shrna cassette Search Results


scrambled ineffective shrna cassette  (Shanghai GenePharma)
90
Shanghai GenePharma scrambled ineffective shrna cassette
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
Scrambled Ineffective Shrna Cassette, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scrambled ineffective shrna cassette/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
scrambled ineffective shrna cassette - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
custom mhp_shrna cassette  (GenScript corporation)
90
GenScript corporation custom mhp_shrna cassette
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
Custom Mhp Shrna Cassette, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/custom mhp_shrna cassette/product/GenScript corporation
Average 90 stars, based on 1 article reviews
custom mhp_shrna cassette - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
small hairpin rna (shrna) cassette targeting human cldn3  (Ribobio co)
90
Ribobio co small hairpin rna (shrna) cassette targeting human cldn3
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
Small Hairpin Rna (Shrna) Cassette Targeting Human Cldn3, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/small hairpin rna (shrna) cassette targeting human cldn3/product/Ribobio co
Average 90 stars, based on 1 article reviews
small hairpin rna (shrna) cassette targeting human cldn3 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
h1-promoter-driven shrna gene cassettes  (VectorBuilder GmbH)
90
VectorBuilder GmbH h1-promoter-driven shrna gene cassettes
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
H1 Promoter Driven Shrna Gene Cassettes, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/h1-promoter-driven shrna gene cassettes/product/VectorBuilder GmbH
Average 90 stars, based on 1 article reviews
h1-promoter-driven shrna gene cassettes - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
shrna cassettes specifically targeting the nucleotide of phb  (GenScript corporation)
90
GenScript corporation shrna cassettes specifically targeting the nucleotide of phb
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
Shrna Cassettes Specifically Targeting The Nucleotide Of Phb, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna cassettes specifically targeting the nucleotide of phb/product/GenScript corporation
Average 90 stars, based on 1 article reviews
shrna cassettes specifically targeting the nucleotide of phb - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
mini-mir30 based shrna cassette  (PSICOR Inc)
90
PSICOR Inc mini-mir30 based shrna cassette
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
Mini Mir30 Based Shrna Cassette, supplied by PSICOR Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mini-mir30 based shrna cassette/product/PSICOR Inc
Average 90 stars, based on 1 article reviews
mini-mir30 based shrna cassette - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)  (Shanghai GenePharma)
90
Shanghai GenePharma pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
Pgphi/Gfp/Neo Plasmid Containing Vegf Shrna Expression Cassette (Target 9 Sequence: Ggagtaccctgatgagatcga), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
three different shrna cassette sequences against the human task-3 gene (kcnk9; genbank accession number: nm_016601)  (GenScript corporation)
90
GenScript corporation three different shrna cassette sequences against the human task-3 gene (kcnk9; genbank accession number: nm_016601)
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
Three Different Shrna Cassette Sequences Against The Human Task 3 Gene (Kcnk9; Genbank Accession Number: Nm 016601), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/three different shrna cassette sequences against the human task-3 gene (kcnk9; genbank accession number: nm_016601)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
three different shrna cassette sequences against the human task-3 gene (kcnk9; genbank accession number: nm_016601) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
shrna cassettes against atm  (Broad Institute Inc)
90
Broad Institute Inc shrna cassettes against atm
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
Shrna Cassettes Against Atm, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna cassettes against atm/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
shrna cassettes against atm - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
u6 promoter shrna cassettes  (Twist Bioscience)
86
Twist Bioscience u6 promoter shrna cassettes
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
U6 Promoter Shrna Cassettes, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/u6 promoter shrna cassettes/product/Twist Bioscience
Average 86 stars, based on 1 article reviews
u6 promoter shrna cassettes - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
shrna cassettes  (Merck & Co)
86
Merck & Co shrna cassettes
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
Shrna Cassettes, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna cassettes/product/Merck & Co
Average 86 stars, based on 1 article reviews
shrna cassettes - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
atp binding cassette sub family a member 3 abca3 human shrna plasmid kit  (OriGene)
N/A
ABCA3 Human 4 unique 29mer shRNA constructs in retroviral GFP vector
   Buy from Supplier

Image Search Results


The effect of AGO2 knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control shRNA by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation

Journal: BMC Cancer

Article Title: Argonaute 2 and nasopharyngeal carcinoma: a genetic association study and functional analysis

doi: 10.1186/s12885-015-1895-4

Figure Lengend Snippet: The effect of AGO2 knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control shRNA by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation

Article Snippet: The AGO2 specific shRNA expression vectors and the scrambled ineffective shRNA cassette (as the negative control) in the pGPU6/GFP/Neo plasmid were purchased from GenePharma (China).

Techniques: Knockdown, Migration, Transfection, Control, shRNA, Western Blot, CCK-8 Assay, Staining, Transwell Assay, Cell Counting, Standard Deviation