, endothelial-targeted AAV (1 × 10 11 viral particles/7.5 µL/mouse) was injected retro-orbitally for RAB5IF knockdown (RAB5IF-eKD). Subsequently, listed neuronal markers were detected by Western blot at P6. (pooled from 8 mice/sample, n = 8 samples/group, 15 μg protein/lane for WB). Data are presented as means ± S.D; One-way ANOVA with Bonferroni’s post hoc test. n = 5 mice per group. Source data are provided as a Source Data file.
Single Guide Rnas, supplied by Genomatix gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single-guide+rnas/pm31025379-69-11-44?v=Genomatix+gmbh
Average 90 stars, based on 1 article reviews
single-guide rnas - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
ToolGen Incorporated single-guide (sg)rnas
A The TIE1-Cre C57 mice (six-seven weeks old) were intravitreously injected with AAV5-FLEX-GFP viral particles (7 × 10 10 viral particles/0.5 µL/mouse), followed by frozen sections and flat mount staining 21 days later to observe GFP-positive infection area. Scale bar = 100 μm / 50 μm. B – H The TIE1-Cre C57 mice (six-seven weeks old) were intravitreously injected with AAV5-FLEX-sgRAB5IF (RAB5IF-eCKO#1 and RAB5IF-eCKO#2, encoding non-overlapping <t>sgRNAs</t> against murine RAB5IF ) or <t>AAV5-FLEX-sgRNA</t> control viral particles (“sgC), both at 7 × 10 10 viral particles/0.5 µL/mouse; After 21 days RAB5IF protein expression in the primary mRMECs extracted from adult mice was shown (pooled from 4 mice/sample, n = 5 samples/group, 15 μg protein/lane for WB) ( B ); IB4 staining of retinal flat mounts, showing representative images, and quantification of vascular branch numbers. Scale bar = 100 μm ( C ). PAS staining of retinal tissue, showing representative images, and quantification of acellular capillary numbers. Scale bar = 60 μm ( D ). Evans blue (EB) leakage assay assessing retinal vascular leakage, showing representative images, and quantification of EB leakage. Scale bar = 1 mm ( E ). Tubb3/NeuN double staining of retinal flat mounts to label RGCs, showing representative images, and quantification of Tubb3 + /NeuN + cell numbers. Scale bar = 60 μm ( F ). RBPMS staining of retinal sections to label RGCs, showing representative images, and quantification of RBPMS + cell numbers. GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer. Scale bar = 200 μm ( G ). Expression of listed neuronal marker proteins in the retinal tissues was also tested (individual samples, n = 5 mice/group, 15 μg protein/lane) ( H ). I At P1, endothelial-targeted AAV (1 × 10 11 viral particles/7.5 µL/mouse) was injected retro-orbitally for RAB5IF knockdown (RAB5IF-eKD). Subsequently, listed neuronal markers were detected by Western blot at P6. (pooled from 8 mice/sample, n = 8 samples/group, 15 μg protein/lane for WB). Data are presented as means ± S.D; One-way ANOVA with Bonferroni’s post hoc test. n = 5 mice per group. Source data are provided as a Source Data file.
Single Guide (Sg)rnas, supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single-guide+rnas/pm35835952-38-7-16?v=ToolGen+Incorporated
Average 90 stars, based on 1 article reviews
single-guide (sg)rnas - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


A The TIE1-Cre C57 mice (six-seven weeks old) were intravitreously injected with AAV5-FLEX-GFP viral particles (7 × 10 10 viral particles/0.5 µL/mouse), followed by frozen sections and flat mount staining 21 days later to observe GFP-positive infection area. Scale bar = 100 μm / 50 μm. B – H The TIE1-Cre C57 mice (six-seven weeks old) were intravitreously injected with AAV5-FLEX-sgRAB5IF (RAB5IF-eCKO#1 and RAB5IF-eCKO#2, encoding non-overlapping sgRNAs against murine RAB5IF ) or AAV5-FLEX-sgRNA control viral particles (“sgC), both at 7 × 10 10 viral particles/0.5 µL/mouse; After 21 days RAB5IF protein expression in the primary mRMECs extracted from adult mice was shown (pooled from 4 mice/sample, n = 5 samples/group, 15 μg protein/lane for WB) ( B ); IB4 staining of retinal flat mounts, showing representative images, and quantification of vascular branch numbers. Scale bar = 100 μm ( C ). PAS staining of retinal tissue, showing representative images, and quantification of acellular capillary numbers. Scale bar = 60 μm ( D ). Evans blue (EB) leakage assay assessing retinal vascular leakage, showing representative images, and quantification of EB leakage. Scale bar = 1 mm ( E ). Tubb3/NeuN double staining of retinal flat mounts to label RGCs, showing representative images, and quantification of Tubb3 + /NeuN + cell numbers. Scale bar = 60 μm ( F ). RBPMS staining of retinal sections to label RGCs, showing representative images, and quantification of RBPMS + cell numbers. GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer. Scale bar = 200 μm ( G ). Expression of listed neuronal marker proteins in the retinal tissues was also tested (individual samples, n = 5 mice/group, 15 μg protein/lane) ( H ). I At P1, endothelial-targeted AAV (1 × 10 11 viral particles/7.5 µL/mouse) was injected retro-orbitally for RAB5IF knockdown (RAB5IF-eKD). Subsequently, listed neuronal markers were detected by Western blot at P6. (pooled from 8 mice/sample, n = 8 samples/group, 15 μg protein/lane for WB). Data are presented as means ± S.D; One-way ANOVA with Bonferroni’s post hoc test. n = 5 mice per group. Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: Endothelial RAB5IF is required for pathological and developmental retinal angiogenesis

doi: 10.1038/s41467-025-66212-x

Figure Lengend Snippet: A The TIE1-Cre C57 mice (six-seven weeks old) were intravitreously injected with AAV5-FLEX-GFP viral particles (7 × 10 10 viral particles/0.5 µL/mouse), followed by frozen sections and flat mount staining 21 days later to observe GFP-positive infection area. Scale bar = 100 μm / 50 μm. B – H The TIE1-Cre C57 mice (six-seven weeks old) were intravitreously injected with AAV5-FLEX-sgRAB5IF (RAB5IF-eCKO#1 and RAB5IF-eCKO#2, encoding non-overlapping sgRNAs against murine RAB5IF ) or AAV5-FLEX-sgRNA control viral particles (“sgC), both at 7 × 10 10 viral particles/0.5 µL/mouse; After 21 days RAB5IF protein expression in the primary mRMECs extracted from adult mice was shown (pooled from 4 mice/sample, n = 5 samples/group, 15 μg protein/lane for WB) ( B ); IB4 staining of retinal flat mounts, showing representative images, and quantification of vascular branch numbers. Scale bar = 100 μm ( C ). PAS staining of retinal tissue, showing representative images, and quantification of acellular capillary numbers. Scale bar = 60 μm ( D ). Evans blue (EB) leakage assay assessing retinal vascular leakage, showing representative images, and quantification of EB leakage. Scale bar = 1 mm ( E ). Tubb3/NeuN double staining of retinal flat mounts to label RGCs, showing representative images, and quantification of Tubb3 + /NeuN + cell numbers. Scale bar = 60 μm ( F ). RBPMS staining of retinal sections to label RGCs, showing representative images, and quantification of RBPMS + cell numbers. GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer. Scale bar = 200 μm ( G ). Expression of listed neuronal marker proteins in the retinal tissues was also tested (individual samples, n = 5 mice/group, 15 μg protein/lane) ( H ). I At P1, endothelial-targeted AAV (1 × 10 11 viral particles/7.5 µL/mouse) was injected retro-orbitally for RAB5IF knockdown (RAB5IF-eKD). Subsequently, listed neuronal markers were detected by Western blot at P6. (pooled from 8 mice/sample, n = 8 samples/group, 15 μg protein/lane for WB). Data are presented as means ± S.D; One-way ANOVA with Bonferroni’s post hoc test. n = 5 mice per group. Source data are provided as a Source Data file.

Article Snippet: For in vitro studies, lentiviral short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs) obtained from Shanghai Genechem Co. (Shanghai, China) were utilized for gene knockdown and knockout (KO) in hRMECs.

Techniques: Injection, Staining, Infection, Control, Expressing, Double Staining, Marker, Knockdown, Western Blot

A – E The human retinal microvascular endothelial cells (hRMECs) expressing the applied RAB5IF shRNAs (shRAB5IF#1, shRAB5IF#2 and shRAB5IF#3, with different shRNA sequences against RAB5IF ) or the scramble control shRNA (shC) were established, expression of RAB5IF mRNA and protein was shown ( n = 5 biological repeats, 15 μg protein/lane for WB) ( A ); Cells were further cultured for the indicated time periods, sprouting ( B ), cell proliferation (by testing EdU-positive nuclei ratio, C ), migration (Transwell assays, D ) and the capillary tube formation ( E ) were tested by the listed assays. F – J Stable hRMECs expressing the listed lentiviral CRISPR/Cas9-RAB5IF-KO construct (koRAB5IF#1/koRAB5IF#2, with different sgRNA sequences against RAB5IF ) or the control construct with non-sense sgRNA (koC) were established, and RAB5IF protein expression was tested ( n = 5 biological repeats, 15 μg protein/lane for WB) ( F ); Cells were further cultured for the indicated time periods, sprouting ( G ), cell proliferation (by testing EdU-positive nuclei ratio, H ), migration (Transwell assays, I ) and the capillary tube formation ( J ) and were tested. K , L Stable hRMECs with the designated genetic modifications on RAB5IF were cultured and subjected to Seahorse analyses to evaluate oxidative phosphorylation ( K ) and glycolysis ( L ). M – R Stable hRMECs with the lentiviral RAB5IF-expressing construct (oeRAB5IF-Sl1/oeRAB5IF-Sl2, two stable cell selections) or the empty vector (Vec) were established, expression of RAB5IF mRNA and protein was shown ( n = 5 biological repeats, 15 μg protein/lane for WB) ( M ); Cells were further cultured for the indicated time periods, sprouting ( N ), cell proliferation (by testing EdU-positive nuclei ratio, O ) and migration (Transwell assays, P ) were tested, with results quantified. Seahorse assays were also carried out to evaluate ATP contents ( Q ) and basal glycolysis levels ( R ). Data are presented as means ± S.D., n = 5 (biological repeats). “N.S.” indicates no statistical difference ( P > 0.05); One-way ANOVA with Bonferroni’s post hoc test. Scale bars = 100/200 μm. Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: Endothelial RAB5IF is required for pathological and developmental retinal angiogenesis

doi: 10.1038/s41467-025-66212-x

Figure Lengend Snippet: A – E The human retinal microvascular endothelial cells (hRMECs) expressing the applied RAB5IF shRNAs (shRAB5IF#1, shRAB5IF#2 and shRAB5IF#3, with different shRNA sequences against RAB5IF ) or the scramble control shRNA (shC) were established, expression of RAB5IF mRNA and protein was shown ( n = 5 biological repeats, 15 μg protein/lane for WB) ( A ); Cells were further cultured for the indicated time periods, sprouting ( B ), cell proliferation (by testing EdU-positive nuclei ratio, C ), migration (Transwell assays, D ) and the capillary tube formation ( E ) were tested by the listed assays. F – J Stable hRMECs expressing the listed lentiviral CRISPR/Cas9-RAB5IF-KO construct (koRAB5IF#1/koRAB5IF#2, with different sgRNA sequences against RAB5IF ) or the control construct with non-sense sgRNA (koC) were established, and RAB5IF protein expression was tested ( n = 5 biological repeats, 15 μg protein/lane for WB) ( F ); Cells were further cultured for the indicated time periods, sprouting ( G ), cell proliferation (by testing EdU-positive nuclei ratio, H ), migration (Transwell assays, I ) and the capillary tube formation ( J ) and were tested. K , L Stable hRMECs with the designated genetic modifications on RAB5IF were cultured and subjected to Seahorse analyses to evaluate oxidative phosphorylation ( K ) and glycolysis ( L ). M – R Stable hRMECs with the lentiviral RAB5IF-expressing construct (oeRAB5IF-Sl1/oeRAB5IF-Sl2, two stable cell selections) or the empty vector (Vec) were established, expression of RAB5IF mRNA and protein was shown ( n = 5 biological repeats, 15 μg protein/lane for WB) ( M ); Cells were further cultured for the indicated time periods, sprouting ( N ), cell proliferation (by testing EdU-positive nuclei ratio, O ) and migration (Transwell assays, P ) were tested, with results quantified. Seahorse assays were also carried out to evaluate ATP contents ( Q ) and basal glycolysis levels ( R ). Data are presented as means ± S.D., n = 5 (biological repeats). “N.S.” indicates no statistical difference ( P > 0.05); One-way ANOVA with Bonferroni’s post hoc test. Scale bars = 100/200 μm. Source data are provided as a Source Data file.

Article Snippet: For in vitro studies, lentiviral short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs) obtained from Shanghai Genechem Co. (Shanghai, China) were utilized for gene knockdown and knockout (KO) in hRMECs.

Techniques: Expressing, shRNA, Control, Cell Culture, Migration, CRISPR, Construct, Phospho-proteomics, Stable Transfection, Plasmid Preparation